Bovine HOXA11 Gene Identified from RNA-Seq: mRNA Profile Analysis and Genetic Variation Detection Using ME Method and Their Associations with Carcass Traits
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals’ Welfare
2.2. Cell Culture
2.3. Total RNA Isolation, cDNA Synthesis and Quantitative Real-Time PCR (qRT-PCR)
2.4. Samples and Data Collection
2.5. Genomic DNA Isolation, PCR Amplification and Genotyping by ME Method
2.6. Statistical Analysis of Population Genetics
3. Results
3.1. Expression Profiles of HOXA11 in Bovine Tissues, Myoblasts and Adipocytes
3.2. Identification of InDels by the ME Method and Sequencing Validation
3.3. Genotypic Frequencies and Population Indices
3.4. Linkage Disequilibrium (LD) and Haplotype Analyses
3.5. Association Analysis between HOXA11 InDels/Diplotypes and Carcass Traits
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Silva-Vignato, B.; Coutinho, L.L.; Poleti, M.D.; Cesar, A.S.; Moncau, C.T.; Regitano, L.C.; Balieiro, J.C. Gene co-expression networks associated with carcass traits reveal new pathways for muscle and fat deposition in Nelore cattle. BMC Genom. 2019, 20, 32. [Google Scholar] [CrossRef]
- Hay, E.H.; Roberts, A. Genome-wide association study for carcass traits in a composite beef cattle breed. Livest. Sci. 2018, 213, 35–43. [Google Scholar] [CrossRef]
- Jin, Y.; Yang, Q.; Zhang, M.; Zhang, S.; Cai, H.; Dang, R.; Lei, C.; Chen, H.; Lan, X. Identification of a Novel Polymorphism in Bovine lncRNA ADNCR Gene and Its Association with Growth Traits. Anim. Biotechnol. 2019, 30, 159–165. [Google Scholar] [CrossRef]
- Li, H.; Xu, H.; Akhatayeva, Z.; Liu, H.; Lin, C.; Han, X.; Lu, X.; Lan, X.; Zhang, Q.; Pan, C. Novel indel variations of the sheep FecB gene and their effects on litter size. Gene 2021, 767, 145176. [Google Scholar] [CrossRef]
- Niu, Q.; Zhang, T.; Xu, L.; Wang, T.; Wang, Z.; Zhu, B.; Zhang, L.; Gao, H.; Song, J.; Li, J.; et al. Integration of selection signatures and multi-trait GWAS reveals polygenic genetic architecture of carcass traits in beef cattle. Genomics 2021, 113, 3325–3336. [Google Scholar] [CrossRef]
- Chang, T.; Xia, J.; Xu, L.; Wang, X.; Zhu, B.; Zhang, L.; Gao, X.; Chen, Y.; Li, J.; Gao, H. A genome-wide association study suggests several novel candidate genes for carcass traits in Chinese Simmental beef cattle. Anim. Genet. 2018, 49, 312–316. [Google Scholar] [CrossRef]
- Choi, Y.; Davis, M.E.; Chung, H. Effects of genetic variants in the promoter region of the bovine adiponectin (ADIPOQ) gene on marbling of Hanwoo beef cattle. Meat Sci. 2015, 105, 57–62. [Google Scholar] [CrossRef]
- He, H.; Liu, X.; Gu, Y.; Liu, Y. A novel 18-bp deletion mutation of the AMPD1 gene affects carcass traits in Qinchuan cattle. Mol. Biol. Rep. 2010, 37, 3945–3949. [Google Scholar] [CrossRef]
- Rinn, J.L.; Kertesz, M.; Wang, J.K.; Squazzo, S.L.; Xu, X.; Brugmann, S.A.; Goodnough, L.H.; Helms, J.A.; Farnham, P.J.; Segal, E.; et al. Functional Demarcation of Active and Silent Chromatin Domains in Human HOX Loci by Noncoding RNAs. Cell 2007, 129, 1311–1323. [Google Scholar] [CrossRef]
- Amores, A.; Force, A.; Yan, Y.-L.; Joly, L.; Amemiya, C.; Fritz, A.; Ho, R.K.; Langeland, J.; Prince, V.; Wang, Y.-L.; et al. Zebrafish hox Clusters and Vertebrate Genome Evolution. Science 1998, 282, 1711–1714. [Google Scholar] [CrossRef]
- Hombría, J.C.; Lovegrove, B. Beyond homeosis—HOX function in morphogenesis and organogenesis. Differentiation 2003, 71, 461–476. [Google Scholar] [CrossRef] [PubMed]
- Poliacikova, G.; Maurel-Zaffran, C.; Graba, Y.; Saurin, A.J. Hox Proteins in the Regulation of Muscle Development. Front. Cell Dev. Biol. 2021, 9, 731996. [Google Scholar] [CrossRef] [PubMed]
- Krumlauf, R. Hox genes in vertebrate development. Cell 1994, 78, 191–201. [Google Scholar] [CrossRef] [PubMed]
- Duboule, D.; Morata, G. Colinearity and functional hierarchy among genes of the homeotic complexes. Trends Genet. 1994, 10, 358–364. [Google Scholar] [CrossRef]
- Schwörer, S.; Becker, F.; Feller, C.; Baig, A.H.; Köber, U.; Henze, H.; Kraus, J.M.; Xin, B.; Lechel, A.; Lipka, D.B.; et al. Epigenetic stress responses induce muscle stem-cell ageing by Hoxa9 developmental signals. Nature 2016, 540, 428–432. [Google Scholar] [CrossRef]
- Yin, H.; Price, F.; Rudnicki, M.A. Satellite Cells and the Muscle Stem Cell Niche. Physiol. Rev. 2013, 93, 23–67. [Google Scholar] [CrossRef]
- Yoshioka, K.; Nagahisa, H.; Miura, F.; Araki, H.; Kamei, Y.; Kitajima, Y.; Seko, D.; Nogami, J.; Tsuchiya, Y.; Okazaki, N.; et al. Hoxa10 mediates positional memory to govern stem cell function in adult skeletal muscle. Sci. Adv. 2021, 7, eabd7924. [Google Scholar] [CrossRef]
- Pineault, K.M.; Wellik, D.M. Hox Genes and Limb Musculoskeletal Development. Curr. Osteoporos. Rep. 2014, 12, 420–427. [Google Scholar] [CrossRef]
- Zakany, J.; Duboule, D. The role of Hox genes during vertebrate limb development. Curr. Opin. Genet. Dev. 2007, 17, 359–366. [Google Scholar] [CrossRef]
- Wang, K.C.; Helms, J.A.; Chang, H.Y. Regeneration, repair and remembering identity: The three Rs of Hox gene expression. Trends Cell Biol. 2009, 19, 268–275. [Google Scholar] [CrossRef] [Green Version]
- Pineault, K.M.; Song, J.Y.; Kozloff, K.M.; Lucas, D.; Wellik, D.M. Hox11 expressing regional skeletal stem cells are progenitors for osteoblasts, chondrocytes and adipocytes throughout life. Nat. Commun. 2019, 10, 3168. [Google Scholar] [CrossRef]
- Davis, A.P.; Witte, D.P.; Hsieh-Li, H.M.; Potter, S.S.; Capecchi, M.R. Absence of radius and ulna in mice lacking hoxa-11 and hoxd-11. Nature 1995, 375, 791–795. [Google Scholar] [CrossRef]
- Swinehart, I.T.; Schlientz, A.J.; Quintanilla, C.A.; Mortlock, D.P.; Wellik, D.M. Hox11 genes are required for regional patterning and integration of muscle, tendon and bone. Development 2013, 140, 4574–4582. [Google Scholar] [CrossRef]
- De Las Heras-Saldana, S.; Chung, K.Y.; Lee, S.H.; Gondro, C. Gene expression of Hanwoo satellite cell differentiation in longissimus dorsi and semimembranosus. BMC Genom. 2019, 20, 156. [Google Scholar] [CrossRef]
- Liu, R.; Liu, X.; Bai, X.; Xiao, C.; Dong, Y. Different expression of lipid metabolism-related genes in Shandong black cattle and Luxi cattle based on transcriptome analysis. Sci. Rep. 2020, 10, 21915. [Google Scholar] [CrossRef]
- Li, X.; Jiang, E.; Zhang, K.; Zhang, S.; Jiang, F.; Song, E.; Chen, H.; Guo, P.; Lan, X. Genetic Variations within the Bovine CRY2 Gene Are Significantly Associated with Carcass Traits. Animals 2022, 12, 1616. [Google Scholar] [CrossRef]
- Zhang, X.; Yang, S.; Kang, Z.; Ru, W.; Shen, X.; Li, M.; Lan, X.; Chen, H. circMEF2D Negatively Regulated by HNRNPA1 Inhibits Proliferation and Differentiation of Myoblasts via miR-486-PI3K/AKT Axis. J. Agric. Food Chem. 2022, 70, 8145–8163. [Google Scholar] [CrossRef]
- Zhang, S.; Jiang, E.; Kang, Z.; Bi, Y.; Liu, H.; Xu, H.; Wang, Z.; Lei, C.; Chen, H.; Lan, X. CircRNA profiling reveals an abundant circBDP1 that regulates bovine fat development by sponging miR-181b/miR-204 targeting Sirt1/TRARG1. J. Agric. Food Chem. 2022, 70, 14312–14328. [Google Scholar] [CrossRef]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef]
- Huang, Y.; Su, P.; Akhatayeva, Z.; Pan, C.; Zhang, Q.; Lan, X. Novel InDel variations of the Cry2 gene are associated with litter size in Australian White sheep. Theriogenology 2022, 179, 155–161. [Google Scholar] [CrossRef]
- Yang, Q.; Zhang, S.; Liu, L.; Cao, X.; Lei, C.; Qi, X.; Lin, F.; Qu, W.; Qi, X.; Liu, J.; et al. Application of mathematical expectation (ME) strategy for detecting low frequency mutations: An example for evaluating 14-bp insertion/deletion (indel) within the bovine PRNP gene. Prion 2016, 10, 409–419. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Zhu, X.; Ma, L.; Xu, H.; Cao, X.; Luo, R.; Chen, H.; Sun, X.; Cai, Y.; Lan, X. Detection of a new 20-bp insertion/deletion (indel) within sheep PRND gene using mathematical expectation (ME) method. Prion 2017, 11, 143–150. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Wang, X.; Chen, H.; Qu, L.; Lan, X. A 17-bp InDel (rs668420586) within goat CHCHD7 gene located in growth-related QTL affecting body measurement traits. 3 Biotech 2020, 10, 441. [Google Scholar] [CrossRef] [PubMed]
- Shi, T.; Peng, W.; Yan, J.; Cai, H.; Lan, X.; Lei, C.; Bai, Y.; Chen, H. A novel 17 bp indel in the SMAD3 gene alters transcription level, contributing to phenotypic traits in Chinese cattle. Arch. Anim. Breed. 2016, 59, 151–157. [Google Scholar] [CrossRef]
- Chen, F.; Shi, J.; Luo, Y.-Q.; Sun, S.-Y.; Pu, M. Genetic Characterization of the Gypsy Moth from China (Lepidoptera, Lymantriidae) Using Inter Simple Sequence Repeats Markers. PLoS ONE 2013, 8, e73017. [Google Scholar] [CrossRef]
- Wei, Z.; Wang, K.; Wu, H.; Wang, Z.; Pan, C.; Chen, H.; Lan, X. Detection of 15-bp Deletion Mutation within PLAG1 Gene and Its Effects on Growth Traits in Goats. Animals 2021, 11, 2064. [Google Scholar] [CrossRef]
- Zhang, S.; Xu, H.; Jiang, E.; Akhatayeva, Z.; Jiang, F.; Song, E.; Pan, C.; Chen, H.; Lan, X. Screening of Bovine Tissue-Specific Expressed Genes and Identification of Genetic Variation within an Adipose Tissue-Specific lncRNA Gene. Front. Vet. Sci. 2022, 9, 887520. [Google Scholar] [CrossRef]
- Lynch, V.J.; Brayer, K.; Gellersen, B.; Wagner, G.P. HoxA-11 and FOXO1A Cooperate to Regulate Decidual Prolactin Expression: Towards Inferring the Core Transcriptional Regulators of Decidual Genes. PLoS ONE 2009, 4, e6845. [Google Scholar] [CrossRef]
- Nnamani, M.C.; Ganguly, S.; Erkenbrack, E.M.; Lynch, V.J.; Mizoue, L.S.; Tong, Y.; Darling, H.L.; Fuxreiter, M.; Meiler, J.; Wagner, G.P. A Derived Allosteric Switch Underlies the Evolution of Conditional Cooperativity between HOXA11 and FOXO1. Cell Rep. 2016, 15, 2097–2108. [Google Scholar] [CrossRef]
- Raines, A.M.; Magella, B.; Adam, M.; Potter, S.S. Key pathways regulated by HoxA9,10,11/HoxD9,10,11 during limb development. BMC Dev. Biol. 2015, 15, 28. [Google Scholar] [CrossRef] [Green Version]
- Hayashi, K.; Ozawa, E. Myogenic cell migration from somites is induced by tissue contact with medial region of the presumptive limb mesoderm in chick embryos. Development 1995, 121, 661–669. [Google Scholar] [CrossRef]
- Yamamoto, M.; Gotoh, Y.; Tamura, K.; Tanaka, M.; Kawakami, A.; Ide, H.; Kuroiwa, A. Coordinated expression of Hoxa-11 and Hoxa-13 during limb muscle patterning. Development 1998, 125, 1325–1335. [Google Scholar] [CrossRef]
- Ma, Y.; Guess, M.; Datar, A.; Hennessey, A.; Cardenas, I.; Johnson, J.; Connell, K.A. Knockdown of Hoxa11 In Vivo in the Uterosacral Ligament and Uterus of Mice Results in Altered Collagen and Matrix Metalloproteinase Activity. Biol. Reprod. 2012, 86, 100. [Google Scholar] [CrossRef]
- White, R.B.; Biérinx, A.-S.; Gnocchi, V.F.; Zammit, P.S. Dynamics of muscle fibre growth during postnatal mouse development. BMC Dev. Biol. 2010, 10, 21. [Google Scholar] [CrossRef]
- Randolph, M.E.; Pavlath, G.K. A muscle stem cell for every muscle: Variability of satellite cell biology among different muscle groups. Front. Aging Neurosci. 2015, 7, 190. [Google Scholar] [CrossRef] [Green Version]
Primer Names | Primer Pairs (5′-3′) | Sizes (bp) | Location | Note |
---|---|---|---|---|
P1-Ins-4-bp | F:ACTGACCATGCCAAGGCTAC | 148/144 | Upstream | rs515880802 |
R:TTGAGCTCTGCACTCCACTC | ||||
P2-Del-8-bp | F:TAGTCGGGGGACCTTGCTTG | 159/151 | Intron 1 | rs517582703 |
R:GCTTCTTTCGGGTTCGTTGG | ||||
MyoG | F:CCAGTGAATGCAGCTCCCATA | 88 | Exon 2–3 | qRT-PCR |
R:AGCAGATGATCCCCTGGGTTG | ||||
MyHC | F:TGCTCATCTCACCAAGTTCC | 150 | Exon 41–42 | qRT-PCR |
R:CACTCTTCACTCTCATGGACC | ||||
DES | F:AACAATTTGGCTGCCTTCCG | 97 | Exon 2–3 | qRT-PCR |
R:ACGCGATTTCCTCGTTGAGA | ||||
C/EBPα | F:TGGACAAGAACAGCAACGAG | 130 | Exon 1 | qRT-PCR |
R:TTGTCACTGGTCAGCTCCAG | ||||
PPARγ | F:AGGATGGGGTCCTCATATCC | 121 | Exon 6 | qRT-PCR |
R:GCGTTGAACTTCACAGCAAA | ||||
FABP4 | F:AAGTCAAGAGCATCGTAA | 111 | Exon 2–3 | qRT-PCR |
R:CCAGCACCATCTTATCAT | ||||
HOXA11 | F:GGCCACACTGAGGACAAG | 144 | Exon 1–2 | qRT-PCR |
R:TAGTTGCAGGCGTTTCTCTT | ||||
GAPDH | F:ACCACTTTGGCATCGTGGAG | 76 | Exon 7–8 | qRT-PCR |
R:GGGCCATCCACAGTCTTCTG |
Loci | Sizes | Genotypic Frequencies | Allelic Frequencies | HWE | Population Parameters | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|
N | II | ID | DD | I | D | p-Value | Ho | He | Ne | PIC | |
P1-Ins-4-bp | 416 | 0 | 0.103 | 0.897 | 0.052 | 0.948 | p > 0.05 | 0.902 | 0.098 | 1.109 | 0.093 |
P2-Del-8-bp | 640 | 0.981 | 0.019 | 0 | 0.991 | 0.009 | p > 0.05 | 0.981 | 0.019 | 1.019 | 0.018 |
Gene | Pearson’s r | Sig. (2-Tailed) |
---|---|---|
C/EBPα | 0.828 * | 0.042 |
PPARγ | 0.475 | 0.341 |
FABP4 | 0.288 | 0.580 |
Gene | Pearson’s r | Sig. (2-Tailed) |
---|---|---|
DES | 0.840 * | 0.018 |
MyHC | 0.863 * | 0.012 |
MyoG | 0.913 ** | 0.004 |
Types | P1-Ins-4-bp | P2-Del-8-bp |
---|---|---|
Sample sizes | 640 | 640 |
Estimated mutation frequency | 0.02 | 0.01 |
NR1 (number of individuals in one reaction time) | 1 | 1 |
RT1 (reaction times) | 640 | 640 |
NGn (the optimal number of individuals in one mixed group) | 8 | 11 |
pRTn (predicted reaction times by the formulate) | 176 | 126 |
pRR (predicted reduction rate) | 72.50% | 80.31% |
RTn (reaction times) | - | 221 |
RR (reduction rate) | - | 65.47% |
Carcass Traits | Observed Genotypes (Mean ± SE) | p Values | |
---|---|---|---|
ID | II | ||
Beef shoulder (kg) | 1.30 a ± 0.1 (n = 29) | 1.02 b ± 0.02 (n = 163) | 0.012 |
Tongue root (kg) | 1.53 B ± 0.14 (n = 4) | 2.02 A ± 0.05 (n = 29) | 0.004 |
Carcass Traits | Observed Genotypes (Mean ± SE) | p Values | |
---|---|---|---|
ID | II | ||
Female | |||
Back tendon (kg) | 0.55 B ± 0.06 (n = 6) | 0.71 A ± 0.01 (n = 363) | 0.008 |
Money tendon (kg) | 1.06 B ± 0.02 (n = 6) | 1.21 A ± 0.01 (n = 366) | 2.84 × 10−4 |
Thick flank (kg) | 9.47 b ± 0.53 (n = 6) | 11.37 a ± 0.11 (n = 363) | 0.034 |
Beef shin (kg) | 14.17 B ± 0.17 (n = 6) | 15.92 A ± 0.28 (n = 323) | 9.09 × 10−7 |
Triangle thick flank (kg) | 2.09 b ± 0.1 (n = 6) | 2.53 a ± 0.03 (n = 367) | 0.040 |
Triangle flank (kg) | 3.79 B ± 0.08 (n = 6) | 4.78 A ± 0.05 (n = 367) | 1.00 × 10−6 |
Rump (kg) | 3.90 b ± 0.15 (n = 6) | 4.73 a ± 0.04 (n = 365) | 0.018 |
Small tenderloin (kg) | 2.00 b ± 0.18 (n = 6) | 2.43 a ± 0.03 (n = 358) | 0.043 |
Male | |||
Brisket fat (kg) | 4.48 a ± 0.96 (n = 4) | 3.36 b ± 0.11 (n = 82) | 0.045 |
Carcass Traits | Observed Diplotypes (Mean ± SE) | p Values | |||
---|---|---|---|---|---|
DD-II | DD-ID | ID-II | ID-ID | ||
Beef shoulder (kg) | 1.02 b ± 0.02 (n = 163) | - | 1.3 a ± 0.11 (n = 27) | (n = 2) | 0.042 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Huang, Y.; Zhang, K.; Li, Y.; Zhang, S.; Akhatayeva, Z.; Jiang, F.; Song, E.; Lan, X. Bovine HOXA11 Gene Identified from RNA-Seq: mRNA Profile Analysis and Genetic Variation Detection Using ME Method and Their Associations with Carcass Traits. Cells 2023, 12, 539. https://doi.org/10.3390/cells12040539
Huang Y, Zhang K, Li Y, Zhang S, Akhatayeva Z, Jiang F, Song E, Lan X. Bovine HOXA11 Gene Identified from RNA-Seq: mRNA Profile Analysis and Genetic Variation Detection Using ME Method and Their Associations with Carcass Traits. Cells. 2023; 12(4):539. https://doi.org/10.3390/cells12040539
Chicago/Turabian StyleHuang, Yangming, Kejing Zhang, Yafang Li, Sihuan Zhang, Zhanerke Akhatayeva, Fugui Jiang, Enliang Song, and Xianyong Lan. 2023. "Bovine HOXA11 Gene Identified from RNA-Seq: mRNA Profile Analysis and Genetic Variation Detection Using ME Method and Their Associations with Carcass Traits" Cells 12, no. 4: 539. https://doi.org/10.3390/cells12040539