Effect of Selenium Sources on Laying Performance, Egg Quality Characteristics, Intestinal Morphology, Microbial Population and Digesta Volatile Fatty Acids in Laying Hens
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Preparation of Organic Selenium from Bacteria (Stenotrophomonas maltophilia)
2.2. Animal Ethics
2.3. Experimental Animals, Design, and Treatments
2.4. Slaughtering and Sampling
2.5. Measurements
2.5.1. Growth and Laying Performance
2.5.2. Eggs Quality Traits
Eggs Physical Characteristics
Eggs Internal Characteristics
2.6. Selenium Content Determination
2.7. Histomorphology of the Small Intestine
2.8. Analysis of Caecum Microbiome (Bacteria) Using Real-Time PCR
2.9. Volatile Fatty Acid Determination from Hen’s Cecal Digesta
2.10. Statistical Analysis
3. Results
3.1. Laying Performance
3.2. Egg Quality Characteristics
3.3. Selenium Concentration in Egg Yolk and Tissue
3.4. Small Intestine Histomorphology
3.5. Microbial Population
3.6. Volatile Fatty Acids
4. Discussion
4.1. Laying Performance
4.2. Egg Quality Characteristics
4.3. Selenium Concentration in Egg Yolk and Tissue
4.4. Small Intestine Histomorphology
4.5. Caecum Microbial Population
4.6. Digesta Volatile Fatty Acids
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Khan, A.Z.; Kumbhar, S.; Liu, Y.; Hamid, M.; Pan, C.; Nido, S.A.; Parveen, F.; Huang, K. Dietary supplementation of selenium-enriched probiotics enhances meat quality of broiler chickens (Gallus gallus domesticus) raised under high ambient temperature. Biol. Trace Elem. Res. 2018, 182, 328–338. [Google Scholar] [CrossRef] [PubMed]
- Mechora, Š.; Žerdoner Čalasan, A.; Felicijan, M.; Urbanek Krajnc, A.; Ambrožič-Dolinšek, J. The impact of selenium treatment on some physiological and antioxidant properties of Apium repens. Aquat. Bot. 2017, 138, 16–23. [Google Scholar] [CrossRef]
- Elnaggar, A.; Ghazalah, A.; Elsayed, A.H.; Abdelalem, A. Impact of selenium sources on productive and physiological performance of broilers. Egypt. Poult. Sci. J. 2020, 40, 577–597. [Google Scholar] [CrossRef]
- Lv, L.; Li, L.; Zhang, R.; Deng, Z.; Jin, T.; Du, G. Effects of dietary supplementation of selenium enriched yeast on egg selenium content and egg production of north China hens. Pak. J. Zool. 2019, 51, 49–55. [Google Scholar] [CrossRef]
- Liu, L.; He, Y.; Xiao, Z.; Tao, W.; Zhu, J.; Wang, B.; Liu, Z.; Wang, M. Effects of selenium nanoparticles on reproductive performance of male sprague-dawley rats at supranutritional and nonlethal levels. Biol. Trace Elem. Res. 2017, 1–9. [Google Scholar] [CrossRef]
- Safdari-Rostamabad, M.; Hosseini-Vashan, S.J.; Perai, A.; Sarir, H. Nanoselenium supplementation of heat-stressed broilers: Effects on performance, carcass characteristics, blood metabolites, immune response, antioxidant status, and jejunal morphology. Biol. Trace Elem. Res. 2016. [Google Scholar] [CrossRef]
- Ventura, M.; Melo, M.; Carrilho, F. Selenium and thyroid disease: From pathophysiology to treatment. Int. J. Endocrinol. 2017, 2017, 1–9. [Google Scholar] [CrossRef] [Green Version]
- Yang, J.; Li, Y.; Zhang, L.; Fan, M.; Wei, X. Response surface design for accumulation of selenium by different lactic acid bacteria. 3 Biotech 2017, 7, 1–14. [Google Scholar] [CrossRef]
- Coppinger, R.J.; Diamond, A.M. Selenium deficiency and human disease. In Selenium; Springer: Boston, MA, USA, 2001; pp. 219–233. [Google Scholar]
- Lin, N.F.; Tang, J.; Bian, J.M. Geochemical environment and health problems in China. Environ. Geochem. Health 2004, 26, 81–88. [Google Scholar] [CrossRef] [PubMed]
- Li, S.; Xiao, T.; Zheng, B. Medical geology of arsenic, selenium and thallium in China. Sci. Total Environ. 2012, 421–422, 31–40. [Google Scholar] [CrossRef]
- Brigelius-Flohé, R. Selenium in human health and disease: An overview. Mol. Integr. Toxicol. 2018, 3–26. [Google Scholar] [CrossRef]
- Hefnawy, A.E.G.; Tórtora-Pérez, J.L. The importance of selenium and the effects of its deficiency in animal health. Small Rumin. Res. 2010, 89, 185–192. [Google Scholar] [CrossRef]
- Zhang, K.; Zhao, Q.; Zhan, T.; Han, Y.; Tang, C.; Zhang, J. Effect of different selenium sources on growth performance, tissue selenium content, meat quality, and selenoprotein gene expression in finishing pigs. Biol. Trace Elem. Res. 2020, 196, 463–471. [Google Scholar] [CrossRef]
- Wan, N.; Xu, Z.; Liu, T.; Min, Y.; Li, S. Ameliorative effects of selenium on cadmium-induced injury in the chicken ovary: Mechanisms of oxidative stress and endoplasmic reticulum stress in cadmium-induced apoptosis. Biol. Trace Elem. Res. 2018, 184, 463–473. [Google Scholar] [CrossRef] [PubMed]
- Kieliszek, M.; Blazejak, S. Selenium: Significance, and outlook for supplementation. Nutrition 2013, 29, 713–718. [Google Scholar] [CrossRef]
- Jin, W.; Yoon, C.; Johnston, T.V.; Ku, S.; Ji, G.E. Production of selenomethionine-enriched Bifidobacterium bifidum BGN4 via sodium selenite biocatalysis. Molecules 2018, 23, 2860. [Google Scholar] [CrossRef] [Green Version]
- Liu, H.; Yu, Q.; Tang, X.; Fang, C.; Sijia, C.; Fang, R. Effect of selenium on performance, egg quality, egg selenium content and serum antioxidant capacity in laying hens. Pak. J. Zool 2020, 52, 635–640. [Google Scholar] [CrossRef]
- Kieliszek, M.; Blazejak, S. Current Knowledge on the Importance of selenium in food for living organisms: A review. Molecules 2016, 21, 609. [Google Scholar] [CrossRef] [Green Version]
- Rajashree, K.; Muthukumar, T.; Karthikeyan, N. Comparative study of the effects of organic selenium on hen performance and productivity of broiler breeders. Br. Poult. Sci. 2014, 55, 367–374. [Google Scholar] [CrossRef]
- Tinggi, U. Essentiality and toxicity of selenium and its status in Australia: A review. Toxicol. Lett. 2003, 137, 103–110. [Google Scholar] [CrossRef]
- Pappas, A.C.; Acamovic, T.; Sparks, N.H.C.; Surai, P.F.; McDevitt, R.M. Effects of supplementing broiler breeder diets with organic selenium and polyunsaturated fatty acids on egg quality during storage. Poult. Sci. 2005, 84, 865–874. [Google Scholar] [CrossRef] [PubMed]
- Asadi, F.; Shariatmadari, F.; Karimi-Torshizi, M.A.; Mohiti-Asli, M.; Ghanaatparast-Rashti, M. Comparison of different selenium sources and vitamin E in laying hen diet and their influences on egg selenium and cholesterol content, quality and oxidative stability. Iran. J. Appl. Anim. Sci. 2017, 7, 83–89. [Google Scholar]
- Yaroshenko, F.; Dvorska, J. Selenium-enriched eggs as a source of selenium for human consumption. Appl. Biotechnol. Food 2003, 1, 13–23. [Google Scholar]
- Singh, V.P.; Pathak, V.; Verma Akhilesh, K. Modified or enriched eggs: A smart approach in egg industry: A review. Am. J. Food Technol. 2012, 7, 266–277. [Google Scholar] [CrossRef] [Green Version]
- Bořilová, M.F.; Bořilová, G. Selenium-enriched eggs as a functional food: A review. MASO Int. 2016, 1, 67–72. [Google Scholar]
- Fisinin, V.I.; Papazyan, T.T.; Surai, P.F. Producing selenium-enriched eggs and meat to improve the selenium status of the general population. Crit. Rev. Biotechnol. 2009, 29, 18–28. [Google Scholar] [CrossRef] [PubMed]
- Fisinin, V.I.; Papazyan, T.T.; Surai, P.F. Producing specialist poultry products to meet human nutrition requirements: Selenium enriched eggs. World’s Poult. Sci. J. 2008, 64, 85–97. [Google Scholar] [CrossRef]
- Słupczyńska, M.; Jamroz, D.; Orda, J.; Wiliczkiewicz, A.; Król, B. Long-term supplementation of laying hen diets with various selenium sources as a method for the fortification of eggs with selenium. J. Chem. 2018, 2018. [Google Scholar] [CrossRef]
- Suchý, P.; Straková, E.; Herzig, I. Selenium in poultry nutrition: A review. Czech J. Anim. Sci. 2014, 59, 495–503. [Google Scholar] [CrossRef] [Green Version]
- Dubey, S.; Kabra, M.; Bajpai, A.; Pandey, R.M.; Hasan, M.; Gautam, R.K.; Menon, P.S.N. Effect of dietary medium-chain α-monoglycerides on the growth performance, intestinal histomorphology, amino acid digestibility, and broiler chickens’ blood biochemical parameters. Animals 2021, 11, 57. [Google Scholar]
- Ariyadi, B.; Sudaryati, S.; Harimurti, S.; Wihandoyo; Sasongko, H.; Habibi, M.F.; Rahayu, D. Effects of feed form on small intestine histomorphology of broilers. IOP Conf. Ser. Earth Environ. Sci. 2019, 387, 1–4. [Google Scholar] [CrossRef] [Green Version]
- Swatson, H.K.; Gous, R.; Iji, P.A.; Zarrinkalam, R. Effect of dietary protein level, amino acid balance, and feeding level on growth, gastrointestinal tract, and mucosal structure of the small intestine in broiler chickens. Anim. Res. 2002, 51, 501–515. [Google Scholar] [CrossRef]
- Jiang, S.; Mohammed, A.A.; Jacobs, J.A.; Cramer, T.A.; Cheng, H.W. Effect of synbiotics on thyroid hormones, intestinal histomorphology, and heat shock protein 70 expression in broiler chickens reared under cyclic heat stress. Poult. Sci. 2020, 99, 142–150. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.X.; Peng, K.M. Developmental morphology of the small intestine of African ostrich chicks. Poult. Sci. 2008, 87, 2629–2635. [Google Scholar] [CrossRef]
- Laudadio, V.; Passantino, L.; Perillo, A.; Lopresti, G.; Passantino, A.; Khan, R.U.; Tufarelli, V. Productive performance and histological features of intestinal mucosa of broiler chickens fed different dietary protein levels. Poult. Sci. 2012, 91, 265–270. [Google Scholar] [CrossRef]
- Yamauchi, K.E. Review on chicken intestinal villus histological alteration; related with intestinal function. J. Poult. Sci. 2002, 39, 229–242. [Google Scholar] [CrossRef] [Green Version]
- Awad, W.A.; Ghareeb, K.; Abdel-Raheem, S.; Böhm, J. Effects of dietary inclusion of probiotic and synbiotic on growth performance, organ weights, and intestinal histomorphology of broiler chickens. Poult. Sci. 2009, 88, 49–55. [Google Scholar] [CrossRef] [PubMed]
- Chichlowski, M.; Croom, W.J.; Edens, F.W.; McBride, B.W.; Qiu, R.; Chiang, C.C.; Daniel, L.R.; Havenstein, G.B.; Koci, M.D. Microarchitecture and spatial relationship between bacteria and ileal, cecal, and colonic epithelium in chicks fed a direct-fed microbial, PrimaLac, and salinomycin. Poult. Sci. 2007, 86, 1121–1132. [Google Scholar] [CrossRef]
- Awad, W.A.; Böhm, J.; Razzazi-Fazeli, E.; Ghareeb, K.; Zentek, J. Effect of addition of a probiotic microorganism to broiler diets contaminated with deoxynivalenol on performance and histological alterations of intestinal villi of broiler chickens. Poult. Sci. 2006, 85, 974–979. [Google Scholar] [CrossRef]
- Samanya, M.; Yamauchi, K. Histological alterations of intestinal villi in chickens fed dried Bacillus subtilis var. natto. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2002, 133, 95–104. [Google Scholar] [CrossRef]
- Samli, H.E.; Senkoylu, N.; Koc, F.; Kanter, M.; Agma, A. Effects of Enterococcus faecium and dried whey on broiler performance, gut histomorphology and intestinal microbiota. Arch. Anim. Nutr. 2007, 61, 42–49. [Google Scholar] [CrossRef] [PubMed]
- Possemiers, S.; Grootaert, C.; Vermeiren, J.; Gross, G.; Marzorati, M.; Verstraete, W.; de Wiele, T. The Intestinal environment in health and disease – Recent insights on the potential of intestinal bacteria to influence human health. Curr. Pharm. Des. 2009, 15, 2051–2065. [Google Scholar] [CrossRef] [PubMed]
- Salminen, S.; Bouley, C.; Boutron, M.-C.; Cummings, J.H.; Franck, A.; Gibson, G.R.; Isolauri, E.; Moreau, M.-C.; Roberfroid, M.; Rowland, I. Functional food science and gastrointestinal physiology and function. Br. J. Nutr. 1998, 80, S147–S171. [Google Scholar] [CrossRef] [Green Version]
- Dethlefsen, L.; Eckburg, P.B.; Bik, E.M.; Relman, D.A. Assembly of the human intestinal microbiota. Trends Ecol. Evol. 2006, 21, 517–523. [Google Scholar] [CrossRef]
- Flint, H.J.; Duncan, S.H.; Scott, K.P.; Louis, P. Interactions and competition within the microbial community of the human colon: Links between diet and health: Minireview. Environ. Microbiol. 2007, 9, 1101–1111. [Google Scholar] [CrossRef]
- Kasaikina, M.V.; Kravtsova, M.A.; Lee, B.C.; Seravalli, J.; Peterson, D.A.; Walter, J.; Legge, R.; Benson, A.K.; Hatfield, D.L.; Gladyshev, V.N. Dietary selenium affects host selenoproteome expression by influencing the gut microbiota. FASEB J. 2011, 25, 2492–2499. [Google Scholar] [CrossRef] [Green Version]
- Baesman, S.M.; Bullen, T.D.; Dewald, J.; Zhang, D.; Curran, S.; Islam, F.S.; Beveridge, T.J.; Oremland, R.S. Formation of tellurium nanocrystals during anaerobic growth of bacteria that use Te oxyanions as respiratory electron acceptors. Appl. Environ. Microbiol. 2007, 73, 2135–2143. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Stolz, J.F.; Basu, P.; Santini, J.M.; Oremland, R.S. Arsenic and selenium in microbial metabolism. Annu. Rev. Microbiol. 2006, 60, 107–130. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Janczyk, P.; Hall, B.; Souffrant, W.B. Microbial community composition of the crop and ceca contents of laying hens fed diets supplemented with Chlorella vulgaris. Poult. Sci. 2009, 88, 2324–2332. [Google Scholar] [CrossRef]
- Guo, F.C.; Williams, B.A.; Kwakkel, R.P.; Li, H.S.; Li, X.P.; Luo, J.Y.; Li, W.K.; Verstegen, M.W.A. Effects of mushroom and herb polysaccharides, as alternatives for an antibiotic, on the cecal microbial ecosystem in broiler chickens. Poult. Sci. 2004, 83, 175–182. [Google Scholar] [CrossRef] [PubMed]
- Khan, S.H.; Ansari, J.; Haq, A.U.; Abbas, G. Black cumin seeds as phytogenic product in broiler diets and its effects on performance, blood constituents, immunity and caecal microbial population. Ital. J. Anim. Sci. 2012, 11, 438–444. [Google Scholar] [CrossRef]
- Martínez, F.G.; Moreno-Martin, G.; Pescuma, M.; Madrid-Albarrán, Y.; Mozzi, F. Biotransformation of selenium by lactic acid bacteria: Formation of seleno-nanoparticles and seleno-amino Acids. Front. Bioeng. Biotechnol. 2020, 8, 1–17. [Google Scholar] [CrossRef]
- Sumner, S.E.; Markley, R.L.; Kirimanjeswara, G.S. Role of selenoproteins in bacterial pathogenesis. Biol. Trace Elem. Res. 2019, 192, 69–82. [Google Scholar] [CrossRef] [PubMed]
- Dalia, A.M.; Loh, T.C.; Sazili, A.Q.; Jahromi, M.F.; Samsudin, A.A. Characterization and identification of organic selenium-enriched bacteria isolated from rumen fluid and hot spring water. Microbiol. Biotechnol. Lett. 2017, 45, 343–353. [Google Scholar] [CrossRef] [Green Version]
- Dalia, A.M.; Loh, T.C.; Sazili, A.Q.; Jahromi, M.F.; Samsudin, A.A. The effect of dietary bacterial organic selenium on growth performance, antioxidant capacity, and Selenoproteins gene expression in broiler chickens. BMC Vet. Res. 2017, 13, 254. [Google Scholar] [CrossRef]
- Malaysia, S. Halal Food-Production, Preparation, Handling and Storage-General Guidelines, 2nd ed.; Department of Standards: Selangor Darul Ehsan, Malaysia, 2009.
- Invernizzi, G.; Agazzi, A.; Ferroni, M.; Rebucci, R.; Fanelli, A.; Baldi, A.; Dell’Orto, V.; Savoini, G. Effects of inclusion of selenium-enriched yeast in the diet of laying hens on performance, eggshell quality, and selenium tissue deposition. Ital. J. Anim. Sci. 2013, 12, 1–8. [Google Scholar] [CrossRef] [Green Version]
- Markos, S.; Belay, B.; Astatkie, T. Evaluation of egg quality traits of three indigenous chicken ecotypes kept under farmers’ management conditions. Int. J. Poult. Sci. 2017, 16, 180–188. [Google Scholar] [CrossRef] [Green Version]
- Rath, P.K.; Mishra, P.K.; Mallick, B.K.; Behura, N.C. Evaluation of different egg quality traits and interpretation of their mode of inheritance in White Leghorns. Vet. World 2015, 8, 449–452. [Google Scholar] [CrossRef] [Green Version]
- Lipiec, E.; Siara, G.; Bierla, K.; Ouerdane, L.; Szpunar, J. Determination of selenomethionine, selenocysteine, and inorganic selenium in eggs by HPLC-inductively coupled plasma mass spectrometry. Anal. Bioanal. Chem. 2010, 397, 731–741. [Google Scholar] [CrossRef]
- Tufarelli, V.; Ceci, E.; Laudadio, V. 2-Hydroxy-4-methylselenobutanoic acid as new organic selenium dietary supplement to produce selenium-enriched eggs. Biol. Trace Elem. Res. 2016, 171, 453–458. [Google Scholar] [CrossRef] [PubMed]
- Choe, D.W.; Loh, T.C.; Foo, H.L.; Hair-Bejo, M.; Awis, Q.S. Egg production, faecal pH and microbial population, small intestine morphology, and plasma and yolk cholesterol in laying hens given liquid metabolites produced by Lactobacillus plantarum strains. Br. Poult. Sci. 2012, 53, 106–115. [Google Scholar] [CrossRef] [PubMed]
- Touchette, K.J.; Carroll, J.A.; Allee, G.L.; Matteri, R.L.; Dyer, C.J.; Beausang, L.A.; Zannelli, M.E. Effect of spray-dried plasma and lipopolysaccharide exposure on weaned pigs: I. Effects on the immune axis of weaned pigs. J. Anim. Sci. 2002, 80, 494–501. [Google Scholar] [CrossRef]
- Fan, Y.K.; Croom, J.; Christensen, V.L.; Black, B.L.; Bird, A.R.; Daniel, L.R.; Mcbride, B.W.; Eisen, E.J. Jejunal glucose uptake and oxygen consumption in turkey poults selected for rapid growth. Poult. Sci. 1997, 76, 1738–1745. [Google Scholar] [CrossRef]
- Navidshad, B.; Liang, J.B.; Jahromi, M.F. Correlation coefficients between different methods of expressing bacterial quantification using real time PCR. Int. J. Mol. Sci. 2012, 13, 2119–2132. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jahromi, M.F.; Altaher, Y.W.; Shokryazdan, P.; Ebrahimi, R.; Ebrahimi, M.; Idrus, Z.; Tufarelli, V.; Liang, J.B. Dietary supplementation of a mixture of Lactobacillus strains enhances performance of broiler chickens raised under heat stress conditions. Int. J. Biometeorol. 2015, 60, 1099–1110. [Google Scholar] [CrossRef]
- Dalia, A.M.; Loh, T.C.; Sazili, A.Q.; Jahromi, M.F.; Samsudin, A.A. Effects of vitamin E, inorganic selenium, bacterial organic selenium, and their combinations on immunity response in broiler chickens. BMC Vet. Res. 2018, 14, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Bartosch, S.; Fite, A.; Macfarlane, G.T.; Mcmurdo, M.E.T. Characterization of bacterial communities in feces from healthy elderly volunteers and hospitalized elderly patients by using real-time PCR and effects of antibiotic treatment on the fecal microbiota. Appl. Environ. Microbiol. 2004, 70, 3575–3581. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- El-shenawy, N.S.; Al-harbi, M.S.; Hamza, R.Z. Effect of vitamin E and selenium separately and in combination on biochemical, immunological and histological changes induced by sodium azide in male mice. Exp. Toxicol. Pathol. 2014, 67, 65–76. [Google Scholar] [CrossRef]
- Nam, H.; Srinivasan, V.; Gillespie, B.E.; Murinda, S.E.; Oliver, S.P. Application of SYBR green real-time PCR assay for specific detection of Salmonella spp. in dairy farm environmental samples. Int. J. Food Microbiol. 2005, 102, 161–171. [Google Scholar] [CrossRef] [PubMed]
- Kareem, K.Y.; Loh, T.C.; Foo, H.L.; Asmara, S.A.; Akit, H.; Abdulla, N.R.; Foong, M.; Tcl, O. Carcass, meat and bone quality of broiler chickens fed with postbiotic and prebiotic combinations. Int. J. Probiotics Prebiotics 2015, 10, 23–30. [Google Scholar]
- Kim, D.H.; Han, S.M.; Keum, M.C.; Lee, S.; An, B.K.; Lee, S.; Lee, K.; Han, S.M.; Keum, M.C.; Lee, S.; et al. Evaluation of bee venom as a novel feed additive in fast-growing broilers. Br. Poult. Sci. 2018, 59, 435–442. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Yu, Q.; Fang, C.; Chen, S.; Tang, X.; Ajuwon, K.M.; Fang, R. Effect of selenium source and level on performance, egg quality, egg selenium content, and serum biochemical parameters in laying hens. Foods 2020, 9, 68. [Google Scholar] [CrossRef] [Green Version]
- Meng, T.; Liu, Y.L.; Xie, C.Y.; Zhang, B.; Huang, Y.Q.; Zhang, Y.W.; Yao, Y.; Huang, R.; Wu, X. Effects of different selenium sources on laying performance, egg selenium concentration, and antioxidant capacity in laying hens. Biol. Trace Elem. Res. 2019, 189, 548–555. [Google Scholar] [CrossRef]
- Han, X.J.; Qin, P.; Li, W.X.; Ma, Q.G.; Ji, C.; Zhang, J.Y.; Zhao, L.H. Effect of sodium selenite and selenium yeast on performance, egg quality, antioxidant capacity, and selenium deposition of laying hens. Poult. Sci. 2017, 96, 3973–3980. [Google Scholar] [CrossRef] [PubMed]
- Jiakui, L.; Xiaolong, W. Effect of dietary organic versus inorganic selenium in laying hens on the productivity, selenium distribution in egg and selenium content in blood, liver and kidney. J. Trace Elem. Med. Biol. 2004, 18, 65–68. [Google Scholar] [CrossRef] [PubMed]
- Payne, R.L.; Lavergne, T.K.; Southern, L.L. Effect of inorganic versus organic selenium on hen production and egg selenium concentration. Poult. Sci. 2005, 84, 232–237. [Google Scholar] [CrossRef]
- Utterback, P.L.; Parsons, C.M.; Yoon, I.; Butler, J. Effect of supplementing selenium yeast in diets of laying hens on egg selenium content. Poult. Sci. 2005, 84, 1900–1901. [Google Scholar] [CrossRef]
- Skřivan, M.; Šimáně, J.; Dlouhá, G.; Doucha, J. Effect of dietary sodium selenite, Se-enriched yeast and Se-enriched Chlorella on egg Se concentration, physical parameters of eggs and laying hen production. Czech J. Anim. Sci. 2006, 51, 163–167. [Google Scholar] [CrossRef] [Green Version]
- Pavlović, Z.; Miletić, I.; Jokić, Ž.; Šobajić, S. The effect of dietary selenium source and level on hen production and egg selenium concentration. Biol. Trace Elem. Res. 2009, 131, 263–270. [Google Scholar] [CrossRef]
- Chantiratikul, A.; Chinrasri, O.; Chantiratikul, P. Effect of sodium selenite and zinc- l-selenomethionine on performance and selenium concentrations in eggs of laying hens. Asian-Australas. J. Anim. Sci. 2008, 21, 1048–1052. [Google Scholar] [CrossRef]
- Gjorgovska, N.; Kiril, F.; Vesna, L.; Tosho, K. The effect of different levels of selenium in feed on egg production, egg quality and selenium content in yolk. Lucr. Ştiinţifice 2012, 57, 270–274. [Google Scholar]
- Zia, W.M.; Khalique, A.; Naveed, S.; Hussain, J. Egg quality, geometry and hatching traits of indigenous Aseel as influenced by organic and inorganic selenium supplementation. Indian J. Anim. Res. 2017, 51, 860–867. [Google Scholar] [CrossRef] [Green Version]
- Arpášová, H.; Mellen, M.; Kačániová, M.; Haščík, P.; Petrovič, V.; Čobanová, K.; Leng, L. Effects of dietary supplementation of sodium selenite and selenized yeast on selected qualitative parameters of laying hens eggs. Slovak J. Anim. Sci. 2009, 42, 27–33. [Google Scholar]
- Zia, M.W.; Khalique, A.; Naveed, S.; Hussain, J. Impact of selenium supplementation on productive performance and egg selenium status in native aseel chicken. Ital. J. Anim. Sci. 2016, 15, 649–657. [Google Scholar] [CrossRef] [Green Version]
- Pan, C.; Zhao, Y.; Liao, S.F.; Chen, F.; Qin, S.; Wu, X.; Zhou, H.; Huang, K. Effect of selenium-enriched probiotics on laying performance, egg quality, egg selenium content, and egg glutathione peroxidase activity. J. Agric. Food Chem. 2011, 59, 11424–11431. [Google Scholar] [CrossRef]
- Hawkes, W.C.; Wilhelmsen, E.C.; Tappel, A.L. Abundance and tissue distribution of selenocysteine-containing proteins in the rat. J. Inorg. Biochem. 1985, 23, 77–92. [Google Scholar] [CrossRef]
- Cummins, L.M.; Martin, J.L. Are selenocystine and selenomethionine synthesized in vivo from sodium selenite in mammals? Biochemistry 1967, 6, 3162–3168. [Google Scholar] [CrossRef] [PubMed]
- Olson, O.E.; Palmer, I.S. Selenoamino acids in tissues of rats administered inorganic selenium. Metabolism 1976, 25, 299–306. [Google Scholar] [CrossRef]
- Sunde, R. Molecular biology of selenoproteins. Annu. Rev. Nutr. 1990, 10, 451–474. [Google Scholar] [CrossRef] [PubMed]
- Edens, F.W.; Sefton, A.E. Organic selenium in animal nutrition—Utilisation, metabolism, storage and comparison with other selenium sources. J. Appl. Anim. Nutr. 2016, 4, 1–15. [Google Scholar] [CrossRef]
- Gammelgaard, B.; Rasmussen, L.H.; Gabel-Jensen, C.; Steffansen, B. Estimating intestinal absorption of inorganic and organic selenium compounds by in vitro flux and biotransformation studies in Caco-2 cells and ICP-MS detection. Biol. Trace Elem. Res. 2012, 145, 248–256. [Google Scholar] [CrossRef] [PubMed]
- Pavlović, Z.; Miletić, I.; Jokić, Ž.; Pavlovski, Z.; Škrbić, Z.; Šobajić, S. The effect of level and source of dietary selenium supplementation on eggshell quality. Biol. Trace Elem. Res. 2010, 133, 197–202. [Google Scholar] [CrossRef]
- Golubkina, N.A.; Papazyan, T.T. Selenium distribution in eggs of avian species. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2006, 145, 384–388. [Google Scholar] [CrossRef]
- Baylan, M.; Canogullari, S.; Ayasan, T.; Copur, G. Effects of dietary selenium source, storage time, and temperature on the quality of quail eggs. Biol. Trace Elem. Res. 2011, 143, 957–964. [Google Scholar] [CrossRef]
- Ketta, M.; Tůamová, E. Eggshell structure, measurements, and quality-affecting factors in laying hens: A review. Czech J. Anim. Sci. 2016, 61, 299–309. [Google Scholar] [CrossRef]
- Zita, L.; Tůmová, E.; Štolc, L. Effects of genotype, age and their interaction on egg quality in brown-egg laying hens. Acta Vet. Brno 2009, 78, 85–91. [Google Scholar] [CrossRef]
- Pavlík, A.; Lichovníková, M.; Jelínek, P. Minerální profil krevní plazmy a kvalitativní indikátory skořápky u nosnic v různých technologických systémech ustájení. Acta Vet. Brno 2009, 78, 419–429. [Google Scholar] [CrossRef] [Green Version]
- Tůmová, E.; Gous, R.M.; Tyler, N. Effect of hen age, environmental temperature, and oviposition time on egg shell quality and egg shell and serum mineral contents in laying and broiler breeder hens. Czech J. Anim. Sci. 2014, 59, 435–443. [Google Scholar] [CrossRef] [Green Version]
- Mabe, I.; Rapp, C.; Bain, M.M.; Nys, Y. Supplementation of a corn-soybean meal diet with manganese, copper, and zinc from organic or inorganic sources improves eggshell quality in aged laying hens. Poult. Sci. 2003, 82, 1903–1913. [Google Scholar] [CrossRef]
- Arpášová, H.; Petrovič, V.; Mellen, M.; Kačániová, M.; Čobanová, K.; Leng, L. The effects of supplementing sodium selenite and selenized yeast to the diet for laying hens on the quality and mineral content of eggs. J. Anim. Feed Sci. 2009, 18, 90–100. [Google Scholar] [CrossRef]
- Maysa, M.H.; El-Sheikh, A.M.H.; Abdalla, E.A. The effect of organic selenium supplementation on productive and physiological performance in a local strain of chicken. 1–The effect of organic selenium (Sel-PlexTM) on productive, reproductive and physiological traits of Bandarah local strain. Egypt. Poult. Sci. J. 2009, 29, 1061–1084. [Google Scholar]
- Patton, N.D. Organic Selenium in the Nutrition of Laying Hens: Effects on Egg Selenium Content, Egg Quality and Transfer to Developing Chick Embryo. Ph.D. Thesis, University of Kentucky, Kentuky, TX, USA, 2000. [Google Scholar]
- Delezie, E.; Rovers, M.; Van Der Aa, A.; Ruttens, A.; Wittocx, S.; Segers, L. Comparing responses to different selenium sources and dosages in laying hens. Poult. Sci. 2014, 93, 3083–3090. [Google Scholar] [CrossRef] [PubMed]
- Pan, C.; Huang, K.; Zhao, Y.; Qin, S.; Chen, F.; Hu, Q. Effect of selenium source and level in hen’s diet on tissue selenium deposition and egg selenium concentrations. J. Agric. Food Chem. 2007, 55, 1027–1032. [Google Scholar] [CrossRef]
- Lu, J.; Qu, L.; Ma, M.; Li, Y.F.; Wang, X.G.; Yang, Z.; Wang, K.H. Efficacy evaluation of selenium-enriched yeast in laying hens: Effects on performance, egg quality, organ development, and selenium deposition. Poult. Sci. 2020, 99, 6267–6277. [Google Scholar] [CrossRef]
- Zhang, X.; Tian, L.; Zhai, S.; Lin, Z.; Yang, H.; Chen, J.; Ye, H.; Wang, W.; Yang, L.; Zhu, Y. Effects of selenium-enriched yeast on performance, egg quality, antioxidant balance, and egg selenium content in laying ducks. Front. Vet. Sci. 2020, 7, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Moslehi, H.; Navidshad, B.; Sharifi, S.D.; Aghjegheshlagh, F.M. Effects of selenium and flaxseed on selenium content and antioxidant properties of eggs and immune response in hens. S. Afr. J. Anim. Sci. 2019, 49, 770–780. [Google Scholar] [CrossRef]
- Çelebi, Ş. Effect of dietary vitamin e, selenium and their combination on concentration of selenium, mda, and antioxidant enzyme activities in some tissues of laying hens. Pak. J. Zool. 2019, 51, 1155–1161. [Google Scholar] [CrossRef]
- Lu, J.; Qu, L.; Shen, M.M.; Wang, X.G.; Guo, J.; Hu, Y.P.; Dou, T.C.; Wang, K.H. Effects of high-dose selenium-enriched yeast on laying performance, egg quality, clinical blood parameters, organ development, and selenium deposition in laying hens. Poult. Sci. 2019, 98, 2522–2530. [Google Scholar] [CrossRef]
- Paiva, F.A.; Netto, A.S.; Corrêa, L.B.; Silva, T.H.; Guimarães, I.C.S.B.; Del Claro, G.R.; Cunha, J.A.; Zanetti, M.A. Organic selenium supplementation increases muscle selenium content in growing lambs compared to inorganic source. Small Rumin. Res. 2019, 175, 57–64. [Google Scholar] [CrossRef]
- Mohapatra, P.; Swain, R.K.; Mishra, S.K.; Behera, T.; Swain, P.; Mishra, S.S.; Behura, N.C.; Sabat, S.C.; Sethy, K.; Dhama, K.; et al. Effects of dietary nano-selenium on tissue selenium deposition, antioxidant status and immune functions in layer chicks. Int. J. Pharmacol. 2014, 10, 160–167. [Google Scholar] [CrossRef]
- Sunde, R.A.; Li, J.L.; Taylor, R.M. Insights for setting of nutrient requirements, gleaned by comparison of selenium status biomarkers in Turkeys and chickens versus rats, mice, and lambs. Adv. Nutr. 2016, 7, 1129–1138. [Google Scholar] [CrossRef] [Green Version]
- Mahan, D.C.; Parrett, N.A. Evaluating the efficacy of selenium-enriched yeast and sodium selenite on tissue selenium retention and serum glutathione peroxidase activity in grower and finisher swine. J. Anim. Sci. 1996, 2967–2974. [Google Scholar] [CrossRef]
- Uni, Z.; Noy, Y.; Sklan, D. Posthatch changes in morphology and function of the small intestines in heavy- and light-strain chicks. Poult. Sci. 1995, 74, 1622–1629. [Google Scholar] [CrossRef]
- Caspary, W.F. Physiology and pathophysiology of hearing. Am. J. Clin. Nutr. 1992, 55, 299S–308S. [Google Scholar] [CrossRef]
- Langhout, D.J.; Schutte, J.B.; Van Leeuwen, P.; Wiebenga, J.; Tamminga, S. Effect of dietary high-and low-methylated citrus pectin on the activity of the ileal microflora and morphology of the small intestinal wall of broiler chicks. Br. Poult. Sci. 1999, 40, 340–347. [Google Scholar] [CrossRef]
- Yasar, S.; Forbes, J.M. Performance and gastro-intestinal response of broiler chickens fed on cereal grain-based foods soaked in water. Br. Poult. Sci. 1999, 40, 65–76. [Google Scholar] [CrossRef]
- Xu, Z.R.; Hu, C.H.; Xia, M.S.; Zhan, X.A.; Wang, M.Q. Effects of dietary fructooligosaccharide on digestive enzyme activities, intestinal microflora and morphology of male broilers. Poult. Sci. 2003, 82, 1030–1036. [Google Scholar] [CrossRef] [PubMed]
- Negroni, A.; Cucchiara, S.; Stronati, L. Apoptosis, necrosis, and necroptosis in the gut and intestinal homeostasis. Mediat. Inflamm. 2015, 2015. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Quinteiro-Filho, W.M.; Ribeiro, A.; Ferraz-de-Paula, V.; Pinheiro, M.L.; Sakai, M.; Sá, L.R.M.; Ferreira, A.J.P.; Palermo-Neto, J. Heat stress impairs performance parameters, induces intestinal injury, and decreases macrophage activity in broiler chickens. Poult. Sci. 2010, 89, 1905–1914. [Google Scholar] [CrossRef] [PubMed]
- De Verdal, H.; Mignon-Grasteau, S.; Jeulin, C.; le Bihan-Duval, E.; Leconte, M.; Mallet, S.; Martin, C.; Narcy, A. Digestive tract measurements and histological adaptation in broiler lines divergently selected for digestive efficiency. Poult. Sci. 2010, 89, 1955–1961. [Google Scholar] [CrossRef] [PubMed]
- Dalia, A.M.; Loh, T.C.; Sazili, A.Q.; Samsudin, A.A. Influence of bacterial organic selenium on blood parameters, immune response, selenium retention and intestinal morphology of broiler chickens. BMC Vet. Res. 2020, 16, 365. [Google Scholar] [CrossRef]
- Zamani Moghaddam, A.K.; Mehraei Hamzekolaei, M.H.; Khajali, F.; Hassanpour, H. Role of selenium from different sources in prevention of pulmonary arterial hypertension syndrome in broiler chickens. Biol. Trace Elem. Res. 2017, 180, 164–170. [Google Scholar] [CrossRef]
- Ahmed, Z.; Malhi, M.; Soomro, S.A.; Gandahi, J.A.; Arijo, A.; Bhutto, B.; Qureshi, T.A. Dietary selenium yeast supplementation improved some villi morphological characteristics in duodenum and jejunum of young goats. J. Anim. Plant Sci. 2016, 26, 382–387. [Google Scholar]
- Read-Snyder, J.; Edens, F.W.; Cantor, A.H.; Pescatore, A.J.; Pierce, J.L. Effect of dietary selenium on small intestine villus integrity in reovirus-challenged broilers. Int. J. Poult. Sci. 2009, 8, 829–835. [Google Scholar]
- Zhang, A.W.; Lee, B.D.; Lee, S.K.; Lee, K.W.; An, G.H.; Song, K.B.; Lee, C.H. Effects of yeast (Saccharomyces cerevisiae) cell components on growth performance, meat quality, and ileal mucosa development of broiler chicks. Poult. Sci. 2005, 84, 1015–1021. [Google Scholar] [CrossRef] [PubMed]
- Ahmadipour, B.; Hassanpour, H.; Rafiei, F.; Khajali, F. Antioxidative, antihyperlipidemic, and growth-promoting effects of Kelussia odoratissima in meat-type chickens. Poult. Sci. J. 2015, 1, 37–46. [Google Scholar]
- Miller, M.J.S.; Angeles, F.M.; Reuter, B.K.; Bobrowski, P.; Sandoval, M. Dietary antioxidants protect gut epithelial cells from oxidant-induced apoptosis. BMC Complement. Altern. Med. 2001, 1. [Google Scholar] [CrossRef] [Green Version]
- Tong, C.; Li, P.; Yu, L.H.; Li, L.; Li, K.; Chen, Y.; Yang, S.H.; Long, M. Selenium-rich yeast attenuates ochratoxin A-induced small intestinal injury in broiler chickens by activating the Nrf2 pathway and inhibiting NF-KB activation. J. Funct. Foods 2020, 66, 103784. [Google Scholar] [CrossRef]
- Pesti, G.M.; Combs, G.F. Studies on the enteric absorption of selenium in the chick using localized coccidial infections. Poult. Sci. 1976, 55, 2265–2274. [Google Scholar] [CrossRef] [PubMed]
- Mykkahen, H.; Wasserman, A.H. Uptake of 75Se-selenite by brush border membrane vesicles from chick duodenum stimulated by vitamin D1,2. J. Nutr. 1989, 119, 242–247. [Google Scholar] [CrossRef]
- Guarner, F.; Malagelada, J.R. Gut flora in health and disease. Lancet 2003, 361, 512–519. [Google Scholar] [CrossRef]
- Lv, C.H.; Wang, T.; Regmi, N.; Chen, X.; Huang, K.; Liao, S.F. Effects of dietary supplementation of selenium-enriched probiotics on production performance and intestinal microbiota of weanling piglets raised under high ambient temperature. J. Anim. Physiol. Anim. Nutr. 2015, 99, 1161–1171. [Google Scholar] [CrossRef]
- Jensen, B. The impact of feed additives on the microbial ecology of the gut in young pigs. J. Anim. Feed Sci. 1998, 7, 45–64. [Google Scholar] [CrossRef]
- Liu, H.N.; Liu, Y.; Hu, L.L.; Suo, Y.L.; Zhang, L.; Jin, F.; Feng, X.A.; Teng, N.; Li, Y. Effects of dietary supplementation of quercetin on performance, egg quality, cecal microflora populations, and antioxidant status in laying hens. Poult. Sci. 2014, 93, 347–353. [Google Scholar] [CrossRef] [PubMed]
- Molan, A.L.; Flanagan, J.; Wei, W.; Moughan, P.J. Selenium-containing green tea has higher antioxidant and prebiotic activities than regular green tea. Food Chem. 2009, 114, 829–835. [Google Scholar] [CrossRef]
- Molan, A. Antioxidant and prebiotic activities of selenium-containing green tea. Nutrition 2013, 29, 476–477. [Google Scholar] [CrossRef]
- Araúz, I.L.C.; Afton, S.; Wrobel, K.; Caruso, J.A.; Corona, J.F.G.; Wrobel, K. Study on the protective role of selenium against cadmium toxicity in lactic acid bacteria: An advanced application of ICP-MS. J. Hazard. Mater. 2008, 153, 1157–1164. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.; Huang, K.; Qin, S.; Wu, X.; Zhao, Z.; Chen, F. Antibacterial action of selenium-enriched probiotics against pathogenic Escherichia coli. Dig. Dis. Sci. 2009, 54, 246–254. [Google Scholar] [CrossRef]
- Thibodeau, A.; Letellier, A.; Yergeau, É.; Larrivière-gauthier, G.; Fravalo, P. Lack of evidence that selenium-yeast improves chicken health and modulates the caecal microbiota in the context of colonization by Campylobacter jejuni. Front. Microbiol. 2017, 8, 1–9. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gangadoo, S.; Bauer, B.W.; Bajagai, Y.S.; Van, T.T.H.; Moore, R.J.; Stanley, D. In Vitro growth of gut microbiota with selenium nanoparticles. Anim. Nutr. 2019, 5, 424–431. [Google Scholar] [CrossRef] [PubMed]
- Zhang, B.; Zhou, K.; Zhang, J.; Chen, Q.; Liu, G.; Shang, N.; Qin, W.; Li, P.; Lin, F. Accumulation and species distribution of selenium in Se-enriched bacterial cells of the Bifidobacterium animalis 01. Food Chem. 2009, 115, 727–734. [Google Scholar] [CrossRef]
- Soomro, A.H.; Masud, T.; Anwaar, K. Role of Lactic acid bacteria (LAB) in food preservation and human health—A Review. Pak. J. Nutr. 2002, 1, 20–24. [Google Scholar] [CrossRef] [Green Version]
- Topping, D.L.; Clifton, P.M. Short-chain fatty acids and human colonic function: Roles of resistant starch and nonstarch polysaccharides. Physiol. Rev. 2001, 81, 1031–1064. [Google Scholar] [CrossRef]
- Ndazigaruye, G.; Kim, D.; Kang, C.; Kang, K.; Joo, Y.-J.; Lee, S.-R.; Kyung-Woo, L. Effects of low-protein diets and exogenous protease on growth performance, carcass traits, intestinal morphology, cecal volatile fatty acids and serum parameters in broilers. Animals 2019, 9, 226. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Peng, Q.; Zeng, X.F.; Zhu, J.L.; Wang, S.; Liu, X.T.; Hou, C.L.; Thacker, P.A.; Qiao, S.Y. Effects of dietary Lactobacillus plantarum B1 on growth performance, intestinal microbiota, and short chain fatty acid profiles in broiler chickens. Poult. Sci. 2016, 95, 893–900. [Google Scholar] [CrossRef]
- Huang, C.B.; Xiao, L.; Xing, S.C.; Chen, J.Y.; Yang, Y.W.; Zhou, Y.; Chen, W.; Liang, J.B.; Mi, J.D.; Wang, Y.; et al. The microbiota structure in the cecum of laying hens contributes to dissimilar H2S production. BMC Genom. 2019, 20, 1–13. [Google Scholar] [CrossRef]
- Xun, W.; Shi, L.; Yue, W. Effect of high-dose nano-selenium and selenium—Yeast on feed digestibility, rumen fermentation, and purine derivatives in sheep. Biol. Trace Elem. Res. 2012, 150, 130–136. [Google Scholar] [CrossRef] [PubMed]
- Shaw, F.L.; Mulholland, F.; Gall, G.L.; Porcelli, I.; Hart, D.J.; Pearson, B.M.; Vliet, A.H.M. Van Selenium-dependent biogenesis of formate dehydrogenase in Campylobacter jejuni is controlled by the fdhtu accessory genes. J. Bacteriol. 2012, 194, 3814–3823. [Google Scholar] [CrossRef] [Green Version]
- Soboh, B.; Pinske, C.; Kuhns, M.; Waclawek, M.; Ihling, C.; Trchounian, K.; Trchounian, A.; Sinz, A.; Sawers, G. The respiratory molybdo-selenoprotein formate dehydrogenases of Escherichia coli have hydrogen: Benzyl viologen oxidoreductase activity. BMC Microbiol. 2011, 11, 1–10. [Google Scholar] [CrossRef] [Green Version]
- Dong, X.; Plugge, C.M.; Stams, A.J.M. Anaerobic degradation of propionate by a mesophilic acetogenic bacterium in coculture and triculture with different methanogens CH3CH2COO-. Appl. Environ. Microbiol. 1994, 60, 2834–2838. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Banks, C.J.; Zhang, Y.; Jiang, Y.; Heaven, S. Bioresource technology trace element requirements for stable food waste digestion at elevated ammonia concentrations. Bioresour. Technol. 2012, 104, 127–135. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, D.; Lee, Y.; Lee, S.; Kim, S.; Lee, S.; Lee, H.; Lee, K.; Lee, K. Changes in production parameters, egg qualities, fecal volatile fatty acids, nutrient digestibility, and plasma parameters in laying hens exposed to ambient temperature. Front. Vet. Sci. 2020, 7, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Kareem, K.Y. Effect of different levels of postbiotic on growth performance, intestinal microbiota count and volatile fatty acids on quail. Plant Arch. 2020, 20, 2885–2887. [Google Scholar]
- Saengkerdsub, S.; Anderson, R.C.; Wilkinson, H.H.; Kim, W.; Nisbet, D.J.; Ricke, S.C. Identification and quantification of methanogenic archaea in adult chicken ceca. Appl. Environ. Microbiol. 2007, 73, 353–356. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dunkley, K.D.; Dunkley, C.S.; Njongmeta, N.L.; Callaway, T.R.; Hume, M.E.; Kubena, L.F.; Nisbet, D.J.; Ricke, S.C. Comparison of In Vitro fermentation and molecular microbial profiles of high-fiber feed substrates incubated with chicken cecal inocula. Poult. Sci. 2007, 86, 801–810. [Google Scholar] [CrossRef] [PubMed]
Ingredients | Laying |
---|---|
Corn (QL) | 44.00 |
Soybean Meal (QL) | 29.00 |
Wheat Pollard (QL) | 11.00 |
CPO (QL) | 3.50 |
l-Lysine | 0.10 |
dl-Methionine | 0.25 |
Dicalcium Phosphate (18%) | 2.00 |
Calcium Carbonate | 7.70 |
Choline Chloride | 0.10 |
Salt | 0.35 |
Mineral Mix * | 0.60 |
Vitamin Mix ** | 0.60 |
Antioxidant *** | 0.40 |
Toxin Binder **** | 0.40 |
Total | 100 |
Calculated Composition | |
Metabolizable Energy Kcal/kg | 2761.24 |
Protein (%) | 17.66 |
Fat (%) | 5.3 |
Fiber (%) | 3.98 |
Calcium (%) | 3.65 |
Total Phosphorus (%) | 0.88 |
Av. Phosphorus for Poultry (%) | 0.48 |
Item | Treatment Diets ** | |||
---|---|---|---|---|
Con | Na₂SeO₃ | Se-Yeast | ADS18 | |
Analyzed Se (mg/kg) * | 0.031 ± 0.01 | 0.312 ± 0.02 | 0.320 ± 0.01 | 0.339 ± 0.02 |
Target Microorganism | Primer Sequences | Size of Amplified Fragments (bp) | Sources |
---|---|---|---|
Total bacteria | F: CGGCAACGAGCGCAACCC | 145 | [67,68] |
R: CCATTGTAGCACGTGTGTAGCC | |||
Lactobacillus spp. | F: CATCCAGTGCAAACCTAAGAG | 341 | [67,68] |
R: GATCCGCTTGCCTTCGCA | |||
Bifidobacteria spp. | F: GGGTGGTAATGCCGGATG | 440 | [66,68,69] |
R: TAAGCCATGGACTTTCACACC | |||
Enterococcus spp. | F: CCCTTATTGTTAGTTGCCATCATT | 144 | [68,70,71] |
R: ACTCGTTGTACTTCCCATTGT | |||
Enterobacteria spp. | F: CAT TGACGTTACCCGCAGAAGAAGC | 195 | [66,67,68] |
R: CTCTACGAGACTCAAGCTTGC | |||
Escherichia coli | F: GTGTGATATCTACCCGCTTCGC | 82 | [66,67,68] |
R: AGAACGCTTTGTGGTTAATCAGGA | |||
Salmonella spp. | F: TCGTCATTCCATTACCTACC | 119 | [68,70] |
R: AAACGTTGAAAAACTGAGGA |
Parameters | Dietary Treatments 1 | p-Value | |||
---|---|---|---|---|---|
Con | Na2SeO3 | Se-Yeast | ADS18 | ||
Laying Rate (%) | 87.91 ± 0.90 c | 90.33 ± 0.64 b | 91.57 ± 0.57 a,b | 93.75 ± 1.02 a | 0.0003 |
Average Egg Weight (g) | 51.56 ± 1.12 b | 52.63 ± 0.65 a,b | 52.93 ± 0.50 a,b | 54.64 ± 0.47 a | 0.0531 |
Daily Egg Mass (g/Hen/Day) | 46.42 ± 1.64 b | 48.18 ± 0.80 a,b | 48.53 ± 0.72 a,b | 51.21 ± 0.66 a | 0.0299 |
Average Daily Feed Intake (g/Hen/Day) | 107.35 ± 0.65 | 108.57 ± 0.40 | 108.37 ± 0.37 | 108.54 ± 0.32 | 0.2133 |
Feed Conversion Ratio (g of Feed/g of Egg) | 2.39 ± 0.09 a | 2.28 ± 0.04 a,b | 2.25 ± 0.04 a,b | 2.13 ± 0.03 b | 0.036 |
LBW | 1727.78 ± 10.65 b | 1732.32 ± 6.65 b | 1753.35 ± 7.25 a | 1750.96 ± 8.01 a | 0.0945 |
Shell-Less and Broken Egg Rate (%) | 1.56 ± 0.60 | 2.45 ± 0.44 | 1.76 ± 1.12 | 1.11 ± 0.39 | 0.5976 |
Parameters | Dietary Treatments 1 | p-Value | |||
---|---|---|---|---|---|
Con | Na2SeO3 | Se-Yeast | ADS18 | ||
Egg Weight (g) | 41.85 ± 0.19 | 41.87 ± 0.11 | 41.61 ± 0.13 | 41.86 ± 0.15 | 0.564 |
Eggshell Weight (g) | 5.29 ± 0.05 | 5.29 ± 0.06 | 5.23 ± 0.12 | 5.30 ± 0.05 | 0.9282 |
Eggshell Thickness (mm) | 0.42 ± 0.01 | 0.41 ± 0.02 | 0.41 ± 0.00 | 0.40 ± 0.00 | 0.5446 |
Egg Length (mm) | 54.02 ± 0.14 | 53.72 ± 0.15 | 53.98 ± 0.32 | 53.74 ± 0.13 | 0.6122 |
Egg Width (mm) | 41.85 ± 0.42 | 41.87 ± 0.19 | 41.61 ± 0.22 | 41.86 ± 0.29 | 0.564 |
Egg Shape Index | 77.45 ± 0.42 | 77.95 ± 0.31 | 77.16 ± 0.44 | 77.91 ± 0.44 | 0.4707 |
Egg Surface Area (cm2) | 70.62 ± 0.45 | 71.19 ± 0.17 | 70.99 ± 0.55 | 71.23 ± 0.31 | 0.6896 |
Eggshell Breaking Strength N (kg/cm2) | 26.78 ± 0.97 b | 28.98 ± 0.62 a,b | 30.77 ± 1.23 a | 32.07 ± 1.74 a | 0.0097 |
Parameters | Dietary Treatments 1 | p-Value | |||
---|---|---|---|---|---|
Con | Na2SeO3 | Se-Yeast | ADS18 | ||
Albumen Weight (g) | 19.40 ± 0.18 | 19.54 ± 0.64 | 19.54 ± 0.22 | 19.64 ± 0.12 | 0.7022 |
Yolk Weight (g) | 19.39 ± 0.17 | 18.61 ± 0.66 | 18.57 ± 0.21 | 18.65 ± 0.12 | 0.702 |
Albumen Height (mm) | 8.97 ± 0.07 | 8.88 ± 0.07 | 8.85 ± 0.09 | 8.80 ± 0.04 | 0.4278 |
Haugh Unit | 52.39 ± 2.95 c | 55.79 ± 2.41 b,c | 61.60 ± 2.54 b | 69.86 ± 0.76 a | 0.0002 |
Yolk pH | 6.34 ± 0.14 | 6.63 ± 0.21 | 6.65 ± 0.28 | 6.40 ± 0.17 | 0.6219 |
Albumen pH | 9.01 ± 0.29 | 9.01 ± 0.01 | 9.02 ± 0.36 | 8.10 ± 0.11 | 0.8779 |
Parameters | Dietary Treatments 1 | p-Value | |||
---|---|---|---|---|---|
Con | Na2SeO3 | Se-Yeast | ADS18 | ||
Egg Yolk µg/g | 0.61 ± 0.07 c | 1.44 b ± 0.05 b | 1.91 ± 0.03 a | 2.04 ± 0.04 a | <0.0001 |
Meat µg/kg | 48.21 ± 0.70 c | 53.41 ± 0.80 b | 82.44 ± 1.08 a | 84.19 ± 1.03 a | <0.0001 |
Parameters | Dietary Treatments 1 | p-Value | |||
---|---|---|---|---|---|
Con | Na2SeO3 | Se-Yeast | ADS18 | ||
Villi Height, µm | |||||
Duodenum | 648.6 ± 25.7 c | 690.0 b ± 24.2 c | 749.6 ± 29.3 a,b | 784.5 ± 30.8 a | 0.0034 |
Jejunum | 342.5 ± 19.2 c | 380.6 ± 18.8 b,c | 413.4 ± 19.2 a,b | 459.6 ± 20.1 a | 0.0002 |
Ileum | 358.6 ± 17.0 a | 236.4 ± 12.3 c | 279.1 ± 12.6 b | 296.7 ± 10.0 b | <0.0001 |
Crypt Depth, µm | |||||
Duodenum | 151.14 ± 3.7 | 104.58 ± 5.6 | 138.71 ± 7.2 | 144.39 ± 7.2 | 0.2673 |
Jejunum | 102.1 ± 3.7 a | 85.1 ± 4.1 b | 85.6 ± 3.8 b | 74.3 ± 4.2 b | <0.0001 |
Ileum | 83.8 ± 2.4 a | 59.5 ± 2.1 b | 62.4 ± 2.1 b | 58.0 ± 2.3 b | <0.0001 |
Villi Height: Crypt Depth | |||||
Duodenum | 5.53 ± 0.30 b | 7.20 ± 0.38 a | 5.8 ± 0.31 b | 5.730 ± 0.35 b | 0.0044 |
Jejunum | 4.21 ± 0.28 b | 4.59 ± 0.17 b | 5.69 ± 0.21 a | 4.69 ± 0.30 b | 0.0003 |
Ileum | 6.36 ± 0.30 a | 4.05 ± 0.20 b,c | 4.62 ± 0.28 b | 3.76 ± 0.23 c | <0.0001 |
Log 10 Copy no/g Caecum | Dietary Treatments 1 | p-Value | |||
---|---|---|---|---|---|
Con | Na2SeO3 | Se-Yeast | ADS18 | ||
T. Bacteria | 8.44 ± 0.35 c | 9.8 ± 0.08 b | 10.47 ± 0.16 a | 10.55 ± 0.12 a | <0.0001 |
Lactobacilli spp. | 6.42 ± 0.28 b | 6.65 ± 0.09 b | 7.36 ± 0.16 a | 7.70 ± 0.23 a | 0.0003 |
Bifidobacteria spp. | 5.67 ± 0.69 c | 6.18 ± 0.27 b,c | 7.91 ± 0.51 a,b | 8.83 ± 0.84 a | 0.0034 |
Enterobacteria spp. | 5.97 ± 0.51 a | 4.46 ± 0.22 b | 4.28 ± 0.13 b | 4.18 ± 0.07 b | 0.0004 |
Enterococcus spp. | 8.24 ± 0.59 | 8.67 ± 0.34 | 8.55 ± 0.20 | 8.23 ± 0.41 | 0.8074 |
Escherichia coli | 6.50 ± 0.74 a | 5.86 ± 0.80 a,b | 4.21 ± 0.29 b | 4.28 ± 0.18 b | 0.0168 |
Salmonella spp. | 2.88 ± 0.25 a | 2.57 ± 0.30 a,b | 2.08 ± 0.22 b | 2.05 ± 0.07 b | 0.0447 |
Organic Acids | Dietary Treatments 1 | p-Value | |||
---|---|---|---|---|---|
Con | Na2SeO3 | Se-Yeast | ADS18 | ||
Acetate | 19.00 ± 1.97 b | 19.03 ± 0.98 b | 26.74 ± 1.91 a | 30.79 ± 1.14 a | 0.0047 |
Propionate | 1.58 ± 0.09 b | 2.36 ± 0.06 a | 1.27 ± 0.09 c | 1.06 ± 0.06 c | <0.0001 |
Butyrate | 1.06 ± 0.08 b | 1.60 ± 0.05 a | 0.59 ± 0.06 c | 0.59 ± 0.03 c | <0.0001 |
Isobutyrate | 18.68 ± 0.47 b | 22.32 ± 0.39 a | 18.90 ± 1.22 b | 12.48 ± 0.97 c | <0.0001 |
Valerate | 0.36 ± 0.04 a | 0.31 ± 0.05 a,b | 0.23 ± 0.01 b | 0.12 ± 0.04 c | 0.0006 |
Isovalerate | 1.27 ± 0.15 a | 1.32 ± 0.05 a | 0.81 ± 0.02 b | 0.70 ± 0.04 b | <0.0001 |
Total VFA | 41.95 ± 3.17 | 46.92 ± 3.79 | 48.54 ± 2.10 | 45.74 ± 3.48 | 0.3504 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Muhammad, A.I.; Mohamed, D.A.; Chwen, L.T.; Akit, H.; Samsudin, A.A. Effect of Selenium Sources on Laying Performance, Egg Quality Characteristics, Intestinal Morphology, Microbial Population and Digesta Volatile Fatty Acids in Laying Hens. Animals 2021, 11, 1681. https://doi.org/10.3390/ani11061681
Muhammad AI, Mohamed DA, Chwen LT, Akit H, Samsudin AA. Effect of Selenium Sources on Laying Performance, Egg Quality Characteristics, Intestinal Morphology, Microbial Population and Digesta Volatile Fatty Acids in Laying Hens. Animals. 2021; 11(6):1681. https://doi.org/10.3390/ani11061681
Chicago/Turabian StyleMuhammad, Aliyu Ibrahim, Dalia Alla Mohamed, Loh Teck Chwen, Henny Akit, and Anjas Asmara Samsudin. 2021. "Effect of Selenium Sources on Laying Performance, Egg Quality Characteristics, Intestinal Morphology, Microbial Population and Digesta Volatile Fatty Acids in Laying Hens" Animals 11, no. 6: 1681. https://doi.org/10.3390/ani11061681