Genotype-Specific Expression of Selected Candidate Genes Conferring Resistance to Leaf Rust of Rye (Secale cereale L.)
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Materials
2.2. Experimental Design
2.3. Inoculation of Rye Seedlings with Prs and the Mock Control
2.4. Microscopic Analysis
2.5. Macroscopic Analysis
2.6. Total RNA Extraction and cDNA Synthesis
2.7. Quantitative Real-Time PCR Analysis
3. Results
3.1. Microscopic and Macroscopic Analyses of LR Symptom Development
3.2. Analysis of DXS, Glu, GT and PR-1 Expression
3.3. DXS Gene
3.4. Glu Gene
3.5. GT Gene
3.6. PR-1 Gene
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Chaves, M.S.; Martinelli, J.A.; Wesp, C.D.L.; Graichen, F.A.S. The cereal rusts: An overview. Pest Technol. 2008, 2, 38–55. [Google Scholar]
- Wehling, P.; Linz, A.; Hackauf, B.; Roux, S.R.; Ruge, B.; Klocke, B. Leaf-rust resistance in rye (Secale cereale L.). 1. Genetic analysis and mapping of resistance genes Pr1 and Pr2. Theor. Appl. Genet. 2003, 107, 432–438. [Google Scholar] [CrossRef]
- Roux, S.R.; Hackauf, B.; Linz, A.; Ruge, B.; Klocke, B.; Wehling, P. Leaf-rust resistance in rye (Secale cereale L.). 2. Genetic analysis and mapping of resistance genes Pr3, Pr4 and Pr5. Theor. Appl. Genet. 2004, 110, 192–201. [Google Scholar] [CrossRef] [PubMed]
- Roux, S.R.; Wehling, P. Nature of mixed infection type 2 (5) observed in rye (Secale cereale L.) plants carrying the Pr1 leaf-rust resistance gene. J. Kult. 2010, 62, 29–34. [Google Scholar]
- Solodukhina, O.V. Genetic characterization of rye accessions with regard to leaf rust resistance. Russ. J. Genet. 2002, 38, 399–407. [Google Scholar] [CrossRef]
- Rabanus-Wallace, M.T.; Hackauf, B.; Mascher, M.; Lux, T.; Wicker, T.; Gundlach, H.; Baez, M.; Houben, A.; Mayer, K.F.; Guo, L.; et al. Chromosome-scale genome assembly provides insights into rye biology, evolution and agronomic potential. Nat. Genet. 2021, 53, 564–573. [Google Scholar] [CrossRef] [PubMed]
- Li, G.; Wang, L.; Yang, J.; He, H.; Jin, H.; Li, X.; Ren, T.; Ren, Z.; Li, F.; Han, X.; et al. A high-quality genome assembly highlights rye genomic characteristics and agronomically important genes. Nat. Genet. 2021, 53, 574–584. [Google Scholar] [CrossRef] [PubMed]
- Vendelbo, N.M.; Mahmood, K.; Sarup, P.; Hovmøller, M.S.; Justesen, A.F.; Kristensen, P.S.; Orabi, J.; Jahoor, A. Discovery of a Novel Leaf Rust (Puccinia recondita) Resistance Gene in Rye (Secale cereale L.) Using Association Genomics. Cells 2021, 11, 64. [Google Scholar] [CrossRef]
- Vendelbo, N.M.; Mahmood, K.; Steuernagel, B.; Wulff, B.B.H.; Sarup, P.; Hovmøller, M.S.; Justesen, A.F.; Kristensen, P.S.; Orabi, J.; Jahoor, A. Discovery of Resistance Genes in Rye by Targeted Long-Read Sequencing and Association Genetics. Cells 2022, 11, 1273. [Google Scholar] [CrossRef]
- Święcicka, M.; Dmochowska-Boguta, M.; Orczyk, W.; Grądzielewska, A.; Stochmal, A.; Kowalczyk, M. Changes in benzoxazinoid contents and the expression of the associated genes in rye (Secale cereale L.) due to brown rust and the inoculation procedure. PLoS ONE 2020, 15, e0233807. [Google Scholar] [CrossRef] [PubMed]
- Rakoczy-Trojanowska, M.; Krajewski, P.; Bocianowski, J.; Schollenberger, M.; Wakuliński, W.; Milczarski, P.; Masojć, P.; Targońska-Karasek, M.; Banaszak, Z.; Banaszak, K.; et al. Identification of single nucleotide polymorphisms associated with brown rust resistance, α-amylase activity and pre-harvest sprouting in rye (Secale cereale L.). Plant Mol. Biol. Report. 2017, 35, 366–378. [Google Scholar] [CrossRef] [PubMed]
- Krępski, T.; Piasecka, A.; Święcicka, M.; Kańczurzewska, M.; Sawikowska, A.; Dmochowska-Boguta, M.; Rakoczy-Trojanowska, M.; Matuszkiewicz, M. Leaf rust (Puccinia recondita f. sp. secalis) triggers substantial changes in rye (Secale cereale L.) at the transcriptome and metabolome levels. BMC Plant Biol. 2024, 24, 107. [Google Scholar]
- Henriquez, M.A.; Soliman, A.; Li, G.; Hannoufa, A.; Ayele, B.T.; Daayf, F. Molecular cloning, functional characterization and expression of potato (Solanum tuberosum) 1-deoxy-d-xylulose 5-phosphate synthase 1 (StDXS1) in response to Phytophthora infestans. Plant Sci. 2016, 243, 71–83. [Google Scholar] [CrossRef] [PubMed]
- Kandel, S.L.; Hulse-Kemp, A.M.; Stoffel, K.; Koike, S.T.; Shi, A.; Mou, B.; Van Deynze, A.; Klosterman, S.J. Transcriptional analyses of differential cultivars during resistant and susceptible interactions with Peronospora effusa, the causal agent of spinach downy mildew. Sci. Rep. 2020, 10, 6719. [Google Scholar] [CrossRef] [PubMed]
- Gao, L.; Wang, S.; Li, X.Y.; Wei, X.J.; Zhang, Y.J.; Wang, H.Y.; Liu, D.Q. Expression and functional analysis of a pathogenesis-related protein 1 gene, TcLr19PR1, involved in wheat resistance against leaf rust fungus. Plant Mol. Biol. Report. 2015, 33, 797–805. [Google Scholar] [CrossRef]
- Liu, B.; Lu, Y.; Xin, Z.; Zhang, Z. Identification and antifungal assay of a wheat β-1, 3-glucanase. Biotechnol. Lett. 2009, 31, 1005–1010. [Google Scholar] [CrossRef] [PubMed]
- Neugebauer, K.A.; Bruce, M.; Todd, T.; Trick, H.N.; Fellers, J.P. Wheat differential gene expression induced by different races of Puccinia triticina. PLoS ONE 2018, 13, e0198350. [Google Scholar] [CrossRef] [PubMed]
- Amo, A.; Soriano, J.M. Unravelling consensus genomic regions conferring leaf rust resistance in wheat via meta-QTL analysis. Plant Genome 2022, 15, e20185. [Google Scholar] [CrossRef]
- Bolton, M.D.; Kolmer, J.A.; Garvin, D.F. Wheat leaf rust caused by Puccinia triticina. Mol. Plant Pathol. 2008, 9, 563–575. [Google Scholar] [CrossRef]
- Pujol, V.; Robles, J.; Wang, P.; Taylor, J.; Zhang, P.; Huang, L.; Tabe, L.; Lagudah, E. Cellular and molecular characterization of a stem rust resistance locus on wheat chromosome 7AL. BMC Res. Notes 2016, 9, 502. [Google Scholar] [CrossRef]
- Li, X.; Zhang, Y.; Zhang, W.; Zhang, J.; Wang, H.; Liu, D. Expression profiles of pathogenesis-related gene, TaLr35PR1, as it relate to Lr35-mediated adult plant leaf rust resistance. Plant Mol. Biol. Report. 2016, 34, 1127–1135. [Google Scholar] [CrossRef]
- Van Loon, L.C.; Rep, M.; Pieterse, C.M. Significance of inducible defense-related proteins in infected plants. Annu. Rev. Phytopathol. 2006, 44, 135–162. [Google Scholar] [CrossRef]
- Muthukrishnan, S.; Liang, G.H.; Trick, H.N.; Gill, B.S. Pathogenesis-related proteins and their genes in cereals. Plant Cell Tissue Organ Cult. 2001, 64, 93–114. [Google Scholar] [CrossRef]
- Krępski, T.; Olechowski, M.; Samborska-Skutnik, I.; Święcicka, M.; Grądzielewska, A.; Rakoczy-Trojanowska, M. Identification and characteristics of wheat Lr orthologs in three rye inbred lines. PLoS ONE 2023, 18, e0288520. [Google Scholar] [CrossRef]
- Dmochowska-Boguta, M.; Alaba, S.; Yanushevska, Y.; Piechota, U.; Lasota, E.; Nadolska-Orczyk, A.; Karlowski, W.M.; Orczyk, W. Pathogen-regulated genes in wheat isogenic lines differing in resistance to brown rust Puccinia triticina. BMC Genom. 2015, 16, 742. [Google Scholar] [CrossRef]
- Orczyk, W.; Dmochowska-Boguta, M.; Czembor, H.J.; Nadolska-Orczyk, A. Spatiotemporal patterns of oxidative burst and micronecrosis in resistance of wheat to brown rust infection. Plant Pathol. 2010, 59, 567–575. [Google Scholar] [CrossRef]
- Murphy, H.C. Physiologic specialization in Puccinia coronata f. sp. avenae. US Dep. Agric. Tech. Bull. 1935, 433, 48. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef]
- Jones, J.D.; Dangl, J.L. The plant immune system. Nature 2006, 444, 323–329. [Google Scholar] [CrossRef] [PubMed]
- Dodds, P.N.; Rathjen, J.P. Plant immunity: Towards an integrated view of plant–pathogen interactions. Nat. Rev. Genet. 2010, 11, 539–548. [Google Scholar] [CrossRef]
- Zhang, Y.; Lubberstedt, T.; Xu, M. The genetic and molecular basis of plant resistance to pathogens. J. Genet. Genom. 2013, 40, 23–35. [Google Scholar] [CrossRef] [PubMed]
- Bent, A.F.; Mackey, D. Elicitors, effectors and R genes: The new paradigm and a lifetime supply of questions. Annu. Rev. Phytopathol. 2007, 45, 399–436. [Google Scholar] [CrossRef]
- Balasubramanian, V.; Vashisht, D.; Cletus, J.; Sakthivel, N. Plant β-1, 3-glucanases: Their biological functions and transgenic expression against phytopathogenic fungi. Biotechnol. Lett. 2012, 34, 1983–1990. [Google Scholar] [CrossRef]
- Kumar, S.; Saini, D.K.; Jan, F.; Jan, S.; Tahir, M.; Djalovic, I.; Latkovic, D.; Khan, M.A.; Kumar, S.; Vikas, V.K.; et al. Comprehensive meta-QTL analysis for dissecting the genetic architecture of stripe rust resistance in bread wheat. BMC Genom. 2023, 24, 259. [Google Scholar] [CrossRef] [PubMed]
- Liu, R.; Lu, J.; Xing, J.; Xue, L.; Wu, Y.; Zhang, L. Characterization and functional analyses of wheat TaPR1 genes in response to stripe rust fungal infection. Sci. Rep. 2023, 13, 3362. [Google Scholar] [CrossRef]
- Okada, A.; Shimizu, T.; Okada, K.; Kuzuyama, T.; Koga, J.; Shibuya, N.; Nojiri, H.; Yamane, H. Elicitor induced activation of the methylerythritol phosphate pathway toward phytoalexins biosynthesis in rice. Plant Mol. Biol. 2007, 65, 177–187. [Google Scholar] [CrossRef] [PubMed]
- Tian, L.; Shi, J.; Yang, L.; Wei, A. Molecular Cloning and Functional Analysis of DXS and FPS Genes from Zanthoxylum bungeanum Maxim. Foods 2022, 11, 1746. [Google Scholar] [CrossRef]
- Paraschivu, M.; Matei, G.; Cotuna, O.; Paraschivu, M.; Drăghici, R. Reaction of rye cultivars to leaf rust (P. recondita f. sp. secalis) in the context of climate change in dry area in southern Romania. Sci. Pap. Ser. A Agron. 2021, 64, 500–507. [Google Scholar]
Inbred Line Designation | Origin |
---|---|
L318 | Department of Plant Genetics, Breeding and Biotechnology, Warsaw University of Life Sciences, Poland |
L9 | |
L310 | |
Ot1-3 | Department of Plant Genetics, Breeding and Biotechnology, West Pomeranian University of Technology in Szczecin, Poland |
541 | |
SE8 | Danko Plant Breeding, Ltd. (Choryń, Poland) |
SE31 | |
SE104 | |
SE118 | |
SE180 | |
SE212 | |
SE133 |
Gene | Primer Sequences (5′ → 3′) | |
---|---|---|
Forward Primer | Reverse Primer | |
DXS | CTTACGAGGCTCCAGTCCAG | GCGGGCATACTCATCCACTT |
Glu | TACCAGAACCTGTTCGACGC | GCCCTTCCTGTTCTCGTTGA |
GT | ATACGGATCCCAAGGACCGA | CTTGCATTGAATGGACCTTACCA |
PR-1 | CTGTTTCGTCGCCAAGGAGT | CCTCCAGCACCTCCATCTTG |
Act | CCCCTTTGAACCCAAAAGCC | GAAAGCACGGCCTGAATAGC |
ADP | TCTCATGGTTGGTCTCGATG | GGATGGTGGTGACGATCTCT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Azad, R.; Krępski, T.; Olechowski, M.; Biernacik, B.; Święcicka, M.; Matuszkiewicz, M.; Dmochowska-Boguta, M.; Rakoczy-Trojanowska, M. Genotype-Specific Expression of Selected Candidate Genes Conferring Resistance to Leaf Rust of Rye (Secale cereale L.). Genes 2024, 15, 275. https://doi.org/10.3390/genes15030275
Azad R, Krępski T, Olechowski M, Biernacik B, Święcicka M, Matuszkiewicz M, Dmochowska-Boguta M, Rakoczy-Trojanowska M. Genotype-Specific Expression of Selected Candidate Genes Conferring Resistance to Leaf Rust of Rye (Secale cereale L.). Genes. 2024; 15(3):275. https://doi.org/10.3390/genes15030275
Chicago/Turabian StyleAzad, Rumana, Tomasz Krępski, Mateusz Olechowski, Bartosz Biernacik, Magdalena Święcicka, Mateusz Matuszkiewicz, Marta Dmochowska-Boguta, and Monika Rakoczy-Trojanowska. 2024. "Genotype-Specific Expression of Selected Candidate Genes Conferring Resistance to Leaf Rust of Rye (Secale cereale L.)" Genes 15, no. 3: 275. https://doi.org/10.3390/genes15030275