The Salinity Survival Strategy of Chenopodium quinoa: Investigating Microbial Community Shifts and Nitrogen Cycling in Saline Soils
Abstract
:1. Introduction
2. Material and Methods
2.1. Experimental Design and Soil Processing
2.2. DNA Extraction and Quantitative PCR (qPCR)
2.3. Statistical Analysis
3. Result and Discussion
3.1. Dynamic of Soil Microbial Communities
3.2. Soil Microbial Co-Occurrence and Keystone Taxa
3.3. Correlations among the Environmental Variables, Bacterial Community, and Nitrogen Functional Genes
4. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Miranda-Apodaca, J.; Agirresarobe, A.; Martínez-Goñi, X.S.; Yoldi-Achalandabaso, A.; Pérez-López, U. N Metabolism Performance in Chenopodium Quinoa Subjected to Drought or Salt Stress Conditions. Plant Physiol. Biochem. 2020, 155, 725–734. [Google Scholar] [CrossRef] [PubMed]
- FAO. The Impact of Disasters and Crises on Agriculture and Food Security; Report; FAO: Rome, Italy, 2018. [Google Scholar]
- Rath, K.M.; Rousk, J. Salt Effects on the Soil Microbial Decomposer Community and Their Role in Organic Carbon Cycling: A Review. Soil Biol. Biochem. 2015, 81, 108–123. [Google Scholar] [CrossRef]
- Zhang, L.; Tang, C.; Yang, J.; Yao, R.; Wang, X.; Xie, W.; Ge, A.-H. Salinity-Dependent Potential Soil Fungal Decomposers under Straw Amendment. Sci. Total Environ. 2023, 891, 164569. [Google Scholar] [CrossRef]
- Yuan, B.-C.; Li, Z.-Z.; Liu, H.; Gao, M.; Zhang, Y.-Y. Microbial Biomass and Activity in Salt Affected Soils under Arid Conditions. Appl. Soil Ecol. 2007, 35, 319–328. [Google Scholar] [CrossRef]
- Zhang, S.; Rasool, G.; Wang, S.; Zhang, Y.; Guo, X.; Wei, Z.; Zhang, X.; Yang, X.; Wang, T. Biochar and Chlorella Increase Rice Yield by Improving Saline-Alkali Soil Physicochemical Properties and Regulating Bacteria under Aquaculture Wastewater Irrigation. Chemosphere 2023, 340, 139850. [Google Scholar] [CrossRef]
- Akhtar, M.; Hussain, F.; Ashraf, M.Y.; Qureshi, T.M.; Akhter, J.; Awan, A.R. Influence of Salinity on Nitrogen Transformations in Soil. Commun. Soil Sci. Plant Anal. 2012, 43, 1674–1683. [Google Scholar] [CrossRef]
- Jacobsen, S.-E.; Mujica, A.; Jensen, C. The Resistance of Quinoa (Chenopodium quinoaWilld.) to Adverse Abiotic Factors. Food Rev. Int.-Food Rev. Int. 2003, 19, 99–109. [Google Scholar] [CrossRef]
- Böhm, J.; Messerer, M.; Müller, H.M.; Scholz-Starke, J.; Gradogna, A.; Scherzer, S.; Maierhofer, T.; Bazihizina, N.; Zhang, H.; Stigloher, C.; et al. Understanding the Molecular Basis of Salt Sequestration in Epidermal Bladder Cells of Chenopodium Quinoa. Curr. Biol. 2018, 28, 3075–3085.e7. [Google Scholar] [CrossRef] [PubMed]
- Estrada, R.; Cosme, R.; Porras, T.; Reynoso, A.; Calderon, C.; Arbizu, C.I.; Arone, G.J. Changes in Bulk and Rhizosphere Soil Microbial Diversity Communities of Native Quinoa Due to the Monocropping in the Peruvian Central Andes. Microorganisms 2023, 11, 1926. [Google Scholar] [CrossRef]
- Toubali, S.; Meddich, A. Role of Combined Use of Mycorrhizae Fungi and Plant Growth Promoting Rhizobacteria in the Tolerance of Quinoa Plants Under Salt Stress. Gesunde Pflanz. 2023, 75, 1855–1869. [Google Scholar] [CrossRef]
- Hu, H.; Shao, T.; Gao, X.; Long, X.; Rengel, Z. Effects of Planting Quinoa on Soil Properties and Microbiome in Saline Soil. Land Degrad. Dev. 2022, 33, 2689–2698. [Google Scholar] [CrossRef]
- Hui, X.; Chen, H.; Shen, S.; Zhi, H.; Li, W. Establishment of Residual Methods for Matrine in Quinoa Plants and Soil and the Effect on Soil Bacterial Community and Composition. Foods 2023, 12, 1337. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Chang, D.; Zhu, Z.; Meng, C.; Wang, K. Soil Priming Effects and Involved Microbial Community along Salt Gradients. Biogeosci. Discuss. 2023, 114, 1–29. [Google Scholar] [CrossRef]
- Fan, K.; Delgado-Baquerizo, M.; Guo, X.; Wang, D.; Wu, Y.; Zhu, M.; Yu, W.; Yao, H.; Zhu, Y.; Chu, H. Suppressed N Fixation and Diazotrophs after Four Decades of Fertilization. Microbiome 2019, 7, 143. [Google Scholar] [CrossRef]
- Pérez Castro, S.; Cleland, E.E.; Wagner, R.; Sawad, R.A.; Lipson, D.A. Soil Microbial Responses to Drought and Exotic Plants Shift Carbon Metabolism. ISME J. 2019, 13, 1776–1787. [Google Scholar] [CrossRef]
- Agler, M.T.; Ruhe, J.; Kroll, S.; Morhenn, C.; Kim, S.-T.; Weigel, D.; Kemen, E.M. Microbial Hub Taxa Link Host and Abiotic Factors to Plant Microbiome Variation. PLoS Biol. 2016, 14, e1002352. [Google Scholar] [CrossRef]
- Herren, C.M.; McMahon, K.D. Keystone Taxa Predict Compositional Change in Microbial Communities. Environ. Microbiol. 2018, 20, 2207–2217. [Google Scholar] [CrossRef]
- Jia, L.; Wang, Z.; Ji, L.; De Neve, S.; Struik, P.C.; Yao, Y.; Lv, J.; Zhou, T.; Jin, K. Keystone Microbiome in the Rhizosphere Soil Reveals the Effect of Long-Term Conservation Tillage on Crop Growth in the Chinese Loess Plateau. Plant Soil 2022, 473, 457–472. [Google Scholar] [CrossRef]
- Zhang, Z.; Han, X.; Yan, J.; Zou, W.; Wang, E.; Lu, X.; Chen, X. Keystone Microbiomes Revealed by 14 Years of Field Restoration of the Degraded Agricultural Soil Under Distinct Vegetation Scenarios. Front. Microbiol. 2020, 11, 1915. [Google Scholar] [CrossRef]
- Kuypers, M.M.M.; Marchant, H.K.; Kartal, B. The Microbial Nitrogen-Cycling Network. Nat. Rev. Microbiol. 2018, 16, 263–276. [Google Scholar] [CrossRef] [PubMed]
- Zhang, M.; Han, F.; Liu, Z.; Han, Y.; Li, Y.; Zhou, W. Ammonium-Assimilating Microbiome: A Halophilic Biosystem Rationally Optimized by Carbon to Nitrogen Ratios with Stable Nitrogen Conversion and Microbial Structure. Bioresour. Technol. 2022, 350, 126911. [Google Scholar] [CrossRef]
- Quince, C.; Lanzen, A.; Davenport, R.J.; Turnbaugh, P.J. Removing Noise From Pyrosequenced Amplicons. BMC Bioinformatics 2011, 12, 38. [Google Scholar] [CrossRef]
- Lane, D.; Stackebrandt, E.; Goodfellow, M. Nucleic Acid Techniques in Bacterial Systematics. In Nucleic Acid Techniques in Bacterial Systematics, 1st ed.; Wiley: Hoboken, NJ, USA, 1991; Volume 125–175. [Google Scholar]
- Gurr, S. PCR Protocols-A Guide to Methods and Applications. Biochem. Educ. 1991, 19, 45. [Google Scholar] [CrossRef]
- Edgar, R.C. UPARSE: Highly Accurate OTU Sequences from Microbial Amplicon Reads. Nat. Methods 2013, 10, 996–998. [Google Scholar] [CrossRef] [PubMed]
- Tourna, M.; Freitag, T.E.; Nicol, G.W.; Prosser, J.I. Growth, Activity and Temperature Responses of Ammonia-Oxidizing Archaea and Bacteria in Soil Microcosms. Environ. Microbiol. 2008, 10, 1357–1364. [Google Scholar] [CrossRef] [PubMed]
- Francis, C.A.; Roberts, K.J.; Beman, J.M.; Santoro, A.E.; Oakley, B.B. Ubiquity and Diversity of Ammonia-Oxidizing Archaea in Water Columns and Sediments of the Ocean. Proc. Natl. Acad. Sci. USA 2005, 102, 14683–14688. [Google Scholar] [CrossRef] [PubMed]
- Rotthauwe, J.H.; Witzel, K.P.; Liesack, W. The Ammonia Monooxygenase Structural Gene amoA as a Functional Marker: Molecular Fine-Scale Analysis of Natural Ammonia-Oxidizing Populations. Appl. Environ. Microbiol. 1997, 63, 4704–4712. [Google Scholar] [CrossRef]
- Rösch, C.; Bothe, H. Improved Assessment of Denitrifying, N2-Fixing, and Total-Community Bacteria by Terminal Restriction Fragment Length Polymorphism Analysis Using Multiple Restriction Enzymes. Appl. Environ. Microbiol. 2005, 71, 2026–2035. [Google Scholar] [CrossRef]
- Michotey, V.; Méjean, V.; Bonin, P. Comparison of Methods for Quantification of Cytochrome Cd1-Denitrifying Bacteria in Environmental Marine Samples. Appl. Environ. Microbiol. 2000, 66, 1564–1571. [Google Scholar] [CrossRef]
- Kandeler, E.; Deiglmayr, K.; Tscherko, D.; Bru, D.; Philippot, L. Abundance of narG, nirS, nirK, and nosZ Genes of Denitrifying Bacteria during Primary Successions of a Glacier Foreland. Appl. Environ. Microbiol. 2006, 72, 5957–5962. [Google Scholar] [CrossRef] [PubMed]
- Braker, G.; Fesefeldt, A.; Witzel, K.-P. Development of PCR Primer Systems for Amplification of Nitrite Reductase Genes (nirK and nirS) To Detect Denitrifying Bacteria in Environmental Samples. Appl. Environ. Microbiol. 1998, 64, 3769–3775. [Google Scholar] [CrossRef] [PubMed]
- Henry, S.; Bru, D.; Stres, B.; Hallet, S.; Philippot, L. Quantitative Detection of the nosZ Gene, Encoding Nitrous Oxide Reductase, and Comparison of the Abundances of 16S rRNA, narG, nirK, and nosZ Genes in Soils. Appl. Environ. Microbiol. 2006, 72, 5181–5189. [Google Scholar] [CrossRef] [PubMed]
- Hariadi, Y.; Marandon, K.; Tian, Y.; Jacobsen, S.-E.; Shabala, S. Ionic and Osmotic Relations in Quinoa (Chenopodium Quinoa Willd.) Plants Grown at Various Salinity Levels. J. Exp. Bot. 2011, 62, 185–193. [Google Scholar] [CrossRef] [PubMed]
- Rath, K.M.; Murphy, D.N.; Rousk, J. The Microbial Community Size, Structure, and Process Rates along Natural Gradients of Soil Salinity. Soil Biol. Biochem. 2019, 138, 107607. [Google Scholar] [CrossRef]
- Otlewska, A.; Migliore, M.; Dybka-Stępień, K.; Manfredini, A.; Struszczyk-Świta, K.; Napoli, R.; Białkowska, A.; Canfora, L.; Pinzari, F. When Salt Meddles Between Plant, Soil, and Microorganisms. Front. Plant Sci. 2020, 11, 1429. [Google Scholar] [CrossRef] [PubMed]
- Qin, Y.; Druzhinina, I.S.; Pan, X.; Yuan, Z. Microbially Mediated Plant Salt Tolerance and Microbiome-Based Solutions for Saline Agriculture. Biotechnol. Adv. 2016, 34, 1245–1259. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Bastida, F.; Zhou, B.; Sun, Y.; Gu, T.; Li, S.; Li, Y. Soil Fertility and Crop Production Are Fostered by Micro-Nano Bubble Irrigation with Associated Changes in Soil Bacterial Community. Soil Biol. Biochem. 2020, 141, 107663. [Google Scholar] [CrossRef]
- Khalmuratova, I.; Choi, D.-H.; Kim, J.-G.; Lee, I.-S. Endophytic Fungi of Salt-Tolerant Plants: Diversity and Ability to Promote Plant Growth. J. Microbiol. Biotechnol. 2021, 31, 1526–1532. [Google Scholar] [CrossRef]
- Liang, W.; Ma, X.; Wan, P.; Liu, L. Plant Salt-Tolerance Mechanism: A Review. Biochem. Biophys. Res. Commun. 2018, 495, 286–291. [Google Scholar] [CrossRef]
- Rath, K.M.; Fierer, N.; Murphy, D.V.; Rousk, J. Linking Bacterial Community Composition to Soil Salinity along Environmental Gradients. ISME J. 2019, 13, 836–846. [Google Scholar] [CrossRef]
- Edwards, J.; Johnson, C.; Santos-Medellín, C.; Lurie, E.; Podishetty, N.K.; Bhatnagar, S.; Eisen, J.A.; Sundaresan, V. Structure, Variation, and Assembly of the Root-Associated Microbiomes of Rice. Proc. Natl. Acad. Sci. USA 2015, 112, E911–E920. [Google Scholar] [CrossRef]
- Yuan, J.; Chaparro, J.M.; Manter, D.K.; Zhang, R.; Vivanco, J.M.; Shen, Q. Roots from Distinct Plant Developmental Stages Are Capable of Rapidly Selecting Their Own Microbiome without the Influence of Environmental and Soil Edaphic Factors. Soil Biol. Biochem. 2015, 89, 206–209. [Google Scholar] [CrossRef]
- Raiger Iustman, L.J.; Almasqué, F.J.; Vullo, D.L. Microbiota Diversity Change as Quality Indicator of Soils Exposed to Intensive Periurban Agriculture. Curr. Microbiol. 2021, 78, 338–346. [Google Scholar] [CrossRef] [PubMed]
- Roy, S.; Chakraborty, A.P.; Chakraborty, R. Understanding the Potential of Root Microbiome Influencing Salt-Tolerance in Plants and Mechanisms Involved at the Transcriptional and Translational Level. Physiol. Plant. 2021, 173, 1657–1681. [Google Scholar] [CrossRef] [PubMed]
- Chaudhary, D.R.; Rathore, A.P.; Kumar, R.; Jha, B. Spatial and Halophyte-Associated Microbial Communities in Intertidal Coastal Region of India. Int. J. Phytoremediation 2017, 19, 478–489. [Google Scholar] [CrossRef] [PubMed]
- Ren, Y.; Shao, Q.; Ge, W.; Li, X.; Wang, H.; Dong, C.; Zhang, Y.; Deshmukh, S.K.; Han, Y. Assembly Processes and Biogeographical Characteristics of Soil Bacterial Sub-Communities of Different Habitats in Urban Green Spaces. Curr. Microbiol. 2023, 80, 309. [Google Scholar] [CrossRef]
- Zhang, G.; Bai, J.; Jia, J.; Wang, W.; Wang, D.; Zhao, Q.; Wang, C.; Chen, G. Soil Microbial Communities Regulate the Threshold Effect of Salinity Stress on SOM Decomposition in Coastal Salt Marshes. Fundam. Res. 2023. [Google Scholar] [CrossRef]
- Zheng, Y.; Cao, X.; Zhou, Y.; Li, Z.; Yang, Y.; Zhao, D.; Li, Y.; Xu, Z.; Zhang, C.-S. Effect of Planting Salt-Tolerant Legumes on Coastal Saline Soil Nutrient Availability and Microbial Communities. J. Environ. Manag. 2023, 345, 118574. [Google Scholar] [CrossRef] [PubMed]
- Xu, Y.; Zhang, G.; Ding, H.; Ci, D.; Dai, L.; Zhang, Z. Influence of Salt Stress on the Rhizosphere Soil Bacterial Community Structure and Growth Performance of Groundnut (Arachis Hypogaea L.). Int. Microbiol. 2020, 23, 453–465. [Google Scholar] [CrossRef]
- Chen, Z.; Zheng, Y.; Ding, C.; Ren, X.; Yuan, J.; Sun, F.; Li, Y. Integrated Metagenomics and Molecular Ecological Network Analysis of Bacterial Community Composition during the Phytoremediation of Cadmium-Contaminated Soils by Bioenergy Crops. Ecotoxicol. Environ. Saf. 2017, 145, 111–118. [Google Scholar] [CrossRef]
- Santolini, M.; Barabási, A.-L. Predicting Perturbation Patterns from the Topology of Biological Networks. Proc. Natl. Acad. Sci. USA 2018, 115, E6375–E6383. [Google Scholar] [CrossRef] [PubMed]
- Fan, K.; Delgado-Baquerizo, M.; Guo, X.; Wang, D.; Zhu, Y.; Chu, H. Biodiversity of Key-Stone Phylotypes Determines Crop Production in a 4-Decade Fertilization Experiment. ISME J. 2021, 15, 550–561. [Google Scholar] [CrossRef] [PubMed]
- Van Horn, D.J.; Okie, J.G.; Buelow, H.N.; Gooseff, M.N.; Barrett, J.E.; Takacs-Vesbach, C.D. Soil Microbial Responses to Increased Moisture and Organic Resources along a Salinity Gradient in a Polar Desert. Appl. Environ. Microbiol. 2014, 80, 3034–3043. [Google Scholar] [CrossRef] [PubMed]
- Huang, G.; Sun, Y.; Zhang, X.; Rodríguez, L.G.; Luo, J.; Chen, Z.; Ou, Y.; Gao, Y.; Ghaffari, H.; Yao, Y. Adaptation to Low Nitrogen and Salt Stresses in the Desert Poplar by Effective Regulation of Nitrogen Assimilation and Ion Balance. Plant Physiol. Biochem. 2022, 193, 14–24. [Google Scholar] [CrossRef] [PubMed]
pH | EC (ms·cm−1) | Salinity (g·kg−1) | TOC (%) | TN (g·kg−1) | AP (mg·g−1) | SWC (%) |
---|---|---|---|---|---|---|
7.35 ± 0.03 | 0.28 ± 0.01 | 0.72 ± 0.10 | 1.47 ± 0.03 | 0.94 ± 0.03 | 23.89 ± 0.20 | 27.87 |
Amplicon Sequencing | Primer IDs | Forward Primer Sequence (5′–3′) | Reference |
---|---|---|---|
16S rRNA | 515F | GTGNCAGCMGCCGCGGTAA | Quince et al. (2011) [23] |
907R | CCGYCAATTYMTTTRAGTTT | Lane et al. (1991) [24] | |
ITS | ITS1F | CTTGGTCATTTAGAGGAAGTAA | Gurr et al. (1991) [25] |
ITS2R | GCTGCGTTCTTCATCGATGC | Edgar et al. (2013) [26] |
Gene | Primer IDs | Primer Sequence (5′–3′) | Reference |
---|---|---|---|
Archaeal amoA | Arch-amoAF | STAATGGTCTGGCTTAGACG | Tourna et al. (2008) [27] |
Arch-amoAR | GCGGCCATCCATCTGTATGT | Francis et al. (2005) [28] | |
Bacterial amoA | amoA-1F | GGGGTTTCTACTGGTGGT | Rotthauwe et al. (1997) [29] |
amoA-2R | CCCCTCKGSAAAGCCTTCTTC | ||
nifH | nifH-F | AAAGGYGGWATCGGYAARTCCACCAC | Rösch and Bothe (2005) [30] |
nifH-Rb | TTGTTSGCSGCRTACATSGCCATCAT | ||
nirS | cd3AF | GTSAACGTSAAGGASACSGG | Michotey et al. (2000) [31] |
R3cd | GASTTCGGRTGSGTCTTGA | Kandeler et al. (2006) [32] | |
nirK | nirK 1F | GGMATGGTKCCSTGGCA | Braker et al. (1998) [33] |
nirK 5R | GCCTCGATCAGRTTRTGGTT | ||
nosZ | nosZ2F | CGCRACGGCAASAAGGTSMSSGT | Henry et al. (2006) [34] |
nosZ2R | CAKRTGCAKSGCRTGGCAGAA |
Microbial Community | Phylum | Salinity | Day |
---|---|---|---|
Bacteria | R2 | 0.236 | 0.129 |
P | 0.002 | 0.031 | |
Sig. | ** | * | |
Fungi | R2 | 0.195 | 0.086 |
P | 0.085 | 0.243 | |
Sig. | - | - |
Variable | Explains (%) | F | P |
---|---|---|---|
Salinity | 24.8 | 5.3 | 0.006 ** |
NH4+_N | 22.4 | 6.4 | 0.014 * |
(a) | |||
NH4+_N | 41.6 | 12.8 | 0.002 ** |
EC | 13.8 | 6.6 | 0.018 * |
(b) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhao, X.; Meng, T.; Jin, S.; Ren, K.; Cai, Z.; Cai, B.; Li, S. The Salinity Survival Strategy of Chenopodium quinoa: Investigating Microbial Community Shifts and Nitrogen Cycling in Saline Soils. Microorganisms 2023, 11, 2829. https://doi.org/10.3390/microorganisms11122829
Zhao X, Meng T, Jin S, Ren K, Cai Z, Cai B, Li S. The Salinity Survival Strategy of Chenopodium quinoa: Investigating Microbial Community Shifts and Nitrogen Cycling in Saline Soils. Microorganisms. 2023; 11(12):2829. https://doi.org/10.3390/microorganisms11122829
Chicago/Turabian StyleZhao, Xuli, Tianzhu Meng, Shenghan Jin, Kaixing Ren, Zhe Cai, Bo Cai, and Saibao Li. 2023. "The Salinity Survival Strategy of Chenopodium quinoa: Investigating Microbial Community Shifts and Nitrogen Cycling in Saline Soils" Microorganisms 11, no. 12: 2829. https://doi.org/10.3390/microorganisms11122829