Molecular Characterization of Ticks and Tick-Borne Pathogens in Cattle from Khartoum State and East Darfur State, Sudan
Abstract
:1. Introduction
2. Results
2.1. Tick Species Identification
2.2. Pathogens Detected in the Ticks and Infection Rates
2.3. Distribution of Tick-Borne Pathogens within Different Tick Species
2.4. Comparative Sequence Analyses of tams-1, ama1, msp4, spb4, and pCS20 Genes
2.5. Phylogenetic Analysis
3. Discussion
4. Materials and Methods
4.1. Study Area
4.2. Tick Samples
4.3. DNA Extraction
4.4. Molecular Characterization of Ticks
4.5. Detection and Characterization of Tick-Borne Pathogens
4.6. Sequencing Analysis
4.7. BLASTn Analysis, Sequence Alignment, and Phylogenetic Analyses
4.8. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Sajid, M.S.; Kausar, A.; Iqbal, A.; Abbas, H.; Iqbal, Z.; Jones, M.K. An insight into the ecobiology, vector significance and control of Hyalomma ticks (Acari: Ixodidae): A review. Acta. Trop. 2018, 187, 229–239. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Guo, H.; Adjou Moumouni, P.F.; Thekisoe, O.; Gao, Y.; Liu, M.; Li, J.; Galon, E.M.; Efstratiou, A.; Wang, G.; Jirapattharasate, C.; et al. Genetic characterization of tick-borne pathogens in ticks infesting cattle and sheep from three South African provinces. Ticks Tick Borne Dis. 2019, 10, 875–882. [Google Scholar] [CrossRef] [PubMed]
- Ambrose, N.; Lloyd, D.; Maillard, J.-C. Immune responses to Dermatophilus congolensis infections. Parasitol. Today 1999, 15, 295–300. [Google Scholar] [CrossRef]
- Hoogstraal, H. Ticks of the Sudan, (with Special Reference to Equatoria Province and with Preliminary Reviews of the Genera Boophilus, Margaropus, and Hyallomma); U.S. Government Printing Office: Washington, DC, USA, 1956.
- Moyo, B.; Masika, P. Tick control methods used by resource-limited farmers and the effect of ticks on cattle in rural areas of the Eastern Cape Province, South Africa. Trop. Anim. Health Prod. 2009, 41, 517–523. [Google Scholar] [CrossRef]
- FAO. Special Report—2019 FAO Crop and Food Supply Assessment Mission to the Sudan; FAO: Rome, Italy, 2020. [Google Scholar] [CrossRef]
- Elhaj, M.T.; Taha, K.M.; El Ghali, A.; Hassan, S.M.; Salih, D.A.; Ahmed, J.; Clausen, P.-H.; EL Hussein, A.R.M. Baseline survey of Ixodid ticks infesting cattle in Northern State, Sudan. J. Veterina. Sci. Res. 2019, 1, 37–46. [Google Scholar] [CrossRef]
- Salih, D.A.; Sharieff, O.E.; Lazarus, A.G.; Hassan, S.M.; El Hussein, A.M. Natural infection rates and transmission of Theileria annulata by Hyalomma anatolicum ticks in the Sudan. Onderstepoort J. Vet. Res. 2005, 72, 303–307. [Google Scholar] [CrossRef] [PubMed]
- Salih, D.A.; Hassan, S.M.; El Hussein, A.M.; Jongejan, F. Preliminary survey of ticks (Acari: Ixodidae) on cattle in northern Sudan. Onderstepoort J. Vet. Res. 2004, 71, 319–326. [Google Scholar] [CrossRef] [Green Version]
- Jongejan, F.; Zivkovic, D.; Pegram, R.G.; Tatchell, R.J.; Fison, T.; Latif, A.A.; Paine, G. Ticks (Acari: Ixodidae) of the Blue and White Nile ecosystems in the Sudan with particular reference to the Rhipicephalus sanguineus group. Exp. Appl. Acarol. 1987, 3, 331–346. [Google Scholar] [CrossRef]
- Ahmed, B.M.; El Hussein, A.M.; El Khider, A.O. Some observations on ticks (Acari: Ixodidae) infesting sheep in river Nile Province of Northern Sudan. Onderstepoort J. Vet. Res. 2005, 72, 239–243. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shuaib, Y.A.; Isaa, M.H.; Ezz-Eldin, M.I.-E.; Abdalla, M.A.; Bakhiet, A.O.; Chitimia-Dobler, L. Morphological abnormalities in ticks (Acari: Ixodidae) collected from domestic animal species in Sudan. Exp. Appl. Acarol. 2020, 82, 161–169. [Google Scholar] [CrossRef]
- Hayati, M.A.; Hassan, S.M.; Ahmed, S.K.; Salih, D.A. Prevalence of ticks (Acari: Ixodidae) and Theileria annulata infection of cattle in Gezira State, Sudan. Parasite Epidemiol. Control 2020, 20, e00148. [Google Scholar] [CrossRef]
- Shuaib, Y.A.; Elhag, A.M.-A.W.; Brima, Y.A.; Abdalla, M.A.; Bakiet, A.O.; Mohmed-Noor, S.E.-T.; Lemhöfer, G.; Bestehorn, M.; Poppert, S.; Schaper, S.; et al. Ixodid tick species and two tick-borne pathogens in three areas in the Sudan. Parasitol. Res. 2020, 119, 385–394. [Google Scholar] [CrossRef] [PubMed]
- Karrar, G.; Kaiser, M.N.; Hoogstraal, H. Ecology and host-relationships of ticks (Ixodoidea) infesting domestic animals in Kassala Province, Sudan, with special reference to Amblyomma lepidum Dönitz. 1. Bull. Entomol. Res. 1963, 54, 509–522. [Google Scholar] [CrossRef]
- Osman, O.; El Hussein, A.; Ahmed, N.; Abdulla, H. Ecological studies on ticks (Acarina, Ixodidae) of Kordofan Region, Sudan. Bull. Anim. Health. Prod. Afr. 1982, 30, 45–53. [Google Scholar]
- Muramatsu, Y.; Ukegawa, S.-y.; El Hussein, A.R.M.; Rahman, M.B.A.; Gabbar, K.M.A.A.; Chitambo, A.M.; Komiya, T.; Mwase, E.T.; Morita, C.; Tamura, Y. Ehrlichia ruminantium, Sudan. Emerg. Infect. Dis. 2005, 11, 1792–1793. [Google Scholar] [CrossRef] [PubMed]
- Sayed, M.; Hassan, S.M.; Elhussein, A.M.; Samir, E.; Mazahir, M.S.; Abdelrahman, M.B. Estimation of the prevalence of Ehrlichia ruminantium in Amblyomma spp. and blood of domestic ruminants in the Sudan by conventional PCR based on pCS20 gene region. Sud. J. Sci. Tech. 2013, 14, 15–27. [Google Scholar]
- Chitimia-Dobler, L.; Issa, M.H.; Ezalden, M.E.; Yagoub, I.A.; Abdalla, M.A.; Bakhiet, A.O.; Schaper, S.; Rieß, R.; Vollmar, P.; Grumbach, A.; et al. Crimean-Congo haemorrhagic fever virus in Hyalomma impeltatum ticks from North Kordofan, the Sudan. Int. J. Infect. Dis. 2019, 89, 81–83. [Google Scholar] [CrossRef] [Green Version]
- Nakao, R.; Qiu, Y.; Salim, B.; Hassan, S.M.; Sugimoto, C. Molecular detection of Rickettsia africae in Amblyomma variegatum collected from Sudan. Vector Borne Zoonotic Dis. 2015, 15, 323–325. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hassan, S.; Salih, D. An overview of factors responsible for geographic distribution pattern of ixodid ticks in the Sudan. Sokoto J. Vet. Sci. 2013, 11, 1–9. [Google Scholar] [CrossRef] [Green Version]
- Bock, R.; Jackson, L.; de Vos, A.; Jorgensen, W. Babesiosis of cattle. Parasitology 2004, 129, S247–S269. [Google Scholar] [CrossRef]
- ElImam, A. Ecological studies of ticks (Acari: Ixodidae) infesting cattle in Kosti Province, Sudan. Sud. J. Vet. Sci. Anim. Husb. 2003, 42, 62–71. [Google Scholar]
- Sowar, A. Epidemiology and Ecology of Ticks and Some Tick-Borne Diseases in (Kadogli and Dilling) Southern Kordofan State, Sudan. Master’s Thesis, Department of Preventive Medicine, University of Khartoum, Khartoum State, Sudan, 2002. [Google Scholar]
- ElGhali, A.A.; Hassan, S.M. Ticks infesting animals in the Sudan and southern Sudan: Past and current status. Onderstepoort J. Vet. Res. 2012, 79, E1–E6. [Google Scholar] [CrossRef]
- Walker, A. The genus Rhipicephalus (Acari, Ixodidae): A guide to the brown ticks of the world. In Tropical Animal Health and Production; Walker, J.B., Keirans, J.E., Horak, I.G., Eds.; Kluwer Academic Publishers: Dordrecht, The Netherlands, 2000; pp. 409–416. [Google Scholar]
- Gad Elrab, N. A Survey of Sheep Piroplasmosis in Khartoum Province, Central Sudan. Master’s Thesis, Department of Parasitology, University of Khartoum, Khartoum State, Sudan, 1986. [Google Scholar]
- Osman, I. Some Studies on Malignant Ovine Theileriosis in Northern Sudan. Master’s Thesis, Department of Parasitology, University of Khartoum, Khartoum State, Sudan, 1999. [Google Scholar]
- Ali, M.M. Studies on Ticks and Tick-Borne Diseases of Cattle in South Darfur State, Sudan. Master’s Thesis, Department of Parasitology, University of Khartoum, Khartoum State, Sudan, 2007. [Google Scholar]
- Walker, A.R.; Latif, A.A.; Morzaria, S.P.; Jongejan, F. Natural infection rates of Hyalomma anatolicum with Theileria in Sudan. Res. Vet. Sci. 1983, 35, 87–90. [Google Scholar] [CrossRef]
- Abdalla, M.M.; Hassan, S.M. Current status of distribution of ticks (Acari: Ixodidae) infesting cattle in South Darfur State, Sudan. Univ. Khartoum. J. Vet. Med. Anim. Prod. 2010, 1, 76–97. [Google Scholar]
- Abaker, I.A.; Salih, D.A.; El Haj, L.M.; Ahmed, R.E.; Osman, M.M.; Ali, A.M. Prevalence of Theileria annulata in dairy cattle in Nyala, South Darfur State, Sudan. Vet. World. 2017, 10, 1475–1480. [Google Scholar] [CrossRef] [Green Version]
- Walker, J.B.; Olwage, A. The tick vectors of Cowdria ruminantium (Ixodoidea, Ixodidae, genus Amblyomma) and their distribution. Onderstepoort J. Vet. Res. 1987, 54, 353–379. [Google Scholar]
- El Hussein, A.M.; Hassan, S.M.; Salih, D.A. Current situation of tropical theileriosis in the Sudan. Parasitol. Res. 2012, 111, 503–508. [Google Scholar] [CrossRef]
- Walker, A.; Bouattour, A.; Camicas, J.L.; Estrada-Peña, A.; Horak, I.; Latif, A.; Pegram, R.G.; Preston, P.M. Ticks of Domestic Animals in Africa: A Guide to Identification of Species; Bioscience Reports: Edinburgh, UK, 2003; pp. 98–114. [Google Scholar]
- Mustafa, U.E.H.; Jongejan, F.; Morzaria, S. Note on the transmission of Theileria annulata by Hyalomma ticks in the Sudan. Vet. Q. 1983, 5, 112–113. [Google Scholar] [CrossRef]
- Taha, K. Experimental Transmission of Theileria lestoquardi and Theileria annulata (Apicomplexa: Theileridae) and Their Cross Transmission between Cattle and Sheep. Ph.D. Thesis, Sudan Academy of Science, Khartoum, Sudan, 2009. [Google Scholar]
- Ibrahim, A.; Geysen, D.; Ismail, A.; Shadia, A.M. Haemoparasites identification in two dairy cattle farms in Khartoum State with reference of Babesia bigemina: Molecular confirmation. Sudan J. Vet. Res. 2010, 25, 37–42. [Google Scholar]
- Eisawi, N.M.; El Hussein, A.R.M.; Hassan, D.A.; Musa, A.B.; Hussien, M.O.; Enan, K.A.; Bakheit, M.A. A molecular prevalence survey on Anaplasma infection among domestic ruminants in Khartoum State, Sudan. Trop. Anim. Health Prod. 2020, 52, 1845–1852. [Google Scholar] [CrossRef]
- Karim, I.E.E.A.; Emam, A.A.; Gafar, S. Beef and mutton consumption in Khartum state: Demand analysis (2000–2004). J. Sc. Tech. 2009, 10, 12–26. [Google Scholar]
- El Zubeir, I.E.; Ahmed, G.M. An overview of the management practices and constrains at the dairy camps in Khartoum State, Sudan. Res. Opin. Anim. Vet. Sci. 2011, 1, 425–428. [Google Scholar]
- Beati, L.; Keirans, J.E. Analysis of the systematic relationships among ticks of the genera Rhipicephalus and Boophilus (Acari: Ixodidae) based on mitochondrial 12S ribosomal DNA gene sequences and morphological characters. J. Parasitol. 2001, 87, 32–48. [Google Scholar] [CrossRef]
- Adjou Moumouni, P.F.; Terkawi, M.A.; Jirapattharasate, C.; Cao, S.; Liu, M.; Nakao, R.; Umemiya-Shirafuji, R.; Yokoyama, N.; Sugimoto, C.; Fujisaki, K.; et al. Molecular detection of spotted fever group rickettsiae in Amblyomma variegatum ticks from Benin. Ticks Tick. Borne Dis. 2016, 7, 828–833. [Google Scholar] [CrossRef]
- Sivakumar, T.; Altangerel, K.; Battsetseg, B.; Battur, B.; AbouLaila, M.; Munkhjargal, T.; Yoshinari, T.; Yokoyama, N.; Igarashi, I. Genetic detection of Babesia bigemina from Mongolian cattle using apical membrane antigen-1 gene-based PCR assay. Vet. Parasitol. 2012, 187, 17–22. [Google Scholar] [CrossRef] [PubMed]
- Terkawi, M.A.; Huyen, N.X.; Shinuo, C.; Inpankaew, T.; Maklon, K.; Aboulaila, M.; Ueno, A.; Goo, Y.-K.; Yokoyama, N.; Jittapalapong, S. Molecular and serological prevalence of Babesia bovis and Babesia bigemina in water buffaloes in the northeast region of Thailand. Vet. Parasitol. 2011, 178, 201–207. [Google Scholar] [CrossRef] [PubMed]
- Torina, A.; Agnone, A.; Blanda, V.; Alongi, A.; D’Agostino, R.; Caracappa, S.; Marino, A.M.; Di Marco, V.; de la Fuente, J. Development and validation of two PCR tests for the detection of and differentiation between Anaplasma ovis and Anaplasma marginale. Ticks Tick Borne Dis. 2012, 3, 283–287. [Google Scholar] [CrossRef] [PubMed]
- Mtshali, K.; Khumalo, Z.T.; Nakao, R.; Grab, D.J.; Sugimoto, C.; Thekisoe, O.M. Molecular detection of zoonotic tick-borne pathogens from ticks collected from ruminants in four South African provinces. J. Vet. Med. Sci. 2015, 77, 1573–1579. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chao, K.-H.; Barton, K.; Palmer, S.; Lanfear, R. sangeranalyseR: Simple and interactive analysis of Sanger sequencing data in R. bioRxiv 2020. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
Tick Species | Khartoum State | East Darfur State | Total |
---|---|---|---|
R. annulatus | 0% (0/417) | 27% (32/119) * | 6% (32/536) |
R. decoloratus | 0% (0/417) | 25% (30/119) * | 5.6% (30/536) |
R. e. evertsi | 34.3% (143/417) * | 0.84% (1/119) | 27% (144/536) |
R. praetextatus | 2.6% (11/417) | 0% (0/119) | 2% (11/536) |
R. simpsoni | 0.5% (2/417) | 0% (0/119) | 0.4% (2/536) |
H. rufipes | 1.2% (5/417) | 29% (34/119) * | 7.3% (39/536) |
H. anatolicum | 57.3% (239/417) * | 0% (0/119) | 44.6% (239/517) |
H. excavatum | 2.4% (10/417) | 0% (0/119) | 1.9% (10/536) |
H. dromedarii | 0% (0/417) | 0.84% (1/119) | 0.2% (1/536) |
H. impeltatum | 0.24% (1/417) | 7.6% (9/119) * | 1.9% (10/536) |
H. marginatum | 0.96% (4/417) | 1.7% (2/119) | 1% (6/536) |
Am. lepidum | 0% (0/417) | 8.4% (10/119) * | 1.9% (10/536) |
Am. variegatum | 0.5% (2/417) | 0% (0/119) | 0.4% (2/536) |
Total | 417 | 119 | 536 |
PCR | T. annulate tams-1 | B. bigemina ama1 | A. marginale msp4 | B. bovis spb4 | E. ruminantium pCS20 |
---|---|---|---|---|---|
Khartoum State | 42.7% (178/417) * | 15.1% (63/417) | 12.5% (52/417) * | 5.5% (23/417) | 12.2% (51/417) * |
East Darfur State | 18.5% (22/119) | 31.1% (37/119) * | 4.2% (5/119) | 5.8% (7/119) | 2.5% (3/119) |
Total | 37.3% (200/536) | 18.7% (100/536) | 10.6% (57/536) | 5.6% (30/536) | 10.07% (54/536) |
Tick Species | T. annulata | B. bigemina | B. bovis | A. marginale | E. ruminantium |
---|---|---|---|---|---|
R. annulatus | 0% (0/200) | 11% (11/100) | 3.3% (1/30) | 1.8% (1/57) | 0% (0/54) |
R. decoloratus | 0% (0/200) | 18% (18/100) | 0% (0/30) | 5.3% (3/57) | 0% (0/54) |
R. e. evertsi | 27.5% (55/200) | 15% (15/100) | 23.3% (7/30) | 35.1% (20/57) | 24.1% (13/54) |
R. praetextatus | 2% (4/200) | 1% (1/100) | 3.3% (1/30) | 1.8% (1/57) | 5.6% (3/54) |
R. simpsoni * | 0% (0/200) | 0% (0/100) | 0% (0/30) | 0% (0/57) | 0% (0/54) |
H. rufipes | 3.5% (7/200) | 2% (2/100) | 10% (3/30) | 1.8% (1/57) | 5.6% (3/54) |
H. anatolicum | 56.5% (113/200) | 44% (44/100) | 43.3% (13/30) | 49.1% (28/57) | 55.5% (30/54) |
H. excavatum | 4% (4/200) | 4% (4/100) | 0% (0/30) | 0% (0/57) | 5.5% (3/54) |
H. dromedarii * | 0% (0/200) | 0% (0/100) | 0% (0/30) | 0% (0/57) | 0% (0/54) |
H. impeltatum | 3% (6/200) | 2% (2/100) | 10% (3/30) | 0% (0/57) | 0% (0/54) |
H. marginatum | 1.5% (3/200) | 1% (1/100) | 6.6% (2/30) | 3.5% (2/57) | 1.9% (1/54) |
Am. lepidum | 4% (8/200) | 2% (2/100) | 0% (0/30) | 0% (0/57) | 1.9% (1/54) |
Am. variegatum | 0% (0/200) | 0% (0/100) | 0% (0/30) | 1.8% (1/57) | 0% (0/54) |
Total | 200 | 100 | 30 | 57 | 54 |
Pathogen Target Gene | Assays | Oligonucleotide Sequences (5′→3′) | Annealing Temperature | Product Size (bp) | References |
---|---|---|---|---|---|
T. annulata tams-1 | PCR | ATGCTGCAAATGAGGAT | 56 °C | 768 | [44] |
GGACTGATGAGAAGACGATGAG | |||||
B. bigemina ama1 | PCR | TACTGTGACGAGGACGGATC | 62 °C | 211 | [44] |
CCTCAAAAGCAGATTCGAGT | |||||
B. bovis sbp4 | PCR | AGTTGTTGGAGGAGGCTAAT | 58 °C | 907 | [45] |
TCCTTCTCGGCGTCCTTTTC | |||||
nPCR | GAAATCCCTGTTCCAGAG | 58 °C | 503 | [45] | |
TCGTTGATAACACTGCAA | |||||
A. marginale msp4 | PCR | CTGAAGGGGGAGTAATGGG | 60 °C | 344 | [46] |
GGTAATAGCTGCCAGAGATTCC | |||||
E. ruminantium pCS20 | PCR | CTTGATGGAGGATTAAAAGCA | 60 °C | 279 | [47] |
GTAATGTTTCATGTGAATTGATCC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mossaad, E.; Gaithuma, A.; Mohamed, Y.O.; Suganuma, K.; Umemiya-Shirafuji, R.; Ohari, Y.; Salim, B.; Liu, M.; Xuan, X. Molecular Characterization of Ticks and Tick-Borne Pathogens in Cattle from Khartoum State and East Darfur State, Sudan. Pathogens 2021, 10, 580. https://doi.org/10.3390/pathogens10050580
Mossaad E, Gaithuma A, Mohamed YO, Suganuma K, Umemiya-Shirafuji R, Ohari Y, Salim B, Liu M, Xuan X. Molecular Characterization of Ticks and Tick-Borne Pathogens in Cattle from Khartoum State and East Darfur State, Sudan. Pathogens. 2021; 10(5):580. https://doi.org/10.3390/pathogens10050580
Chicago/Turabian StyleMossaad, Ehab, Alex Gaithuma, Yassir O. Mohamed, Keisuke Suganuma, Rika Umemiya-Shirafuji, Yuma Ohari, Bashir Salim, Mingming Liu, and Xuenan Xuan. 2021. "Molecular Characterization of Ticks and Tick-Borne Pathogens in Cattle from Khartoum State and East Darfur State, Sudan" Pathogens 10, no. 5: 580. https://doi.org/10.3390/pathogens10050580