Chemoprevention of DMH-Induced Early Colon Carcinogenesis in Male BALB/c Mice by Administration of Lactobacillus Paracasei DTA81
Abstract
:1. Introduction
2. Materials and Methods
2.1. Probiotic Strains, Fermented Milk Production, and Probiotic Dose
2.2. Animals and Experimental Design
2.2.1. Animals
2.2.2. Study Design
- Group GSM (skim milk): 300 mg of freeze-dried skim milk resuspended with 0.1 mL of sterile tap water.
- Group DTA81 (L. paracasei DTA81): 300 mg of freeze-dried fermented milk containing ~3 × 109 cells/0.1 mL of sterile tap water daily.
- Group LGG (L. rhamnosus GG): 300 mg of freeze-dried fermented milk containing ~3 × 109 cells/0.1 mL of sterile tap water daily.
- Group GNI (non-intervention): 0.1 mL of sterile tap water daily.
2.3. Food Intake, Body Weight, and Feces Collection
2.4. Euthanasia
2.5. Evaluation of Liver Oxidative Stress Markers
2.6. Cytokine Profile in Colon Homogenate
2.7. Fecal Short-Chain Fatty Acids (SCFAs) Quantification
2.8. Quantitative Real-Time Polymerase Chain Reaction (RT-qPCR)
2.9. Fecal Bacterial Composition Analysis Using Next-Generation Sequencing (NGS)
2.9.1. DNA Extraction
2.9.2. 16S rRNA Gene Amplicon Sequencing
2.9.3. Bioinformatic Data Analyses
2.10. Statistical Analysis
3. Results
3.1. Food Intake and Body Weight
3.2. Effect of L. Paracasei DTA81 on Oxidative Stress Biomarkers in the Liver
3.3. Cytokine Production Profile in Colon Tissue
3.4. The Caecal Concentration of SCFA
3.5. RT-qPCR
3.6. Bacterial Community Profile
3.6.1. Alpha and Beta Diversity Analyses
3.6.2. Microbiota Profiling and Linear Discriminant Analysis Effect Size (LEfSe) Analysis
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- WHO. Fiscal Policies for Diet and the Prevention of Noncommunicable Diseases; WHO Regional Office for Europe: Copenhagen, Denmark, 2015. [Google Scholar]
- Bray, F.; Ferlay, J.; Soerjomataram, I.; Siegel, R.L.; Torre, L.A.; Jemal, A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 2018, 68, 394–424. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Poti, J.M.; Braga, B.; Qin, B. Ultra-processed Food Intake and Obesity: What Really Matters for Health—Processing or Nutrient Content? Curr. Obes. Rep. 2017, 6, 420–431. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Liu, X.; Zhang, C.; Zhu, H.; Xu, Q.; Bu, Y.; Lei, Y. Redox imbalance in the development of colorectal cancer. J. Cancer 2017, 8, 1586. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tuomisto, A.E.; Mäkinen, M.J.; Väyrynen, J.P. Systemic inflammation in colorectal cancer: Underlying factors, effects, and prognostic significance. World J. Gastroenterol. 2019, 25, 4383–4404. [Google Scholar] [CrossRef]
- De Almeida, C.V.; de Camargo, M.R.; Russo, E.; Amedei, A. Role of diet and gut microbiota on colorectal cancer immunomodulation. World J. Gastroenterol. 2018, 25, 151–162. [Google Scholar] [CrossRef]
- Montalban-Arques, A.; Scharl, M. Intestinal microbiota and colorectal carcinoma: Implications for pathogenesis, diagnosis, and therapy. EBioMedicine 2019, 48, 648–655. [Google Scholar] [CrossRef] [Green Version]
- Saus, E.; Iraola-Guzmán, S.; Willis, J.R.; Brunet-Vega, A.; Gabaldón, T. Microbiome and colorectal cancer: Roles in carcinogenesis and clinical potential. Mol. Asp. Med. 2019, 69, 93–106. [Google Scholar] [CrossRef]
- Yang, J.; McDowell, A.; Kim, E.K.; Seo, H.; Lee, W.H.; Moon, C.-M.; Kym, S.-M.; Lee, D.H.; Park, Y.S.; Jee, Y.-K.; et al. Development of a colorectal cancer diagnostic model and dietary risk assessment through gut microbiome analysis. Exp. Mol. Med. 2019, 51, 1–15. [Google Scholar] [CrossRef] [Green Version]
- Hendler, R.; Zhang, Y. Probiotics in the Treatment of Colorectal Cancer. Medicines 2018, 5, 101. [Google Scholar] [CrossRef] [Green Version]
- Villéger, R.; Lopès, A.; Veziant, J.; Gagnière, J.; Barnich, N.; Billard, E.; Boucher, D.; Bonnet, M. Microbial markers in colorectal cancer detection and/or prognosis. World J. Gastroenterol. 2018, 24, 2327–2347. [Google Scholar] [CrossRef]
- Dos Reis, S.A.; da Conceição, L.L.; e Dias, M.M.; Siqueira, N.P.; Rosa, D.D.; de Oliveira, L.L.; da Matta, S.L.P.; do Carmo Gouveia Peluzio, M. Kefir reduces the incidence of pre-neoplastic lesions in an animal model for colorectal cancer. J. Funct. Foods 2019, 53, 1–6. [Google Scholar] [CrossRef]
- Bishehsari, F.; Engen, P.; Preite, N.; Tuncil, Y.; Naqib, A.; Shaikh, M.; Rossi, M.; Wilber, S.; Green, S.; Hamaker, B.; et al. Dietary Fiber Treatment Corrects the Composition of Gut Microbiota, Promotes SCFA Production, and Suppresses Colon Carcinogenesis. Genes 2018, 9, 102. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, C.-W.; Chen, H.-J.; Xie, G.-R.; Shih, C.-K. Djulis (Chenopodium Formosanum) Prevents Colon Carcinogenesis via Regulating Antioxidative and Apoptotic Pathways in Rats. Nutrients 2019, 11, 2168. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dos Santos Cruz, B.C.; da Silva Duarte, V.; Giacomini, A.; Corich, V.; de Paula, S.O.; da Silva Fialho, L.; Guimarães, V.M.; de Luces Fortes Ferreira, C.L.; do Carmo Gouveia Peluzio, M. Synbiotic VSL#3 and yacon-based product modulate the intestinal microbiota and prevent the development of pre-neoplastic lesions in a colorectal carcinogenesis model. Appl. Microbiol. Biotechnol. 2020, 104, 8837–8857. [Google Scholar] [PubMed]
- Cruz, B.C.S.; Sarandy, M.M.; Messias, A.C.; Gonçalves, R.V.; Ferreira, C.L.L.F.; Peluzio, M.C.G. Preclinical and clinical relevance of probiotics and synbiotics in colorectal carcinogenesis: A systematic review. Nutr. Rev. 2020, 78, 667–687. [Google Scholar] [CrossRef] [PubMed]
- Ranadheera, C.; Vidanarachchi, J.; Rocha, R.; Cruz, A.; Ajlouni, S. Probiotic Delivery through Fermentation: Dairy vs. Non-Dairy Beverages. Fermentation 2017, 3, 67. [Google Scholar] [CrossRef] [Green Version]
- Homayouni, A.; Ansari, F.; Azizi, A.; Pourjafar, H.; Madadi, M. Cheese as a Potential Food Carrier to Deliver Probiotic Microorganisms into the Human Gut: A Review. Curr. Nutr. Food Sci. 2020, 16, 15–28. [Google Scholar] [CrossRef]
- Tarrah, A.; da Silva Duarte, V.; de Castilhos, J.; Pakroo, S.; Lemos Junior, W.J.F.; Luchese, R.H.; Fioravante Guerra, A.; Rossi, R.C.; Righetto Ziegler, D.; Corich, V.; et al. Probiotic potential and biofilm inhibitory activity of Lactobacillus casei group strains isolated from infant feces. J. Funct. Foods 2019, 54, 489–497. [Google Scholar] [CrossRef]
- Iyer, R.; Tomar, S.K. Dietary effect of folate-rich fermented milk produced by Streptococcus thermophilus strains on hemoglobin level. Nutrition 2011, 27, 994–997. [Google Scholar] [CrossRef]
- Newell, L.E.; Heddle, J.A. The potent colon carcinogen, 1,2-dimethylhydrazine induces mutations primarily in the colon. Mutat. Res. Genet. Toxicol. Environ. Mutagenesis 2004, 564, 1–7. [Google Scholar] [CrossRef]
- Lowry, O.H.; Rosenbrough, N.J.; Farr, A.L.; Randall, R.J. Protein measurement with the folin. J. Biol. Chem. 1951, 193, 265–275. [Google Scholar] [PubMed]
- Aebi, H. Catalase in vitro. In Methods in Enzymology; Academic Press: Cambridge, MA, USA, 1984; pp. 121–126. [Google Scholar]
- Marklund, S.L. Product of extracellular-superoxide dismutase catalysis. FEBS Lett. 1985, 184, 237–239. [Google Scholar] [CrossRef] [Green Version]
- Buege, J.A.; Aust, S.D. Microsomal lipid peroxidation. In Methods in Enzymology; Academic Press: Cambridge, MA, USA, 1978; pp. 302–310. [Google Scholar]
- Levine, R.L.; Garland, D.; Oliver, C.N.; Amici, A.; Climent, I.; Lenz, A.-G.; Ahn, B.-W.; Shaltiel, S.; Stadtman, E.R. Determination of carbonyl content in oxidatively modified proteins. In Methods in Enzymology; Academic Press: Cambridge, MA, USA, 1990; pp. 464–478. [Google Scholar]
- Siegfried, R.; Ruckemann, H.; Stumpf, G. Method for the determination of organic-acids in silage by high-performance liquid-chromatography. Landwirtsch. Forsch. 1984, 37, 298–304. [Google Scholar]
- Lin, Y.; Sun, Z. In Vivo Pancreatic β-Cell–Specific Expression of Antiaging Gene Klotho: A Novel Approach for Preserving β-Cells in Type 2 Diabetes. Diabetes 2015, 64, 1444–1458. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mengying, Z.; Yiyue, X.; Tong, P.; Yue, H.; Limpanont, Y.; Ping, H.; Okanurak, K.; Yanqi, W.; Dekumyoy, P.; Hongli, Z.; et al. Apoptosis and necroptosis of mouse hippocampal and parenchymal astrocytes, microglia and neurons caused by Angiostrongylus cantonensis infection. Parasites Vectors 2017, 10, 611. [Google Scholar] [CrossRef] [Green Version]
- Zeineldin, M.; Cunningham, J.; McGuinness, W.; Alltizer, P.; Cowley, B.; Blanchat, B.; Xu, W.; Pinson, D.; Neufeld, K.L. A knock-in mouse model reveals roles for nuclear Apc in cell proliferation, Wnt signal inhibition and tumor suppression. Oncogene 2012, 31, 2423–2437. [Google Scholar] [CrossRef] [Green Version]
- Kiatpakdee, B.; Sato, K.; Otsuka, Y.; Arashiki, N.; Chen, Y.; Tsumita, T.; Otsu, W.; Yamamoto, A.; Kawata, R.; Yamazaki, J.; et al. Cholesterol-binding protein TSPO2 coordinates maturation and proliferation of terminally differentiating erythroblasts. J. Biol. Chem. 2020, 295, 8048–8063. [Google Scholar] [CrossRef]
- Piranlioglu, R.; Lee, E.; Ouzounova, M.; Bollag, R.J.; Vinyard, A.H.; Arbab, A.S.; Marasco, D.; Guzel, M.; Cowell, J.K.; Thangaraju, M.; et al. Primary tumor-induced immunity eradicates disseminated tumor cells in syngeneic mouse model. Nat. Commun. 2019, 10, 1430. [Google Scholar] [CrossRef] [Green Version]
- Dhariwal, A.; Chong, J.; Habib, S.; King, I.L.; Agellon, L.B.; Xia, J. MicrobiomeAnalyst: A web-based tool for comprehensive statistical, visual and meta-analysis of microbiome data. Nucleic Acids Res. 2017, 45, W180–W188. [Google Scholar] [CrossRef]
- Segata, N.; Izard, J.; Waldron, L.; Gevers, D.; Miropolsky, L.; Garrett, W.S.; Huttenhower, C. Metagenomic biomarker discovery and explanation. Genome Biol. 2011, 12, R60. [Google Scholar] [CrossRef] [Green Version]
- Drago, L. Probiotics and colon cancer. Microorganisms 2019, 7, 66. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Legesse Bedada, T.; Feto, T.K.; Awoke, K.S.; Garedew, A.D.; Yifat, F.T.; Birri, D.J. Probiotics for cancer alternative prevention and treatment. Biomed. Pharmacother. 2020, 129, 110409. [Google Scholar] [CrossRef]
- Terracini, B. Monographs on the Evaluation of Carcinogenic Risk of Chemicals to Man. Tumori J. 1975, 61, 315–316. [Google Scholar] [CrossRef] [Green Version]
- Perše, M.; Cerar, A. Morphological and Molecular Alterations in 1,2 Dimethylhydrazine and Azoxymethane Induced Colon Carcinogenesis in Rats. J. Biomed. Biotechnol. 2011, 2011, 473964. [Google Scholar] [CrossRef]
- Zhu, Q.; Gao, R.; Wu, W.; Qin, H. The role of gut microbiota in the pathogenesis of colorectal cancer. Tumor Biol. 2013, 34, 1285–1300. [Google Scholar] [CrossRef]
- Brenner, D.A.; Paik, Y.-H.; Schnabl, B. Role of Gut Microbiota in Liver Disease. J. Clin. Gastroenterol. 2015, 49, S25–S27. [Google Scholar] [CrossRef] [Green Version]
- Takaki, A.; Kawano, S.; Uchida, D.; Takahara, M.; Hiraoka, S.; Okada, H. Paradoxical Roles of Oxidative Stress Response in the Digestive System before and after Carcinogenesis. Cancers 2019, 11, 213. [Google Scholar] [CrossRef] [Green Version]
- Wang, Y.; Wu, Y.; Wang, Y.; Xu, H.; Mei, X.; Yu, D.; Wang, Y.; Li, W. Antioxidant Properties of Probiotic Bacteria. Nutrients 2017, 9, 521. [Google Scholar] [CrossRef]
- Hu, P.; Song, W.; Shan, Y.; Du, M.; Huang, M.; Song, C.; Zhang, L. Lactobacillus paracasei subsp. paracasei M5L induces cell cycle arrest and calreticulin translocation via the generation of reactive oxygen species in HT-29 cell apoptosis. Food Funct. 2015, 6, 2257–2265. [Google Scholar] [CrossRef]
- Zhao, J.; Yu, L.; Zhai, Q.; Tian, F.; Zhang, H.; Chen, W. Effects of probiotic administration on hepatic antioxidative parameters depending on oxidative stress models: A meta-analysis of animal experiments. J. Funct. Foods 2020, 71, 103936. [Google Scholar] [CrossRef]
- Walia, S.; Kamal, R.; Dhawan, D.K.; Kanwar, S.S. Chemoprevention by Probiotics During 1,2-Dimethylhydrazine-Induced Colon Carcinogenesis in Rats. Dig. Dis. Sci. 2018, 63, 900–909. [Google Scholar] [CrossRef] [PubMed]
- Sharma, M.; Shukla, G. Administration of Metabiotics Extracted from Probiotic Lactobacillus rhamnosus MD 14 Inhibit Experimental Colorectal Carcinogenesis by Targeting Wnt/β-Catenin Pathway. Front. Oncol. 2020, 10, 746. [Google Scholar] [CrossRef] [PubMed]
- Lin, W.-W.; Karin, M. A cytokine-mediated link between innate immunity, inflammation, and cancer. J. Clin. Investig. 2007, 117, 1175–1183. [Google Scholar] [CrossRef] [PubMed]
- Lamichhane, P.; Maiolini, M.; Alnafoosi, O.; Hussein, S.; Alnafoosi, H.; Umbela, S.; Richardson, T.; Alla, N.; Lamichhane, N.; Subhadra, B.; et al. Colorectal Cancer and Probiotics: Are Bugs Really Drugs? Cancers 2020, 12, 1162. [Google Scholar] [CrossRef] [PubMed]
- Panahipour, L.; Nasserzare, S.; Amer, Z.; Brücke, F.; Stähli, A.; Kreissl, A.; Haiden, N.; Gruber, R. The anti-inflammatory effect of milk and dairy products on periodontal cells: An in vitro approach. Clin. Oral Investig. 2019, 23, 1959–1966. [Google Scholar] [CrossRef] [Green Version]
- Ozawa, T.; Miyata, M.; Nishimura, M.; Ando, T.; Ouyang, Y.; Ohba, T.; Shimokawa, N.; Ohnuma, Y.; Katoh, R.; Ogawa, H.; et al. Transforming Growth Factor-β Activity in Commercially Available Pasteurized Cow Milk Provides Protection against Inflammation in Mice. J. Nutr. 2009, 139, 69–75. [Google Scholar] [CrossRef] [Green Version]
- Chen, Y.; Patel, A.; Meier, P.P.; Fantuzzi, G. Digested Early Preterm Human Milk Suppresses Tumor Necrosis Factor–induced Inflammation and Cytotoxicity in Intestinal Epithelial Cells. J. Pediatr. Gastroenterol. Nutr. 2018, 66, e153–e157. [Google Scholar] [CrossRef]
- Bordoni, A.; Danesi, F.; Dardevet, D.; Dupont, D.; Fernandez, A.S.; Gille, D.; Nunes dos Santos, C.; Pinto, P.; Re, R.; Rémond, D.; et al. Dairy products and inflammation: A review of the clinical evidence. Crit. Rev. Food Sci. Nutr. 2017, 57, 2497–2525. [Google Scholar] [CrossRef]
- Rooks, M.G.; Veiga, P.; Wardwell-Scott, L.H.; Tickle, T.; Segata, N.; Michaud, M.; Gallini, C.A.; Beal, C.; Van Hylckama-Vlieg, J.E.T.; Ballal, S.A.; et al. Gut microbiome composition and function in experimental colitis during active disease and treatment-induced remission. ISME J. 2014, 8, 1403–1417. [Google Scholar] [CrossRef]
- Veiga, P.; Gallini, C.A.; Beal, C.; Michaud, M.; Delaney, M.L.; DuBois, A.; Khlebnikov, A.; Van Hylckama Vlieg, J.E.T.; Punit, S.; Glickman, J.N.; et al. Bifidobacterium animalis subsp. lactis fermented milk product reduces inflammation by altering a niche for colitogenic microbes. Proc. Natl. Acad. Sci. USA 2010, 107, 18132–18137. [Google Scholar] [CrossRef] [Green Version]
- Zeng, J.; Tang, Z.-H.; Liu, S.; Guo, S.-S. Clinicopathological significance of overexpression of interleukin-6 in colorectal cancer. World J. Gastroenterol. 2017, 23, 1780. [Google Scholar] [CrossRef] [PubMed]
- Razi, S.; Baradaran Noveiry, B.; Keshavarz-Fathi, M.; Rezaei, N. IL-17 and colorectal cancer: From carcinogenesis to treatment. Cytokine 2019, 116, 7–12. [Google Scholar] [CrossRef] [PubMed]
- Wang, Q.; Feng, M.; Yu, T.; Liu, X.; Zhang, P. Intratumoral regulatory T cells are associated with suppression of colorectal carcinoma metastasis after resection through overcoming IL-17 producing T cells. Cell. Immunol. 2014, 287, 100–105. [Google Scholar] [CrossRef] [PubMed]
- Hurtado, C.G.; Wan, F.; Housseau, F.; Sears, C.L. Roles for Interleukin 17 and Adaptive Immunity in Pathogenesis of Colorectal Cancer. Gastroenterology 2018, 155, 1706–1715. [Google Scholar] [CrossRef] [PubMed]
- Ernst, M.; Putoczki, T. IL-17 Cuts to the Chase in Colon Cancer. Immunity 2014, 41, 880–882. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dunne, M.R.; Ryan, C.; Nolan, B.; Tosetto, M.; Geraghty, R.; Winter, D.C.; O’Connell, P.R.; Hyland, J.M.; Doherty, G.A.; Sheahan, K.; et al. Enrichment of Inflammatory IL-17 and TNF-α Secreting CD4+ T Cells within Colorectal Tumors despite the Presence of Elevated CD39+ T Regulatory Cells and Increased Expression of the Immune Checkpoint Molecule, PD-1. Front. Oncol. 2016, 6, 50. [Google Scholar] [CrossRef] [Green Version]
- Pagnini, C.; Corleto, V.D.; Martorelli, M.; Lanini, C.; D’Ambra, G.; Di Giulio, E.; Fave, G.D. Mucosal adhesion and anti-inflammatory effects of Lactobacillus rhamnosus GG in the human colonic mucosa: A proof-of-concept study. World J. Gastroenterol. 2018, 24, 4652–4662. [Google Scholar] [CrossRef]
- Li, N.; Russell, W.M.; Douglas-Escobar, M.; Hauser, N.; Lopez, M.; Neu, J. Live and Heat-Killed Lactobacillus rhamnosus GG: Effects on Proinflammatory and Anti-Inflammatory Cytokines/Chemokines in Gastrostomy-Fed Infant Rats. Pediatr. Res. 2009, 66, 203–207. [Google Scholar] [CrossRef] [Green Version]
- Sharaf, L.K.; Sharma, M.; Chandel, D.; Shukla, G. Prophylactic intervention of probiotics (L.acidophilus, L.rhamnosus GG) and celecoxib modulate Bax-mediated apoptosis in 1,2-dimethylhydrazine-induced experimental colon carcinogenesis. BMC Cancer 2018, 18, 1111. [Google Scholar] [CrossRef]
- Kekkonen, R.A.; Lummela, N.; Karjalainen, H.; Latvala, S.; Tynkkynen, S.; Järvenpää, S.; Kautiainen, H.; Julkunen, I.; Vapaatalo, H.; Korpela, R. Probiotic intervention has strain-specific anti-inflammatory effects in healthy adults. World J. Gastroenterol. 2008, 14, 2029. [Google Scholar] [CrossRef]
- Gamallat, Y.; Meyiah, A.; Kuugbee, E.D.; Hago, A.M.; Chiwala, G.; Awadasseid, A.; Bamba, D.; Zhang, X.; Shang, X.; Luo, F.; et al. Lactobacillus rhamnosus induced epithelial cell apoptosis, ameliorates inflammation and prevents colon cancer development in an animal model. Biomed. Pharmacother. 2016, 83, 536–541. [Google Scholar] [CrossRef] [PubMed]
- Tedelind, S.; Westberg, F.; Kjerrulf, M.; Vidal, A. Anti-inflammatory properties of the short-chain fatty acids acetate and propionate: A study with relevance to inflammatory bowel disease. World J. Gastroenterol. 2007, 13, 2826. [Google Scholar] [CrossRef] [PubMed]
- Dos Reis, S.A.; da Conceição, L.L.; Siqueira, N.P.; Rosa, D.D.; da Silva, L.L.; do Carmo Gouveia Peluzio, M. Review of the mechanisms of probiotic actions in the prevention of colorectal cancer. Nutr. Res. 2017, 37, 1–19. [Google Scholar] [CrossRef]
- Molska, M.; Reguła, J. Potential Mechanisms of Probiotics Action in the Prevention and Treatment of Colorectal Cancer. Nutrients 2019, 11, 2453. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Weir, T.L.; Manter, D.K.; Sheflin, A.M.; Barnett, B.A.; Heuberger, A.L.; Ryan, E.P. Stool Microbiome and Metabolome Differences between Colorectal Cancer Patients and Healthy Adults. PLoS ONE 2013, 8, e70803. [Google Scholar] [CrossRef] [Green Version]
- Chen, H.-M.; Yu, Y.-N.; Wang, J.-L.; Lin, Y.-W.; Kong, X.; Yang, C.-Q.; Yang, L.; Liu, Z.-J.; Yuan, Y.-Z.; Liu, F.; et al. Decreased dietary fiber intake and structural alteration of gut microbiota in patients with advanced colorectal adenoma. Am. J. Clin. Nutr. 2013, 97, 1044–1052. [Google Scholar] [CrossRef] [Green Version]
- Lin, Y.; Ma, C.; Liu, C.; Wang, Z.; Yang, J.; Liu, X.; Shen, Z.; Wu, R. NMR-based fecal metabolomics fingerprinting as predictors of earlier diagnosis in patients with colorectal cancer. Oncotarget 2016, 7, 29454–29464. [Google Scholar] [CrossRef]
- Marchesi, J.R.; Holmes, E.; Khan, F.; Kochhar, S.; Scanlan, P.; Shanahan, F.; Wilson, I.D.; Wang, Y. Rapid and Noninvasive Metabonomic Characterization of Inflammatory Bowel Disease. J. Proteome Res. 2007, 6, 546–551. [Google Scholar] [CrossRef]
- Ferrario, C.; Taverniti, V.; Milani, C.; Fiore, W.; Laureati, M.; De Noni, I.; Stuknyte, M.; Chouaia, B.; Riso, P.; Guglielmetti, S. Modulation of fecal clostridiales bacteria and butyrate by probiotic intervention with Lactobacillus paracasei DG varies among healthy adults. J. Nutr. 2014, 144, 1787–1796. [Google Scholar] [CrossRef] [Green Version]
- Parisa, A.; Roya, G.; Mahdi, R.; Shabnam, R.; Maryam, E.; Malihe, T. Anti-cancer effects of Bifidobacterium species in colon cancer cells and a mouse model of carcinogenesis. PLoS ONE 2020, 15, e0232930. [Google Scholar] [CrossRef]
- Chang, C.-Y.; Pan, T.-M. Anticancer and Antimigration Effects of a Combinatorial Treatment of 5-Fluorouracil and Lactobacillus paracasei subsp. paracasei NTU 101 Fermented Skim Milk Extracts on Colorectal Cancer Cells. J. Agric. Food Chem. 2018, 66, 5549–5555. [Google Scholar] [CrossRef] [PubMed]
- Elbadawy, M.; Usui, T.; Yamawaki, H.; Sasaki, K. Emerging Roles of c-myc in Cancer Stem Cell-Related Signaling and Resistance to Cancer Chemotherapy: A Potential Therapeutic Target against Colorectal Cancer. Int. J. Mol. Sci. 2019, 20, 2340. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cancer Genome Atlas Network. Comprehensive molecular characterization of human colon and rectal cancer. Nature 2012, 487, 330–337. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yu, W.; Liu, C.; Li, X.; Yang, F.; Cheng, L.; Liu, C.; Song, Y. Inositol hexaphosphate suppresses colorectal cancer cell proliferation via the Akt/GSK-3β/β-catenin signaling cascade in a 1,2-dimethylhydrazine-induced rat model. Eur. J. Pharmacol. 2017, 805, 67–74. [Google Scholar] [CrossRef] [PubMed]
- Kumar, K.N.; Raja, S.B.; Vidhya, N.; Devaraj, S.N. Ellagic acid modulates antioxidant status, ornithine decarboxylase expression, and aberrant crypt foci progression in 1,2-dimethylhydrazine-instigated colon preneoplastic lesions in rats. J. Agric. Food Chem. 2012, 60, 3665–3672. [Google Scholar] [CrossRef]
- Wang, S.; Zhang, Y.; Huang, J.; Wong, C.C.; Zhai, J.; Li, C.; Wei, G.; Zhao, L.; Wang, G.; Wei, H.; et al. TRIM67 activates p53 to suppress colorectal cancer initiation and progression. Cancer Res. 2019, 79, 4086–4098. [Google Scholar] [CrossRef] [Green Version]
- Li, H.; Zhang, J.; Tong, J.H.M.; Chan, A.W.H.; Yu, J.; Kang, W.; To, K.F. Targeting the Oncogenic p53 Mutants in Colorectal Cancer and Other Solid Tumors. Int. J. Mol. Sci. 2019, 20, 5999. [Google Scholar] [CrossRef] [Green Version]
- Wan, Y.; Xin, Y.; Zhang, C.; Wu, D.; Ding, D.; Tang, L.; Owusu, L.; Bai, J.; Li, W. Fermentation supernatants of Lactobacillus delbrueckii inhibit growth of human colon cancer cells and induce apoptosis through a caspase 3-dependent pathway. Oncol. Lett. 2014, 7, 1738–1742. [Google Scholar] [CrossRef] [Green Version]
- Chondrou, P.; Karapetsas, A.; Kiousi, D.E.; Tsela, D.; Tiptiri-Kourpeti, A.; Anestopoulos, I.; Kotsianidis, I.; Bezirtzoglou, E.; Pappa, A.; Galanis, A. Lactobacillus paracasei K5 displays adhesion, anti-proliferative activity and apoptotic effects in human colon cancer cells. Benef. Microbes 2018, 9, 975–983. [Google Scholar] [CrossRef]
- Cai, F.; Li, J.; Pan, X.; Zhang, C.; Wei, D.; Gao, C. Increased Expression of PCNA-AS1 in Colorectal Cancer and its Clinical Association. Clin. Lab. 2017, 63, 1809–1814. [Google Scholar] [CrossRef]
- Guzińska-Ustymowicz, K.; Pryczynicz, A.; Kemona, A.; Czyzewska, J. Correlation between proliferation markers: PCNA, Ki-67, MCM-2 and antiapoptotic protein Bcl-2 in colorectal cancer. Anticancer Res. 2009, 29, 3049–3052. [Google Scholar] [PubMed]
- Mohania, D.; Kansal, V.K.; Kruzliak, P.; Kumari, A. Probiotic Dahi containing Lactobacillus acidophilus and Bifidobacterium bifidum modulates the formation of aberrant crypt foci, mucin-depleted foci, and cell proliferation on 1,2-dimethylhydrazine-induced colorectal carcinogenesis in Wistar rats. Rejuvenation Res. 2014, 17, 325–333. [Google Scholar] [CrossRef] [PubMed]
- Zhu, J.; Zhu, C.; Ge, S.; Zhang, M.; Jiang, L.; Cui, J.; Ren, F. Lactobacillus salivarius Ren prevent the early colorectal carcinogenesis in 1, 2-dimethylhydrazine-induced rat model. J. Appl. Microbiol. 2014, 117, 208–216. [Google Scholar] [CrossRef]
- Le Leu, R.K.; Hu, Y.; Brown, I.L.; Woodman, R.J.; Young, G.P. Synbiotic intervention of Bifidobacterium lactis and resistant starch protects against colorectal cancer development in rats. Carcinogenesis 2010, 31, 246–251. [Google Scholar] [CrossRef] [PubMed]
- García-Castillo, V.; Sanhueza, E.; McNerney, E.; Onate, S.A.; García, A. Microbiota dysbiosis: A new piece in the understanding of the carcinogenesis puzzle. J. Med. Microbiol. 2016, 65, 1347–1362. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rajagopala, S.V.; Vashee, S.; Oldfield, L.M.; Suzuki, Y.; Venter, J.C.; Telenti, A.; Nelson, K.E. The Human Microbiome and Cancer. Cancer Prev. Res. 2017, 10, 226–234. [Google Scholar] [CrossRef] [Green Version]
- Gagliardi, A.; Totino, V.; Cacciotti, F.; Iebba, V.; Neroni, B.; Bonfiglio, G.; Trancassini, M.; Passariello, C.; Pantanella, F.; Schippa, S. Rebuilding the Gut Microbiota Ecosystem. Int. J. Environ. Res. Public Health 2018, 15, 1679. [Google Scholar] [CrossRef] [Green Version]
- Robles-Vera, I.; Toral, M.; la Visitación, N.; Sánchez, M.; Gómez-Guzmán, M.; Romero, M.; Yang, T.; Izquierdo-Garcia, J.L.; Jiménez, R.; Ruiz-Cabello, J.; et al. Probiotics Prevent Dysbiosis and the Rise in Blood Pressure in Genetic Hypertension: Role of Short-Chain Fatty Acids. Mol. Nutr. Food Res. 2020, 64, 1900616. [Google Scholar] [CrossRef]
- Kumar, R.; Sood, U.; Gupta, V.; Singh, M.; Scaria, J.; Lal, R. Recent Advancements in the Development of Modern Probiotics for Restoring Human Gut Microbiome Dysbiosis. Indian J. Microbiol. 2020, 60, 12–25. [Google Scholar] [CrossRef]
- Van de Wijgert, J.; Verwijs, M.C. Lactobacilli-containing vaginal probiotics to cure or prevent bacterial or fungal vaginal dysbiosis: A systematic review and recommendations for future trial designs. BJOG 2020, 127, 287–299. [Google Scholar] [CrossRef]
- Mangifesta, M.; Mancabelli, L.; Milani, C.; Gaiani, F.; De’Angelis, N.; De’Angelis, G.L.; van Sinderen, D.; Ventura, M.; Turroni, F. Mucosal microbiota of intestinal polyps reveals putative biomarkers of colorectal cancer. Sci. Rep. 2018, 8, 13974. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gao, Z.; Guo, B.; Gao, R.; Zhu, Q.; Qin, H. Microbiota disbiosis is associated with colorectal cancer. Front. Microbiol. 2015, 6, 20. [Google Scholar] [CrossRef] [PubMed]
- Sheng, Q.; Du, H.; Cheng, X.; Cheng, X.; Tang, Y.; Pan, L.; Wang, Q.; Lin, J. Characteristics of fecal gut microbiota in patients with colorectal cancer at different stages and different sites. Oncol. Lett. 2019, 18, 4834–4844. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hibberd, A.A.; Lyra, A.; Ouwehand, A.C.; Rolny, P.; Lindegren, H.; Cedgård, L.; Wettergren, Y. Intestinal microbiota is altered in patients with colon cancer and modified by probiotic intervention. BMJ Open Gastroenterol. 2017, 4, e000145. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Song, L.; Dong, X. Hydrogenoanaerobacterium saccharovorans gen. nov., sp. nov., isolated from H2-producing UASB granules. Int. J. Syst. Evol. Microbiol. 2009, 59, 295–299. [Google Scholar] [CrossRef] [Green Version]
- Guo, F.-F.; Yu, T.-C.; Hong, J.; Fang, J.-Y. Emerging Roles of Hydrogen Sulfide in Inflammatory and Neoplastic Colonic Diseases. Front. Physiol. 2016, 7, 156. [Google Scholar] [CrossRef] [Green Version]
- Bui, T.P.N.; Shetty, S.A.; Lagkouvardos, I.; Ritari, J.; Chamlagain, B.; Douillard, F.P.; Paulin, L.; Piironen, V.; Clavel, T.; Plugge, C.M.; et al. Comparative genomics and physiology of the butyrate-producing bacterium Intestinimonas butyriciproducens. Environ. Microbiol. Rep. 2016, 8, 1024–1037. [Google Scholar] [CrossRef]
- Ai, D.; Pan, H.; Li, X.; Gao, Y.; Liu, G.; Xia, L.C. Identifying Gut Microbiota Associated with Colorectal Cancer Using a Zero-Inflated Lognormal Model. Front. Microbiol. 2019, 10, 826. [Google Scholar] [CrossRef]
- Gupta, A.; Dhakan, D.B.; Maji, A.; Saxena, R.; Vishnu Prasoodanan, P.K.; Mahajan, S.; Pulikkan, J.; Kurian, J.; Gomez, A.M.; Scaria, J.; et al. Association of Flavonifractor plautii, a Flavonoid-Degrading Bacterium, with the Gut Microbiome of Colorectal Cancer Patients in India. mSystems 2019, 4. [Google Scholar] [CrossRef] [Green Version]
- Zhang, W.; Zhu, Y.-H.; Zhou, D.; Wu, Q.; Song, D.; Dicksved, J.; Wang, J.-F. Oral Administration of a Select Mixture of Bacillus Probiotics Affects the Gut Microbiota and Goblet Cell Function following Escherichia coli Challenge in Newly Weaned Pigs of Genotype MUC4 That Are Supposed To Be Enterotoxigenic E. coli F4ab/ac Receptor. Appl. Environ. Microbiol. 2017, 83. [Google Scholar] [CrossRef] [Green Version]
- Rossi, G.; Pengo, G.; Caldin, M.; Palumbo Piccionello, A.; Steiner, J.M.; Cohen, N.D.; Jergens, A.E.; Suchodolski, J.S. Comparison of Microbiological, Histological, and Immunomodulatory Parameters in Response to Treatment with Either Combination Therapy with Prednisone and Metronidazole or Probiotic VSL#3 Strains in Dogs with Idiopathic Inflammatory Bowel Disease. PLoS ONE 2014, 9, e94699. [Google Scholar]
- Zhang, X.; Zhao, Y.; Zhang, M.; Pang, X.; Xu, J.; Kang, C.; Li, M.; Zhang, C.; Zhang, Z.; Zhang, Y.; et al. Structural changes of gut microbiota during berberine-mediated prevention of obesity and insulin resistance in high-fat diet-fed rats. PLoS ONE 2012, 7, e42529. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, T.; Aquino, V.; Lobaton, G.O.; Li, H.; Colon-Perez, L.; Goel, R.; Qi, Y.; Zubcevic, J.; Febo, M.; Richards, E.M.; et al. Sustained captopril-induced reduction in blood pressure is associated with alterations in Gut-Brain axis in the spontaneously hypertensive rat. J. Am. Heart Assoc. 2019, 8, e010721. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Zhao, X.; Jiang, Y.; Zhao, W.; Guo, T.; Cao, Y.; Teng, J.; Hao, X.; Zhao, J.; Yang, Z. Antioxidant status and gut microbiota change in an aging mouse model as influenced by exopolysaccharide produced by Lactobacillus plantarum YW11 isolated from Tibetan kefir. J. Dairy Sci. 2017, 100, 6025–6041. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Wang, X.; Zhou, M.; Kang, C.; Lang, H.; Chen, M.; Hui, S.; Wang, B.; Mi, M. Crosstalk between gut microbiota and Sirtuin-3 in colonic inflammation and tumorigenesis. Exp. Mol. Med. 2018, 50, 21. [Google Scholar] [CrossRef] [Green Version]
- Song, H.; Wang, W.; Shen, B.; Jia, H.; Hou, Z.; Chen, P.; Sun, Y. Pretreatment with probiotic Bifico ameliorates colitis-associated cancer in mice: Transcriptome and gut flora profiling. Cancer Sci. 2018, 109, 666–677. [Google Scholar] [CrossRef] [Green Version]
- Youssef, O.; Lahti, L.; Kokkola, A.; Karla, T.; Tikkanen, M.; Ehsan, H.; Carpelan-Holmström, M.; Koskensalo, S.; Böhling, T.; Rautelin, H.; et al. Stool Microbiota Composition Differs in Patients with Stomach, Colon, and Rectal Neoplasms. Dig. Dis. Sci. 2018, 63, 2950–2958. [Google Scholar] [CrossRef] [Green Version]
- Ai, L.; Ren, Y.; Li, Y.; Chen, H.; Qian, Y.; Lu, S.; Xu, A.; Ren, L.; Zhao, S.; Chen, Z.; et al. Synbindin deficiency inhibits colon carcinogenesis by attenuating Wnt cascade and balancing gut microbiome. Int. J. Cancer 2019, 145, 206–220. [Google Scholar] [CrossRef]
Gene | Sequence (5’→3’) | Reference |
---|---|---|
PCNA | F: TAAAGAAGAGGAGGCGGTAA R: TAAGTGTCCCATGTCAGCAA | [28] |
Caspase-3 | F: AGCAGCTTTGTGTGTGTGATTCTAA R: AGTTTCGGCTTTCCAGTCAGAC | [29] |
c-myc | F: TCCTGTACCTCGTCCGATTC R: GGAGGACAGCAGCGAGTC | [30] |
p53 | F: GTATTTCACCCTCAAGATCC R: TGGGCATCCTTTAACTCTA | [31] |
GAPDH | F: CTGCTTCACCACCTTCTTGA R: AAGGTCATCCCAGAGCTAAA | [32] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
da Silva Duarte, V.; dos Santos Cruz, B.C.; Tarrah, A.; Sousa Dias, R.; de Paula Dias Moreira, L.; Lemos Junior, W.J.F.; Fidélis Silva, L.C.; Rocha Santana, G.; Licursi de Oliveira, L.; Gouveia Peluzio, M.d.C.; et al. Chemoprevention of DMH-Induced Early Colon Carcinogenesis in Male BALB/c Mice by Administration of Lactobacillus Paracasei DTA81. Microorganisms 2020, 8, 1994. https://doi.org/10.3390/microorganisms8121994
da Silva Duarte V, dos Santos Cruz BC, Tarrah A, Sousa Dias R, de Paula Dias Moreira L, Lemos Junior WJF, Fidélis Silva LC, Rocha Santana G, Licursi de Oliveira L, Gouveia Peluzio MdC, et al. Chemoprevention of DMH-Induced Early Colon Carcinogenesis in Male BALB/c Mice by Administration of Lactobacillus Paracasei DTA81. Microorganisms. 2020; 8(12):1994. https://doi.org/10.3390/microorganisms8121994
Chicago/Turabian Styleda Silva Duarte, Vinícius, Bruna Cristina dos Santos Cruz, Armin Tarrah, Roberto Sousa Dias, Luiza de Paula Dias Moreira, Wilson José Fernandes Lemos Junior, Lívia Carneiro Fidélis Silva, Gabriele Rocha Santana, Leandro Licursi de Oliveira, Maria do Carmo Gouveia Peluzio, and et al. 2020. "Chemoprevention of DMH-Induced Early Colon Carcinogenesis in Male BALB/c Mice by Administration of Lactobacillus Paracasei DTA81" Microorganisms 8, no. 12: 1994. https://doi.org/10.3390/microorganisms8121994