miR-34a Regulates Lipid Droplet Deposition in 3T3-L1 and C2C12 Cells by Targeting LEF1
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animal Experiments
2.2. RNA Isolation, Library Preparation, and Sequencing Analysis
2.3. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) Enrichment Analyses
2.4. Gene and Protein Expression Analyses
2.5. Cell Culture and Treatments
2.6. Lef1 and miR-34a Mimics and Silencing
2.7. Oil Red O Staining
2.8. RNA Fluorescence In Situ Hybridization (RNA FISH)
2.9. BODIPY Staining
2.10. Immunofluorescence Staining
2.11. Dual Luciferase Reporter Assay
2.12. Statistical Analysis
3. Results
3.1. GO and KEGG Analysis Indicated the Involvement of miRNAs in Lipid Storage and Fatty Acid Metabolism
3.2. miR-34a and Lef1 Show Opposite Expression Patterns during the Differentiation of 3T3-L1-Derived Adipocytes
3.3. Lef1 Is a Target of miR-34a
3.4. miR-34a Promoted Adipogenesis
3.5. miR-34a Promoted Fat Deposition by Suppressing Lef1 during 3T3-L1 Differentiation
3.6. miR-34a/Lef1 Promoted Lipid Droplet Accumulation in C2C12 Cells
3.7. miR-34a Increased Fat Deposition in 3T3-L1 and C2C12 Cells Co-Culture System
3.8. miR-34a Increased IMF Deposition in C2C12 Cells Incubated with the Adipogenic Conditioned Medium
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Fernandez, X.; Monin, G.; Talmant, A.; Mourot, J.; Lebret, B. Influence of intramuscular fat content on the quality of pig meat—1. Composition of the lipid fraction and sensory characteristics of m. longissimus lumborum. Meat Sci. 1999, 53, 59–65. [Google Scholar] [CrossRef] [PubMed]
- Park, S.J.; Beak, S.; Da Jin Sol Jung, S.Y.; Kim, I.H.J.; Piao, M.Y.; Kang, H.J.; Fassah, D.M.; Na, S.W.; Yoo, S.P.; Baik, M. Genetic, management, and nutritional factors affecting intramuscular fat deposition in beef cattle—A review. Asian-Australas. J. Anim. Sci. 2018, 31, 1043. [Google Scholar] [CrossRef] [Green Version]
- Poklukar, K.; Čandek-Potokar, M.; Batorek Lukač, N.; Tomažin, U.; Škrlep, M. Lipid deposition and metabolism in local and modern pig breeds: A review. Animals 2020, 10, 424. [Google Scholar] [CrossRef] [Green Version]
- Wang, L.; Shan, T. Factors inducing transdifferentiation of myoblasts into adipocytes. J. Cell. Physiol. 2021, 236, 2276–2289. [Google Scholar] [CrossRef] [PubMed]
- Zhou, C.; Li, P.; Han, M.; Gao, X. Daidzein stimulates fatty acid-induced fat deposition in C2C12 myoblast cells via the G protein-coupled receptor 30 pathway. Anim. Biotechnol. 2020, 33, 851–863. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Wang, J.; Zhou, X.; Cao, H.; Zhang, X.; Huang, K.; Li, X.; Yang, G. miR-324-5p Inhibits C2C12 cell Differentiation and Promotes Intramuscular Lipid Deposition through lncDUM and PM20D1. Mol. Ther. Nucleic Acids 2020, 22, 722–732. [Google Scholar] [CrossRef]
- Herms, A.; Bosch, M.; Ariotti, N.; Reddy, B.J.; Fajardo, A.; Fernández-Vidal, A.; Alvarez-Guaita, A.; Fernández-Rojo, M.A.; Rentero, C.; Tebar, F. Cell-to-cell heterogeneity in lipid droplets suggests a mechanism to reduce lipotoxicity. Curr. Biol. 2013, 23, 1489–1496. [Google Scholar] [CrossRef] [Green Version]
- Bartel, D.P. MicroRNAs: Target recognition and regulatory functions. Cell 2009, 136, 215–233. [Google Scholar] [CrossRef] [Green Version]
- Lim, L.P.; Lau, N.C.; Weinstein, E.G.; Abdelhakim, A.; Yekta, S.; Rhoades, M.W.; Burge, C.B.; Bartel, D.P. The microRNAs of Caenorhabditis elegans. Gene. Dev. 2003, 17, 991–1008. [Google Scholar] [CrossRef] [Green Version]
- Baek, D.; Villén, J.; Shin, C.; Camargo, F.D.; Gygi, S.P.; Bartel, D.P. The impact of microRNAs on protein output. Nature 2008, 455, 64–71. [Google Scholar] [CrossRef]
- Zhang, X.; Zuo, X.; Yang, B.; Li, Z.; Xue, Y.; Zhou, Y.; Huang, J.; Zhao, X.; Zhou, J.; Yan, Y. MicroRNA directly enhances mitochondrial translation during muscle differentiation. Cell 2014, 158, 607–619. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ni, W.; Leng, X. Dynamic miRNA–mRNA paradigms: New faces of miRNAs. Biochem. Biophy. Rep. 2015, 4, 337–341. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vasudevan, S.; Tong, Y.; Steitz, J.A. Switching from repression to activation: microRNAs can up-regulate translation. Science 2007, 318, 1931–1934. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ling, H.Y.; Wen, G.B.; Feng, S.D.; Tuo, Q.H.; Ou, H.S.; Yao, C.H.; Zhu, B.Y.; Gao, Z.P.; Zhang, L.; Liao, D.F. MicroRNA-375 promotes 3T3-L1 adipocyte differentiation through modulation of extracellular signal-regulated kinase signalling. Clin. Exp. Pharmacol. Physiol. 2011, 38, 239–246. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, S.; Sun, G.; Yuan, B.; Zhang, L.; Gao, Y.; Jiang, H.; Dai, L.; Zhang, J. miR-375 negatively regulates porcine preadipocyte differentiation by targeting BMPR 2. FEBS Lett. 2016, 590, 1417–1427. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xu, J.; Zhang, L.; Shu, G.; Wang, B. microRNA-16–5p promotes 3T3-L1 adipocyte differentiation through regulating EPT1. Biochem. Biophys. Res. Commun. 2019, 514, 1251–1256. [Google Scholar] [CrossRef]
- Liu, K.; Zhang, X.; Wei, W.; Liu, X.; Tian, Y.; Han, H.; Zhang, L.; Wu, W.; Chen, J. Myostatin/SMAD4 signaling-mediated regulation of miR-124-3p represses glucocorticoid receptor expression and inhibits adipocyte differentiation. Am. J. Physiol. Endoc. M. 2019, 316, E635–E645. [Google Scholar] [CrossRef]
- Giese, K.; Kingsley, C.; Kirshner, J.R.; Grosschedl, R. Assembly and function of a TCR alpha enhancer complex is dependent on LEF-1-induced DNA bending and multiple protein-protein interactions. Gene. Dev. 1995, 9, 995–1008. [Google Scholar] [CrossRef] [Green Version]
- De Winter, T.J.; Nusse, R. Running Against the Wnt: How Wnt/β-Catenin Suppresses Adipogenesis. Front. Cell Dev. Biol. 2021, 9, 140. [Google Scholar] [CrossRef]
- Li, L.; Yuan, L.; Luo, J.; Gao, J.; Guo, J.; Xie, X. MiR-34a inhibits proliferation and migration of breast cancer through down-regulation of Bcl-2 and SIRT1. Clin. Exp. Med. 2013, 13, 109–117. [Google Scholar] [CrossRef]
- Ding, J.; Li, M.; Wan, X.; Jin, X.; Chen, S.; Yu, C.; Li, Y. Effect of miR-34a in regulating steatosis by targeting PPARα expression in nonalcoholic fatty liver disease. Sci. Rep. 2015, 5, 13729. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Huang, Y.; Zhou, L.; Zhang, J.; Liu, X.; Huang, L. A large-scale comparison of meat quality and intramuscular fatty acid composition among three Chinese indigenous pig breeds. Meat Sci. 2020, 168, 108182. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Xie, Y.; Chen, W.; Zhang, Y.; Zeng, Y. Identification and functional prediction of long noncoding RNAs related to intramuscular fat content in Laiwu pigs. Anim. Biosci. 2021, 35, 115. [Google Scholar] [CrossRef] [PubMed]
- Langmead, B.; Trapnell, C.; Pop, M.; Salzberg, S.L. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol. 2009, 10, R25. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Young, M.D.; Wakefield, M.J.; Smyth, G.K.; Oshlack, A. goseq: Gene Ontology testing for RNA-seq datasets. R Bioconductor 2012, 8, 1–25. [Google Scholar]
- Kanehisa, M.; Araki, M.; Goto, S.; Hattori, M.; Hirakawa, M.; Itoh, M.; Katayama, T.; Kawashima, S.; Okuda, S.; Tokimatsu, T. KEGG for linking genomes to life and the environment. Nucleic Acids Res. 2007, 36, D480–D484. [Google Scholar] [CrossRef]
- Mao, X.; Cai, T.; Olyarchuk, J.G.; Wei, L. Automated genome annotation and pathway identification using the KEGG Orthology (KO) as a controlled vocabulary. Bioinformatics 2005, 21, 3787–3793. [Google Scholar] [CrossRef]
- Xiang, A.; Chu, G.; Zhu, Y.; Ma, G.; Yang, G.; Sun, S. IGFBP5 suppresses oleate-induced intramyocellular lipids deposition and enhances insulin signaling. J. Cell. Physiol. 2019, 234, 15288–15298. [Google Scholar] [CrossRef]
- Buxadé, M.; Huerga Encabo, H.; Riera-Borrull, M.; Quintana-Gallardo, L.; López-Cotarelo, P.; Tellechea, M.; Martínez-Martínez, S.; Redondo, J.M.; Martín-Caballero, J.; Flores, J.M. Macrophage-specific MHCII expression is regulated by a remote Ciita enhancer controlled by NFAT5. J. Exp. Med. 2018, 215, 2901–2918. [Google Scholar] [CrossRef] [Green Version]
- Man, X.; Tan, S.; Tang, H.; Guo, Y.; Tang, C.; Tang, J.; Zhou, C.; Zhou, H. MiR-503 inhibits adipogenesis by targeting bone morphogenetic protein receptor 1a. Am. J. Transl. Res. 2016, 8, 2727. [Google Scholar]
- Singh, R.; Artaza, J.N.; Taylor, W.E.; Braga, M.; Yuan, X.; Gonzalez-Cadavid, N.F.; Bhasin, S. Testosterone inhibits adipogenic differentiation in 3T3-L1 cells: Nuclear translocation of androgen receptor complex with β-catenin and T-cell factor 4 may bypass canonical Wnt signaling to down-regulate adipogenic transcription factors. Endocrinology 2006, 147, 141–154. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, X.; Fu, X.; Yang, G.; Du, M. Enhancing intramuscular fat development via targeting fibro-adipogenic progenitor cells in meat animals. Animal 2020, 14, 312–321. [Google Scholar] [CrossRef] [PubMed]
- Chen, W.; Fang, G.; Wang, S.; Wang, H.; Zeng, Y. Longissimus lumborum muscle transcriptome analysis of Laiwu and Yorkshire pigs differing in intramuscular fat content. Genes Genom. 2017, 39, 759–766. [Google Scholar] [CrossRef]
- Bommer, G.T.; Gerin, I.; Feng, Y.; Kaczorowski, A.J.; Kuick, R.; Love, R.E.; Zhai, Y.; Giordano, T.J.; Qin, Z.S.; Moore, B.B. p53-mediated activation of miRNA34 candidate tumor-suppressor genes. Curr. Biol. 2007, 17, 1298–1307. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhao, E.; Keller, M.P.; Rabaglia, M.E.; Oler, A.T.; Stapleton, D.S.; Schueler, K.L.; Neto, E.C.; Moon, J.Y.; Wang, P.; Wang, I. Obesity and genetics regulate microRNAs in islets, liver, and adipose of diabetic mice. Mamm. Genome 2009, 20, 476–485. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ortega, F.J.; Moreno-Navarrete, J.M.; Pardo, G.; Sabater, M.; Hummel, M.; Ferrer, A.; Rodriguez-Hermosa, J.I.; Ruiz, B.; Ricart, W.; Peral, B. MiRNA expression profile of human subcutaneous adipose and during adipocyte differentiation. PLoS ONE 2010, 5, e9022. [Google Scholar] [CrossRef] [Green Version]
- Fu, T.; Seok, S.; Choi, S.; Huang, Z.; Suino-Powell, K.; Xu, H.E.; Kemper, B.; Kemper, J.K. MicroRNA 34a inhibits beige and brown fat formation in obesity in part by suppressing adipocyte fibroblast growth factor 21 signaling and SIRT1 function. Mol. Cell. Biol. 2014, 34, 4130–4142. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sun, Y.; Qin, J.; Liu, S.; Cai, R.; Chen, X.; Wang, X.; Pang, W. PDGFRα regulated by miR-34a and FoxO1 promotes adipogenesis in porcine intramuscular preadipocytes through Erk signaling pathway. Int. J. Mole. Sci. 2017, 18, 2424. [Google Scholar] [CrossRef] [Green Version]
- Park, C.W.; Zeng, Y.; Zhang, X.; Subramanian, S.; Steer, C.J. Mature microRNAs identified in highly purified nuclei from HCT116 colon cancer cells. RNA Biol. 2010, 7, 606–614. [Google Scholar] [CrossRef] [Green Version]
- Bian, Z.; Li, L.; Tang, R.; Hou, D.; Chen, X.; Zhang, C.; Zen, K. Identification of mouse liver mitochondria-associated miRNAs and their potential biological functions. Cell Res. 2010, 20, 1076–1078. [Google Scholar] [CrossRef] [Green Version]
- Long, L.; Zhang, X.; Bai, J.; Li, Y.; Wang, X.; Zhou, Y. Tissue-specific and exosomal miRNAs in lung cancer radiotherapy: From regulatory mechanisms to clinical implications. Cancer Manag. Res. 2019, 11, 4413. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Asally, M.; Yoneda, Y. β-catenin can act as a nuclear import receptor for its partner transcription factor, lymphocyte enhancer factor-1 (lef-1). Exp. Cell Res. 2005, 308, 357–363. [Google Scholar] [CrossRef] [PubMed]
- Buchan, J.R.; Parker, R. The two faces of miRNA. Science 2007, 318, 1877–1878. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Greenwood, P.L.; Walmsley, B.J.; Oddy, V.H. Regulation of growth and development of skeletal muscle and adipocytes and its impact on efficiency and meat quality. In Energy and Protein Metabolism and Nutrition; EAAP Publication No. 138; Chizzotti, M., Ed.; Wageningen Academic Publishers: Wageningen, The Netherlands, 2019; pp. 53–71. [Google Scholar]
- Pandurangan, M.; Jeong, D.; Amna, T.; Van Ba, H.; Hwang, I. Co-culture of C2C12 and 3T3-L1 preadipocyte cells alters the gene expression of calpains, caspases and heat shock proteins. Vitr. Cell. Dev.-An. 2012, 48, 577–582. [Google Scholar] [CrossRef]
- Shang, Y.C.; Zhang, C.; Wang, S.H.; Xiong, F.; Zhao, C.P.; Peng, F.N.; Feng, S.W.; Yu, M.J.; Li, M.S.; Zhang, Y.N. Activated β-catenin induces myogenesis and inhibits adipogenesis in BM-derived mesenchymal stromal cells. Cytotherapy 2007, 9, 667–681. [Google Scholar] [CrossRef]
- Chen, N.; Wang, J. Wnt/β-catenin signaling and obesity. Front. Physiol. 2018, 9, 792. [Google Scholar] [CrossRef] [Green Version]
- Pham, H.G.; Park, J.P.; Yun, J.W. BMP11 Negatively Regulates Lipid Metabolism in C2C12 Muscle Cells. Biotechnol. Bioproc. Eng. 2020, 25, 670–680. [Google Scholar] [CrossRef]
- Li, L.; Ma, J.; Li, S.; Chen, X.; Zhang, J. Vascular endothelial growth factor B inhibits lipid accumulation in C2C12 myotubes incubated with fatty acids. Growth Factors 2019, 37, 76–84. [Google Scholar] [CrossRef]
- Pandurangan, M.; Hwang, I. Application of cell co-culture system to study fat and muscle cells. Appl. Microbiol. Biot. 2014, 98, 7359–7364. [Google Scholar] [CrossRef]
- Yao, F.; Yu, Y.; Feng, L.; Li, J.; Zhang, M.; Lan, X.; Yan, X.; Liu, Y.; Guan, F.; Zhang, M. Adipogenic miR-27a in adipose tissue upregulates macrophage activation via inhibiting PPARγ of insulin resistance induced by high-fat diet-associated obesity. Exp. Cell Res. 2017, 355, 105–112. [Google Scholar] [CrossRef]
- Seo, K.; Suzuki, T.; Kobayashi, K.; Nishimura, T. Adipocytes suppress differentiation of muscle cells in a co-culture system. Anim. Sci. J. 2019, 90, 423–434. [Google Scholar] [CrossRef] [PubMed]
- Marques, B.G.; Hausman, D.B.; Martin, R.J. Association of fat cell size and paracrine growth factors in development of hyperplastic obesity. Am. J. Physiol. Regul. Integr. Comp. Physiol. 1998, 275, R1898–R1908. [Google Scholar] [CrossRef] [PubMed]
- Camussi, G.; Deregibus, M.; Bruno, S.; Grange, C.; Fonsato, V.; Tetta, C. Exosome/microvesicle-mediated epigenetic reprogramming of cells. Am. J. Cancer Res. 2011, 1, 98. [Google Scholar]
- Zernecke, A.; Bidzhekov, K.; Noels, H.; Shagdarsuren, E.; Gan, L.; Denecke, B.; Hristov, M.; Köppel, T.; Jahantigh, M.N.; Lutgens, E. Delivery of microRNA-126 by apoptotic bodies induces CXCL12-dependent vascular protection. Sci. Signal. 2009, 2, a81. [Google Scholar] [CrossRef]
- Deng, Z.; Poliakov, A.; Hardy, R.W.; Clements, R.; Liu, C.; Liu, Y.; Wang, J.; Xiang, X.; Zhang, S.; Zhuang, X. Adipose tissue exosome-like vesicles mediate activation of macrophage-induced insulin resistance. Diabetes 2009, 58, 2498–2505. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ferrante, S.C.; Nadler, E.P.; Pillai, D.K.; Hubal, M.J.; Wang, Z.; Wang, J.M.; Gordish-Dressman, H.; Koeck, E.; Sevilla, S.; Wiles, A.A. Adipocyte-derived exosomal miRNAs: A novel mechanism for obesity-related disease. Pediatr. Res. 2015, 77, 447–454. [Google Scholar] [CrossRef] [PubMed]
- Zanotti, S.; Gibertini, S.; Blasevich, F.; Bragato, C.; Ruggieri, A.; Saredi, S.; Fabbri, M.; Bernasconi, P.; Maggi, L.; Mantegazza, R. Exosomes and exosomal miRNAs from muscle-derived fibroblasts promote skeletal muscle fibrosis. Matrix Biol. 2018, 74, 77–100. [Google Scholar] [CrossRef] [PubMed]
Gene | Accession Number | Species | Sequence (5′-3′) |
---|---|---|---|
Myhc | AH002050 | mouse | F: GGAGCAGACGGAGAGGAGCAG |
R: TTGGTGTTGATGAGGCTGGTGTTC | |||
Myod | M84918 | mouse | F: TCCAACTGCTCTGATGGCATGATG |
R: ACTGTAGTAGGCGGTGTCGTAGC | |||
Plin1 | NM_175640 | mouse | F: GCACAACCTGGCAGCCTCTC |
R: CTTCCTCCTCCTCGTCGTCTGTC | |||
Fabp4 | CT010390 | mouse | F: AAATCACCGCAGACGACAGGAAG |
R: CATTCCACCACCAGCTTGTCACC | |||
Cebpa | NM_001287523 | mouse | F: GAGGGGAGGGACTTAGGTGTTGG |
R: CCTGGCCTGTTGTAAGCTGAGTG | |||
Lef1 | NM_010703 | mouse | F: CAACTAGAAAGCCAGCGACCAGAG |
R: GGAAAATGAAGACAGGAGCGAGAGG | |||
LEF1 | NM_001129967 | sus scrofa | F: GGGTCGGGCTGTGTGTGTTTC |
R: CTCAGGGAGTCGGCAGTGGAG | |||
Pparg | CT010340 | mouse | F: GTTCGCCAAGGTGCTCCAGAAG |
R: GTGAAGGCTCATGTCTGTCTCTGTC | |||
PPARG | NM_214379 | sus scrofa | F: TCTGTGGACCTGTCGGTGATGG |
R: TCAGCTCTCGGGAATGGGATGTC | |||
β-actin | AY618569 | mouse | F: CAGATGTGGATCAGCAAGCAGGAG |
R: CAGTAACAGTCCGCCTAGAAGCAC | |||
β-ACTIN | AJ312193 | sus scrofa | F: AATCCTGCGGCATCCACGAAAC |
R: CAGCACCGTGTTGGCGTAGAG | |||
miR-34a | NR_029751 | mouse/sus scrofa | F: CTGGCAGTGTCTTAGCTGGTTGTT |
U6 | NM_015816 | mouse/sus scrofa | F: ACGATACCCGCAAGGATGACA |
miR-34a mimics | mouse | F: UGGCAGUGUCUUAGCUGGUUGU | |
R: AACCAGCUAAGACACUGCCAUU | |||
mimicsNC | mouse | F: UUCUCCGAACGUGUCACGUTT | |
R: ACGUGACACGUUCGGAGAATT | |||
miR-34ainhibitor | mouse | F: ACAACCAGCUAAGACACUGCCA | |
inhibitor NC | mouse | F: CAGUACUUUUGUGUAGUACAA | |
siLef1 | mouse | F: CGUCAGAUGUCAACUCCAATT | |
R: UUGGAGUUGACAUCUGACGTT | |||
siNC | mouse | F: UUCUCCGAACGUGUCACGUTT | |
R: ACGUGACACGUUCGGAGAATT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, L.; Xie, Y.; Chen, W.; Zhang, Y.; Zeng, Y. miR-34a Regulates Lipid Droplet Deposition in 3T3-L1 and C2C12 Cells by Targeting LEF1. Cells 2023, 12, 167. https://doi.org/10.3390/cells12010167
Wang L, Xie Y, Chen W, Zhang Y, Zeng Y. miR-34a Regulates Lipid Droplet Deposition in 3T3-L1 and C2C12 Cells by Targeting LEF1. Cells. 2023; 12(1):167. https://doi.org/10.3390/cells12010167
Chicago/Turabian StyleWang, Lixue, Yuhuai Xie, Wei Chen, Yu Zhang, and Yongqing Zeng. 2023. "miR-34a Regulates Lipid Droplet Deposition in 3T3-L1 and C2C12 Cells by Targeting LEF1" Cells 12, no. 1: 167. https://doi.org/10.3390/cells12010167