Cannabinoids Alleviate the LPS-Induced Cytokine Storm via Attenuating NLRP3 Inflammasome Signaling and TYK2-Mediated STAT3 Signaling Pathways In Vitro
Abstract
:1. Introduction
2. Materials and Methods
2.1. Chemicals and Reagents
2.2. Cell Culture and Treatments
2.3. Immunoblotting
2.4. Immunoblotting for Mature IL-1β
2.5. Gene Expression
2.6. Multiplex Enzyme-Linked Immunosorbent Assay (ELISA)
2.7. Reactive Oxygen Species (ROS) Generation Assay
2.8. Trypan Blue Cell Viability Assay
2.9. Statistics
3. Results
3.1. CBD and THC Inhibit the Expression of NLRP3 Inflammasome Proteins in THP-1 Cells and HBECs to Downregulate the Expression of Mature IL-1β
3.2. CBD, but Not THC, Diminishes the Phosphorylation of NF-κB p-65 Subunit at Ser-536, Thereby Reducing the Expression of Inflammasome Proteins in THP-1 Cells and HBECs
3.3. CBD and THC Markedly Reduce the Increased Levels of IL-1β, IL-6, IL-8, and TNF-α after LPS Stimulation in THP-1 Cells and HBECs, Thus Curbing LPS-Mediated Cytokine Release
3.4. CBD and THC Curb the Cellular ROS Generation Induced by LPS in THP-1 Cells and HBECs
3.5. CBD and THC Decrease the Phosphorylation of STAT3 in Part via Reducing the Phosphorylation of TYK2 after LPS Stimulation in HBECs but Not in THP-1 Macrophages
4. Discussion
5. Limitations and Future Directions
6. Conclusions and Clinical Implications
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- World Health Organization—Noncommunicable Diseases (NCD) Country Profiles. 2018. Available online: https://www.who.int/nmh/countries/can_en.pdf?ua=1 (accessed on 16 June 2021).
- Working Together Globally: Canada’s World Health Organization (WHO) Collaborating Centre on Chronic Noncommunicable Disease Policy. Available online: https://www.canada.ca/en/public-health/corporate/mandate/about-agency/working-together-globally-canada-world-health-organization-collaborating-centre-chronic-noncommunicable-disease-policy.html (accessed on 16 June 2021).
- Prevalence of Chronic Diseases Among Canadian Adults. (Accession Number: 978-0-660-26218-5). 2019. Available online: https://www.canada.ca/en/public-health/services/chronic-diseases/prevalence-canadian-adults-infographic-2019.html (accessed on 16 June 2021).
- Elmslie, K. Against the Growing Burden of Disease. 2016. Available online: https://cagh-acsm.org/sites/default/files/resources/2016/10/elmslie.pdf (accessed on 17 June 2021).
- Suryavanshi, S.V.; Kovalchuk, I.; Kovalchuk, O. Cannabinoids as Key Regulators of Inflammasome Signaling: A Current Perspective. Front. Immunol. 2020, 11, 613613. [Google Scholar] [CrossRef] [PubMed]
- Fajgenbaum, D.C.; June, C.H. Cytokine Storm. N. Engl. J. Med. 2020, 383, 2255–2273. [Google Scholar] [CrossRef] [PubMed]
- Miossec, P. Understanding the cytokine storm during COVID-19: Contribution of preexisting chronic inflammation. Eur. J. Rheumatol. 2020, 7, S97–S98. [Google Scholar] [CrossRef]
- Smolen, J.S.; Schoels, M.M.; Nishimoto, N.; Breedveld, F.C.; Burmester, G.R.; Dougados, M.; Emery, P.; Ferraccioli, G.; Gabay, C.; Gibofsky, A.; et al. Consensus statement on blocking the effects of interleukin-6 and in particular by interleukin-6 receptor inhibition in rheumatoid arthritis and other inflammatory conditions. Ann. Rheum. Dis. 2013, 72, 482–492. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Freeman, T.L.; Swartz, T.H. Targeting the NLRP3 Inflammasome in Severe COVID-19. Front. Immunol. 2020, 11, 1518. [Google Scholar] [CrossRef]
- Ratajczak, M.Z.; Kucia, M. SARS-CoV-2 infection and overactivation of Nlrp3 inflammasome as a trigger of cytokine “storm” and risk factor for damage of hematopoietic stem cells. Leukemia 2020, 34, 1726–1729. [Google Scholar] [CrossRef] [PubMed]
- Hirano, T.; Murakami, M. COVID-19: A New Virus, but a Familiar Receptor and Cytokine Release Syndrome. Immunity 2020, 52, 731–733. [Google Scholar] [CrossRef] [PubMed]
- Yu, H.; Pardoll, D.; Jove, R. STATs in cancer inflammation and immunity: A leading role for STAT3. Nat. Rev. Cancer 2009, 9, 798–809. [Google Scholar] [CrossRef] [PubMed]
- Hojyo, S.; Uchida, M.; Tanaka, K.; Hasebe, R.; Tanaka, Y.; Murakami, M.; Hirano, T. How COVID-19 induces cytokine storm with high mortality. Inflamm. Regen. 2020, 40, 37. [Google Scholar] [CrossRef] [PubMed]
- Hirano, T. IL-6 in inflammation, autoimmunity and cancer. Int. Immunol. 2021, 33, 127–148. [Google Scholar] [CrossRef]
- Guo, H.; Callaway, J.B.; Ting, J.P. Inflammasomes: Mechanism of action, role in disease, and therapeutics. Nat. Med. 2015, 21, 677–687. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pairo-Castineira, E.; Clohisey, S.; Klaric, L.; Bretherick, A.D.; Rawlik, K.; Pasko, D.; Walker, S.; Parkinson, N.; Fourman, M.H.; Russell, C.D.; et al. Genetic mechanisms of critical illness in COVID-19. Nature 2021, 591, 92–98. [Google Scholar] [CrossRef]
- Kovalchuk, A.; Wang, B.; Li, D.; Rodriguez-Juarez, R.; Ilnytskyy, S.; Kovalchuk, I.; Kovalchuk, O. Fighting the storm: Could novel anti-TNFalpha and anti-IL-6 C. sativa cultivars tame cytokine storm in COVID-19? Aging 2021, 13, 1571–1590. [Google Scholar] [CrossRef]
- Nichols, J.M.; Kaplan, B.L.F. Immune Responses Regulated by Cannabidiol. Cannabis Cannabinoid Res. 2020, 5, 12–31. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Henshaw, F.R.; Dewsbury, L.S.; Lim, C.K.; Steiner, G.Z. The Effects of Cannabinoids on Pro- and Anti-Inflammatory Cytokines: A Systematic Review of In Vivo Studies. Cannabis Cannabinoid Res. 2021, 6, 177–195. [Google Scholar] [CrossRef] [PubMed]
- Peyravian, N.; Deo, S.; Daunert, S.; Jimenez, J.J. Cannabidiol as a Novel Therapeutic for Immune Modulation. Immunotargets Ther. 2020, 9, 131–140. [Google Scholar] [CrossRef] [PubMed]
- Liu, C.; Ma, H.; Slitt, A.L.; Seeram, N.P. Inhibitory Effect of Cannabidiol on the Activation of NLRP3 Inflammasome Is Associated with Its Modulation of the P2X7 Receptor in Human Monocytes. J. Nat. Prod. 2020, 83, 2025–2029. [Google Scholar] [CrossRef] [PubMed]
- Williams, J.C.; Klein, T.W.; Goldberger, B.A.; Sleasman, J.W.; Mackman, N.; Goodenow, M.M. Delta(9)-Tetrahydrocannabinol (THC) enhances lipopolysaccharide-stimulated tissue factor in human monocytes and monocyte-derived microvesicles. J. Inflamm. 2015, 12, 39. [Google Scholar] [CrossRef] [Green Version]
- Mohammed, A.; Alghetaa, H.F.K.; Miranda, K.; Wilson, K.; Singh, N.P.; Cai, G.; Putluri, N.; Nagarkatti, P.; Nagarkatti, M. Delta9-Tetrahydrocannabinol Prevents Mortality from Acute Respiratory Distress Syndrome through the Induction of Apoptosis in Immune Cells, Leading to Cytokine Storm Suppression. Int. J. Mol. Sci. 2020, 21, 6244. [Google Scholar] [CrossRef] [PubMed]
- Mohammed, A.; Alghetaa, H.; Sultan, M.; Singh, N.P.; Nagarkatti, P.; Nagarkatti, M. Administration of Delta9-Tetrahydrocannabinol (THC) Post-Staphylococcal Enterotoxin B Exposure Protects Mice From Acute Respiratory Distress Syndrome and Toxicity. Front. Pharmacol. 2020, 11, 893. [Google Scholar] [CrossRef]
- Huang, Y.; Wan, T.; Pang, N.; Zhou, Y.; Jiang, X.; Li, B.; Gu, Y.; Huang, Y.; Ye, X.; Lian, H.; et al. Cannabidiol protects livers against nonalcoholic steatohepatitis induced by high-fat high cholesterol diet via regulating NF-kappaB and NLRP3 inflammasome pathway. J. Cell. Physiol. 2019, 234, 21224–21234. [Google Scholar] [CrossRef]
- Rizzo, M.D.; Crawford, R.B.; Bach, A.; Sermet, S.; Amalfitano, A.; Kaminski, N.E. Delta(9)-Tetrahydrocannabinol Suppresses Monocyte-Mediated Astrocyte Production of Monocyte Chemoattractant Protein 1 and Interleukin-6 in a Toll-Like Receptor 7-Stimulated Human Coculture. J. Pharmacol. Exp. Ther. 2019, 371, 191–201. [Google Scholar] [CrossRef] [PubMed]
- Lund, M.E.; To, J.; O’Brien, B.A.; Donnelly, S. The choice of phorbol 12-myristate 13-acetate differentiation protocol influences the response of THP-1 macrophages to a pro-inflammatory stimulus. J. Immunol. Methods 2016, 430, 64–70. [Google Scholar] [CrossRef] [PubMed]
- Suryavanshi, S.V.; Jadhav, S.M.; Anderson, K.L.; Katsonis, P.; Lichtarge, O.; McConnell, B.K. Human muscle-specific A-kinase anchoring protein polymorphisms modulate the susceptibility to cardiovascular diseases by altering cAMP/PKA signaling. Am. J. Physiol. Heart Circ. Physiol. 2018, 315, H109–H121. [Google Scholar] [CrossRef]
- Brady, P.N.; Macnaughtan, M.A. Evaluation of colorimetric assays for analyzing reductively methylated proteins: Biases and mechanistic insights. Anal. Biochem. 2015, 491, 43–51. [Google Scholar] [CrossRef] [Green Version]
- Jakobs, C.; Bartok, E.; Kubarenko, A.; Bauernfeind, F.; Hornung, V. Immunoblotting for active caspase-1. Methods Mol. Biol. 2013, 1040, 103–115. [Google Scholar] [CrossRef]
- Strober, W. Trypan Blue Exclusion Test of Cell Viability. Curr. Protoc. Immunol. 2015, 111, A3B1–A3B3. [Google Scholar] [CrossRef]
- Yu, H.; Lin, L.; Zhang, Z.; Zhang, H.; Hu, H. Targeting NF-kappaB pathway for the therapy of diseases: Mechanism and clinical study. Signal Transduct. Target. Ther. 2020, 5, 209. [Google Scholar] [CrossRef] [PubMed]
- Liu, T.; Zhang, L.; Joo, D.; Sun, S.C. NF-kappaB signaling in inflammation. Signal Transduct. Target. Ther. 2017, 2, 17023. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Boaru, S.G.; Borkham-Kamphorst, E.; Van de Leur, E.; Lehnen, E.; Liedtke, C.; Weiskirchen, R. NLRP3 inflammasome expression is driven by NF-kappaB in cultured hepatocytes. Biochem. Biophys. Res. Commun. 2015, 458, 700–706. [Google Scholar] [CrossRef] [PubMed]
- Kozela, E.; Pietr, M.; Juknat, A.; Rimmerman, N.; Levy, R.; Vogel, Z. Cannabinoids Delta(9)-tetrahydrocannabinol and cannabidiol differentially inhibit the lipopolysaccharide-activated NF-kappaB and interferon-beta/STAT proinflammatory pathways in BV-2 microglial cells. J. Biol. Chem. 2010, 285, 1616–1626. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cruz, C.M.; Rinna, A.; Forman, H.J.; Ventura, A.L.; Persechini, P.M.; Ojcius, D.M. ATP activates a reactive oxygen species-dependent oxidative stress response and secretion of proinflammatory cytokines in macrophages. J. Biol. Chem. 2007, 282, 2871–2879. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hsu, H.Y.; Wen, M.H. Lipopolysaccharide-mediated reactive oxygen species and signal transduction in the regulation of interleukin-1 gene expression. J. Biol. Chem. 2002, 277, 22131–22139. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Raza, H.; John, A.; Shafarin, J. Potentiation of LPS-Induced Apoptotic Cell Death in Human Hepatoma HepG2 Cells by Aspirin via ROS and Mitochondrial Dysfunction: Protection by N-Acetyl Cysteine. PLoS ONE 2016, 11, e0159750. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Miscia, S.; Marchisio, M.; Grilli, A.; Di Valerio, V.; Centurione, L.; Sabatino, G.; Garaci, F.; Zauli, G.; Bonvini, E.; Di Baldassarre, A. Tumor necrosis factor alpha (TNF-alpha) activates Jak1/Stat3-Stat5B signaling through TNFR-1 in human B cells. Cell Growth Differ. 2002, 13, 13–18. [Google Scholar] [PubMed]
- Battagello, D.S.; Dragunas, G.; Klein, M.O.; Ayub, A.L.P.; Velloso, F.J.; Correa, R.G. Unpuzzling COVID-19: Tissue-related signaling pathways associated with SARS-CoV-2 infection and transmission. Clin. Sci. 2020, 134, 2137–2160. [Google Scholar] [CrossRef] [PubMed]
- Muller, S.; Chen, Y.; Ginter, T.; Schafer, C.; Buchwald, M.; Schmitz, L.M.; Klitzsch, J.; Schutz, A.; Haitel, A.; Schmid, K.; et al. SIAH2 antagonizes TYK2-STAT3 signaling in lung carcinoma cells. Oncotarget 2014, 5, 3184–3196. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wan, J.; Fu, A.K.; Ip, F.C.; Ng, H.K.; Hugon, J.; Page, G.; Wang, J.H.; Lai, K.O.; Wu, Z.; Ip, N.Y. Tyk2/STAT3 signaling mediates beta-amyloid-induced neuronal cell death: Implications in Alzheimer’s disease. J. Neurosci. 2010, 30, 6873–6881. [Google Scholar] [CrossRef] [Green Version]
- Furman, D.; Campisi, J.; Verdin, E.; Carrera-Bastos, P.; Targ, S.; Franceschi, C.; Ferrucci, L.; Gilroy, D.W.; Fasano, A.; Miller, G.W.; et al. Chronic inflammation in the etiology of disease across the life span. Nat. Med. 2019, 25, 1822–1832. [Google Scholar] [CrossRef] [PubMed]
- Ferrucci, L.; Fabbri, E. Inflammageing: Chronic inflammation in ageing, cardiovascular disease, and frailty. Nat. Rev. Cardiol. 2018, 15, 505–522. [Google Scholar] [CrossRef]
- The Emerging Risk Factors Collaboration; Kaptoge, S.; Di Angelantonio, E.; Lowe, G.; Pepys, M.B.; Thompson, S.G.; Collins, R.; Danesh, J. C-reactive protein concentration and risk of coronary heart disease, stroke, and mortality: An individual participant meta-analysis. Lancet 2010, 375, 132–140. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Teixeira, P.C.; Dorneles, G.P.; Santana Filho, P.C.; da Silva, I.M.; Schipper, L.L.; Postiga, I.A.L.; Neves, C.A.M.; Rodrigues Junior, L.C.; Peres, A.; Souto, J.T.; et al. Increased LPS levels coexist with systemic inflammation and result in monocyte activation in severe COVID-19 patients. Int. Immunopharmacol. 2021, 100, 108125. [Google Scholar] [CrossRef]
- Furman, D.; Chang, J.; Lartigue, L.; Bolen, C.R.; Haddad, F.; Gaudilliere, B.; Ganio, E.A.; Fragiadakis, G.K.; Spitzer, M.H.; Douchet, I.; et al. Expression of specific inflammasome gene modules stratifies older individuals into two extreme clinical and immunological states. Nat. Med. 2017, 23, 174–184. [Google Scholar] [CrossRef] [PubMed]
- Junqueira, C.; Crespo, A.; Ranjbar, S.; de Lacerda, L.B.; Lewandrowski, M.; Ingber, J.; Parry, B.; Ravid, S.; Clark, S.; Schrimpf, M.R.; et al. FcgammaR-mediated SARS-CoV-2 infection of monocytes activates inflammation. Nature 2022, 1–13. [Google Scholar] [CrossRef]
- Shen-Orr, S.S.; Furman, D.; Kidd, B.A.; Hadad, F.; Lovelace, P.; Huang, Y.W.; Rosenberg-Hasson, Y.; Mackey, S.; Grisar, F.A.; Pickman, Y.; et al. Defective Signaling in the JAK-STAT Pathway Tracks with Chronic Inflammation and Cardiovascular Risk in Aging Humans. Cell Syst. 2016, 3, 374–384.e374. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rodrigues, T.S.; de Sa, K.S.G.; Ishimoto, A.Y.; Becerra, A.; Oliveira, S.; Almeida, L.; Goncalves, A.V.; Perucello, D.B.; Andrade, W.A.; Castro, R.; et al. Inflammasomes are activated in response to SARS-CoV-2 infection and are associated with COVID-19 severity in patients. J. Exp. Med. 2021, 218, e20201707. [Google Scholar] [CrossRef] [PubMed]
- Paland, N.; Pechkovsky, A.; Aswad, M.; Hamza, H.; Popov, T.; Shahar, E.; Louria-Hayon, I. The Immunopathology of COVID-19 and the Cannabis Paradigm. Front. Immunol. 2021, 12, 631233. [Google Scholar] [CrossRef] [PubMed]
- Zhu, L.; Meng, Q.; Liang, S.; Ma, Y.; Li, R.; Li, G.; Zeng, H. The transcription factor GFI1 negatively regulates NLRP3 inflammasome activation in macrophages. FEBS Lett. 2014, 588, 4513–4519. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- McKallip, R.J.; Nagarkatti, M.; Nagarkatti, P.S. Delta-9-tetrahydrocannabinol enhances breast cancer growth and metastasis by suppression of the antitumor immune response. J. Immunol. 2005, 174, 3281–3289. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Szekely, Y.; Ingbir, M.; Bentur, O.S.; Hochner, O.; Porat, R. Natural cannabinoids suppress the cytokine storm in sepsis-like in vitro model. Eur. Cytokine Netw. 2020, 31, 50–58. [Google Scholar] [CrossRef] [PubMed]
- Ruiz-Valdepenas, L.; Martinez-Orgado, J.A.; Benito, C.; Millan, A.; Tolon, R.M.; Romero, J. Cannabidiol reduces lipopolysaccharide-induced vascular changes and inflammation in the mouse brain: An intravital microscopy study. J. Neuroinflamm. 2011, 8, 5. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zgair, A.; Lee, J.B.; Wong, J.C.M.; Taha, D.A.; Aram, J.; Di Virgilio, D.; McArthur, J.W.; Cheng, Y.K.; Hennig, I.M.; Barrett, D.A.; et al. Oral administration of cannabis with lipids leads to high levels of cannabinoids in the intestinal lymphatic system and prominent immunomodulation. Sci. Rep. 2017, 7, 14542. [Google Scholar] [CrossRef] [PubMed]
- Srivastava, M.D.; Srivastava, B.I.; Brouhard, B. Delta9 tetrahydrocannabinol and cannabidiol alter cytokine production by human immune cells. Immunopharmacology 1998, 40, 179–185. [Google Scholar] [CrossRef]
- Joffre, J.; Yeh, C.C.; Wong, E.; Thete, M.; Xu, F.; Zlatanova, I.; Lloyd, E.; Kobzik, L.; Legrand, M.; Hellman, J. Activation of CB1R Promotes Lipopolysaccharide-Induced IL-10 Secretion by Monocytic Myeloid-Derived Suppressive Cells and Reduces Acute Inflammation and Organ Injury. J. Immunol. 2020, 204, 3339–3350. [Google Scholar] [CrossRef] [PubMed]
- Chernyak, B.V.; Popova, E.N.; Prikhodko, A.S.; Grebenchikov, O.A.; Zinovkina, L.A.; Zinovkin, R.A. COVID-19 and Oxidative Stress. Biochemistry 2020, 85, 1543–1553. [Google Scholar] [CrossRef] [PubMed]
- Crapo, J.D. Oxidative stress as an initiator of cytokine release and cell damage. Eur. Respir. J. 2003, 44, 4–6. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Atalay, S.; Jarocka-Karpowicz, I.; Skrzydlewska, E. Antioxidative and Anti-Inflammatory Properties of Cannabidiol. Antioxidants 2019, 9, 21. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Raja, A.; Ahmadi, S.; de Costa, F.; Li, N.; Kerman, K. Attenuation of Oxidative Stress by Cannabinoids and Cannabis Extracts in Differentiated Neuronal Cells. Pharmaceuticals 2020, 13, 328. [Google Scholar] [CrossRef]
- De Simone, V.; Franze, E.; Ronchetti, G.; Colantoni, A.; Fantini, M.C.; Di Fusco, D.; Sica, G.S.; Sileri, P.; MacDonald, T.T.; Pallone, F.; et al. Th17-type cytokines, IL-6 and TNF-alpha synergistically activate STAT3 and NF-kB to promote colorectal cancer cell growth. Oncogene 2015, 34, 3493–3503. [Google Scholar] [CrossRef] [PubMed]
- Ribeiro, A.; Almeida, V.I.; Costola-de-Souza, C.; Ferraz-de-Paula, V.; Pinheiro, M.L.; Vitoretti, L.B.; Gimenes-Junior, J.A.; Akamine, A.T.; Crippa, J.A.; Tavares-de-Lima, W.; et al. Cannabidiol improves lung function and inflammation in mice submitted to LPS-induced acute lung injury. Immunopharmacol. Immunotoxicol. 2015, 37, 35–41. [Google Scholar] [CrossRef]
- Tedesco, S.; De Majo, F.; Kim, J.; Trenti, A.; Trevisi, L.; Fadini, G.P.; Bolego, C.; Zandstra, P.W.; Cignarella, A.; Vitiello, L. Convenience versus Biological Significance: Are PMA-Differentiated THP-1 Cells a Reliable Substitute for Blood-Derived Macrophages When Studying in Vitro Polarization? Front. Pharmacol. 2018, 9, 71. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bort, A.; Alvarado-Vazquez, P.A.; Moracho-Vilrriales, C.; Virga, K.G.; Gumina, G.; Romero-Sandoval, A.; Asbill, S. Effects of JWH015 in cytokine secretion in primary human keratinocytes and fibroblasts and its suitability for topical/transdermal delivery. Mol. Pain 2017, 13, 1744806916688220. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Primary Antibody | Manufacturer (Cat#) | Dilution |
---|---|---|
NLRP3 | CST (15101S) | 1:750 |
Caspase-1 | CST (4199S) | 1:500 |
IL-1β | SCBT (sc-32294) | 1:500 |
NFκB p65 | SCBT (sc-8008) | 1:750 |
phospho-NFκB p65 (Ser-536) | CST (13346S) | 1:750 |
STAT-3 | SCBT (sc-8019) | 1:750 |
phospho-STAT3 (Tyr-705) | SCBT (sc-8059) | 1:750 |
STAT-1 | Abcam (ab109320) | 1:2000 |
phospho-STAT1 (Ser-727) | Abcam (ab109461) | 1:2000 |
TYK2 | CST (14193S) | 1:1000 |
phospho-TYK2 (Tyr-1054/1055) | CST (9321S) | 1:500 |
GAPDH | SCBT (sc-32233) | 1:1000 |
β-actin | SCBT (sc-47778) | 1:1000 |
Gene Name | Forward Primer | Reverse Primer |
---|---|---|
Nlrp3 | GAAGAGGAGTGGATGGGTTTAC | TCTGCTTCTCACGTACTTTCTG |
Il-1β | CCTTAGGGTAGTGCTAAGAGGA | AAGTGAGTAGGAGAGGTGAGAG |
Tyk2 | CAAATGTCCCTGTGAGGTCTATC | GGACTGTCTTCAGAATGGGTATG |
Gapdh | CAGGAGGCATTGCTGATGAT | GAAGGCTGGGGCTCATTT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Suryavanshi, S.V.; Zaiachuk, M.; Pryimak, N.; Kovalchuk, I.; Kovalchuk, O. Cannabinoids Alleviate the LPS-Induced Cytokine Storm via Attenuating NLRP3 Inflammasome Signaling and TYK2-Mediated STAT3 Signaling Pathways In Vitro. Cells 2022, 11, 1391. https://doi.org/10.3390/cells11091391
Suryavanshi SV, Zaiachuk M, Pryimak N, Kovalchuk I, Kovalchuk O. Cannabinoids Alleviate the LPS-Induced Cytokine Storm via Attenuating NLRP3 Inflammasome Signaling and TYK2-Mediated STAT3 Signaling Pathways In Vitro. Cells. 2022; 11(9):1391. https://doi.org/10.3390/cells11091391
Chicago/Turabian StyleSuryavanshi, Santosh V., Mariia Zaiachuk, Nazar Pryimak, Igor Kovalchuk, and Olga Kovalchuk. 2022. "Cannabinoids Alleviate the LPS-Induced Cytokine Storm via Attenuating NLRP3 Inflammasome Signaling and TYK2-Mediated STAT3 Signaling Pathways In Vitro" Cells 11, no. 9: 1391. https://doi.org/10.3390/cells11091391