Tetra-Primer Amplification-Refractory Mutation System (ARMS)—PCR for Genotyping Mouse Leptin Gene Mutation
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals
2.2. DNA Extraction from Tail Tissue
2.3. Primer Design and ARMS-PCR Parameters
2.4. Sequencing of Tetra-Primer ARMS-PCR Amplicons
3. Results and Discussion
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Lindstrom, P. The physiology of obese-hyperglycemic mice [ob/ob mice]. ScientificWorldJournal 2007, 7, 666–685. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Martinez-Sanchez, N. There and Back Again: Leptin Actions in White Adipose Tissue. Int. J. Mol. Sci. 2020, 21, 6039. [Google Scholar] [CrossRef]
- Steppan, C.M.; Crawford, D.T.; Chidsey-Frink, K.L.; Ke, H.; Swick, A.G. Leptin is a potent stimulator of bone growth in ob/ob mice. Regul. Pept. 2000, 92, 73–78. [Google Scholar] [CrossRef]
- Wang, B.; Chandrasekera, P.C.; Pippin, J.J. Leptin- and leptin receptor-deficient rodent models: Relevance for human type 2 diabetes. Curr. Diabetes Rev. 2014, 10, 131–145. [Google Scholar] [CrossRef] [Green Version]
- Munzberg, H.; Morrison, C.D. Structure, production and signaling of leptin. Metabolism 2015, 64, 13–23. [Google Scholar] [CrossRef] [Green Version]
- Evans, M.C.; Lord, R.A.; Anderson, G.M. Multiple Leptin Signalling Pathways in the Control of Metabolism and Fertility: A Means to Different Ends? Int. J. Mol. Sci. 2021, 22, 9210. [Google Scholar] [CrossRef]
- Park, H.K.; Ahima, R.S. Leptin signaling. F1000Prime Rep. 2014, 6, 73. [Google Scholar] [CrossRef] [Green Version]
- Paz-Filho, G.; Mastronardi, C.; Delibasi, T.; Wong, M.L.; Licinio, J. Congenital leptin deficiency: Diagnosis and effects of leptin replacement therapy. Arq. Bras. Endocrinol. Metabol. 2010, 54, 690–697. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Y.; Proenca, R.; Maffei, M.; Barone, M.; Leopold, L.; Friedman, J.M. Positional cloning of the mouse obese gene and its human homologue. Nature 1994, 372, 425–432. [Google Scholar] [CrossRef]
- Chehab, F.F.; Lim, M.E.; Lu, R. Correction of the sterility defect in homozygous obese female mice by treatment with the human recombinant leptin. Nat. Genet. 1996, 12, 318–320. [Google Scholar] [CrossRef]
- Jacquot, S.; Chartoire, N.; Piguet, F.; Herault, Y.; Pavlovic, G. Optimizing PCR for Mouse Genotyping: Recommendations for Reliable, Rapid, Cost Effective, Robust and Adaptable to High-Throughput Genotyping Protocol for Any Type of Mutation. Curr. Protoc. Mouse Biol. 2019, 9, e65. [Google Scholar] [CrossRef] [Green Version]
- Peng, B.Y.; Wang, Q.; Luo, Y.H.; He, J.F.; Tan, T.; Zhu, H. A novel and quick PCR-based method to genotype mice with a leptin receptor mutation (db/db mice). Acta Pharmacol. Sin. 2018, 39, 117–123. [Google Scholar] [CrossRef]
- Ehnert, S.; Linnemann, C.; Braun, B.; Botsch, J.; Leibiger, K.; Hemmann, P.; Nussler, A.A.K. One-Step ARMS-PCR for the Detection of SNPs-Using the Example of the PADI4 Gene. Methods Protoc. 2019, 2, 63. [Google Scholar] [CrossRef] [Green Version]
- Islam, M.T.; Alam, A.R.U.; Sakib, N.; Hasan, M.S.; Chakrovarty, T.; Tawyabur, M.; Islam, O.K.; Al-Emran, H.M.; Jahid, M.I.K.; Anwar Hossain, M. A rapid and cost-effective multiplex ARMS-PCR method for the simultaneous genotyping of the circulating SARS-CoV-2 phylogenetic clades. J Med Virol. 2021, 93, 2962–2970. [Google Scholar] [CrossRef]
- Little, S. Amplification-refractory mutation system (ARMS) analysis of point mutations. Curr. Protoc. Hum. Genet. 2001, 9, 9-8. [Google Scholar] [CrossRef]
- Komijani, M.; Shahin, K.; Azhar, E.I.; Bahram, M. Designing PCR Primers for the Amplification-Refractory Mutation System. Methods Mol. Biol. 2022, 2392, 93–99. [Google Scholar] [CrossRef]
- Ye, S.; Dhillon, S.; Ke, X.; Collins, A.R.; Day, I.N. An efficient procedure for genotyping single nucleotide polymorphisms. Nucleic Acids Res. 2001, 29, E88. [Google Scholar] [CrossRef] [Green Version]
- Vamvakopoulos, J.E. Multiplex universal genotyping using a modified ARMS-PCR protocol. Biotechniques 2002, 33, 1110–1112. [Google Scholar] [CrossRef] [PubMed]
- Huang, M.M.; Arnheim, N.; Goodman, M.F. Extension of base mispairs by Taq DNA polymerase: Implications for single nucleotide discrimination in PCR. Nucleic Acids Res. 1992, 20, 4567–4573. [Google Scholar] [CrossRef] [Green Version]
- Medrano, R.F.; de Oliveira, C.A. Guidelines for the tetra-primer ARMS-PCR technique development. Mol. Biotechnol. 2014, 56, 599–608. [Google Scholar] [CrossRef]
- Newton, C.R.; Graham, A.; Heptinstall, L.E.; Powell, S.J.; Summers, C.; Kalsheker, N.; Smith, J.C.; Markham, A.F. Analysis of any point mutation in DNA. The amplification refractory mutation system (ARMS). Nucleic Acids Res. 1989, 17, 2503–2516. [Google Scholar] [CrossRef]
- Liu, J.; Huang, S.; Sun, M.; Liu, S.; Liu, Y.; Wang, W.; Zhang, X.; Wang, H.; Hua, W. An improved allele-specific PCR primer design method for SNP marker analysis and its application. Plant Methods 2012, 8, 34. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Laboratory, T.J. B6.Cg-Lepob/J. Available online: https://www.jax.org/strain/000632 (accessed on 15 July 2022).
- Suriano, F.; Vieira-Silva, S.; Falony, G.; Roumain, M.; Paquot, A.; Pelicaen, R.; Regnier, M.; Delzenne, N.M.; Raes, J.; Muccioli, G.G.; et al. Novel insights into the genetically obese (ob/ob) and diabetic (db/db) mice: Two sides of the same coin. Microbiome 2021, 9, 147. [Google Scholar] [CrossRef] [PubMed]
- Laboratory, T.J. B6.BKS(D)-Leprdb/J. Available online: https://www.jax.org/strain/000697 (accessed on 14 July 2022).
- Chung, W.K.; Chua, S.C.; Lee, G.H.; Leibel, R.L. Polymerase chain reaction-restriction fragment length polymorphisms (PCR-RFLP) and electrophoretic assays for the mouse obese (Lepob) mutation. Obes. Res. 1997, 5, 183–185. [Google Scholar] [CrossRef] [PubMed]
- Ellett, J.D.; Evans, Z.P.; Zhang, G.; Chavin, K.D.; Spyropoulos, D.D. A rapid PCR-based method for the identification of ob mutant mice. Obesity 2009, 17, 402–404. [Google Scholar] [CrossRef] [PubMed]
- Oler, A.T.; Attie, A.D. A rapid, microplate SNP genotype assay for the leptinob allele. J. Lipid Res. 2008, 49, 1126–1129. [Google Scholar] [CrossRef] [Green Version]
- Mein, C.A.; Barratt, B.J.; Dunn, M.G.; Siegmund, T.; Smith, A.N.; Esposito, L.; Nutland, S.; Stevens, H.E.; Wilson, A.J.; Phillips, M.S.; et al. Evaluation of single nucleotide polymorphism typing with invader on PCR amplicons and its automation. Genome Res. 2000, 10, 330–343. [Google Scholar] [CrossRef] [Green Version]
- Ayabe, H.; Ikeda, S.; Maruyama, S.; Shioyama, S.; Kikuchi, M.; Kawaguchi, A.; Yamada, T.; Ikeda, T. Development of an efficient genotyping method to detect obese mutation in the mouse leptin gene for use in SPF barrier facilities. J. Vet. Med. Sci. 2013, 75, 633–638. [Google Scholar] [CrossRef]
Name | Sequences | Length of Expected PCR Amplicons |
---|---|---|
Forward Outer (FO) | 5′-GGTCACTGGCTTGGACTTCA-3′ | Between FO and RO pair: 369 bp |
Reverse Outer (RO) | 5′-TGATTCTTGGGAGCCTGGTGGCCTTTGA-3′ | Between FI and RO pair: 253 bp (C allele, wildtype) |
Forward Inner (FI) | 5′-TGCAGATAGCCAATGACCTGGAGAATCGCC-3′ | Between FO and RI pair: 171 bp (T allele, mutant) |
Reverse Inner (RI) | 5′-AAGGCCAGCAGATGGAGGAGGTCGCA-3′ |
Animal ID | Sequencing Results | Allele | Genotype |
---|---|---|---|
129 | CTGGAGAATCTCTGCGACCTC | T allele | Lep+/−, heterozygous |
129 | CTGGAGAATCGCCGAGACCTC | C allele | |
136 | CTGGAGAATCTCTGCGACCTC | T allele | Lep+/−, heterozygous |
136 | CTGGAGAATCGCCGAGACCTC | C allele | |
137 | CTGGAGAATCTCTGCGACCTC | T allele | Lep+/−, heterozygous |
137 | CTGGAGAATCGCCGAGACCTC | C allele | |
128 | CTGGAGAATCGCCGAGACCTC | C allele | Lep+/+, wildtype |
130 | CTGGAGAATCGCCGAGACCTC | C allele | Lep+/+, wildtype |
131 | CTGGAGAATCGCCGAGACCTC | C allele | Lep+/+, wildtype |
138 | CTGGAGAATCTCTGCGACCTC | T allele | Lep−/−, ob/ob |
139 | CTGGAGAATCTCTGCGACCTC | T allele | Lep−/−, ob/ob |
135 | CTGGAGAATCTCTGCGACCTC | T allele | Lep−/−, ob/ob |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, J.; Xu, X.; Dalhaimer, P.; Zhao, L. Tetra-Primer Amplification-Refractory Mutation System (ARMS)—PCR for Genotyping Mouse Leptin Gene Mutation. Animals 2022, 12, 2680. https://doi.org/10.3390/ani12192680
Chen J, Xu X, Dalhaimer P, Zhao L. Tetra-Primer Amplification-Refractory Mutation System (ARMS)—PCR for Genotyping Mouse Leptin Gene Mutation. Animals. 2022; 12(19):2680. https://doi.org/10.3390/ani12192680
Chicago/Turabian StyleChen, Jiangang, Xinyun Xu, Paul Dalhaimer, and Ling Zhao. 2022. "Tetra-Primer Amplification-Refractory Mutation System (ARMS)—PCR for Genotyping Mouse Leptin Gene Mutation" Animals 12, no. 19: 2680. https://doi.org/10.3390/ani12192680