Equus β-Defensin-1 Regulates Innate IMMUNE Response in S. aureus-Infected Mouse Monocyte Macrophage
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. cDNA Preparation
2.2. PCR
2.3. qPCR
2.4. Rapid Amplification of cDNA Ends (RACE) PCR
2.5. The OEBD-1 and ELP-(V)30 Fragment Connection
2.6. The ELP-(V)30-OEBD-1 Recombination Proteins Expression In Vitro
2.7. Mice Mononuclear Macrophage J774A.1 Cell Line Culture
2.8. Preparation of the S. aureus-Infected J774A.1
2.9. Macrophage (J774A.1) Phagocytosis Assay
2.10. Enzyme-Linked Immunosorbent Assay (ELISA)
2.11. Protein Extraction
2.12. Coomassie Brilliant Blue Staining
2.13. Western Blotting
2.14. Immunofluorescence Assay
2.15. Data Analysis
3. Results
3.1. BD-1 Expression in Various Tissues of the Horse, Ass, Mule, and Homology Analysis
3.2. The ELP-(V)30-OEBD-1 Recombination Protein Is Highly Expressed after Two Inverse Transition Cycling (ITC)
3.3. The OEBD-1 Recombination Protein Induces Various Cytokines Expression in SA113-Infected J774A.1 Cells
3.4. The OEBD-1 Recombination Strengthens Macrophage Phagocytosis of SA113
3.5. The OEBD-1 Recombination Promotes the Phosphorylation of Syk, AKT and IκB-α in SA113-Infected Macrophage
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Wang, J.; Bian, G.; Pan, W.; Feng, T.; Dai, J. Molecular characterization of a defensin gene from a hard tick, Dermacentor silvarum. Parasites Vectors 2015, 8, 25. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ganz, T. Defensins: Antimicrobial peptides of innate immunity. Nat. Rev. Immunol. 2003, 3, 710–720. [Google Scholar] [CrossRef] [PubMed]
- Duits, L.A.; Ravensbergen, B.; Rademaker, M.; Hiemstra, P.S.; Nibbering, P.H. Expression of beta-defensin-1 and 2 mRNA by human monocytes, macrophages and dendritic cells. Immunology 2002, 106, 517–525. [Google Scholar] [CrossRef]
- Ganz, T.; Weiss, J. Antimicrobial peptides of phagocytes and epithelia. Semin. Hematol. 1997, 34, 343–354. [Google Scholar] [PubMed]
- Marth, C.D.; Glenton, L.Y.; Browning, G.F.; Krekeler, N. Uterine equine β-defensin 1 expression during different stages of the oestrous cycle and after bacterial challenge. J. Equine Vet. Sci. 2014, 34, 153. [Google Scholar] [CrossRef]
- Lee, S.H.; Lim, H.H.; Lee, H.M.; Choi, J.O. Expression of human β-defensin 1 mRNA in human nasal mucosa. Acta Otolaryngol. 2000, 120, 58–61. [Google Scholar]
- Goldman, M.J.; Anderson, G.M.; Stolzenberg, E.D.; Kari, U.P.; Zasloff, M.; Wilson, J.M. Human β-defensin-1 is a salt-sensitive antibiotic in lung that is inactivated in cystic fibrosi. Cell 1997, 88, 553–560. [Google Scholar] [CrossRef] [Green Version]
- Jia, H.P.; Starner, T.; Ackermann, M.; Kirby, P.; Mccray, P.B. Abundant human β-defensin-1 expression in milk and mammary gland epithelium. J. Pediatrics 2001, 138, 109–112. [Google Scholar] [CrossRef]
- Davis, E.G.; Sang, Y.; Blecha, F. Equine b-defensin-1: Full-length cDNA sequence and tissue expression. Vet. Immunol. Immunopathol. 2004, 99, 127–132. [Google Scholar] [CrossRef]
- Biragyn, A.; Ruffini, P.A.; Leifer, C.A.; Klyushnenkova, E.; Shakhov, A.; Chertov, O.; Shirakawa, A.K.; Farber, J.M.; Segal, D.M.; Oppenheim, J.J.; et al. Toll-Like Receptor 4–Dependent Activation of Dendritic Cells by beta-Defensin 2. Science 2002, 298, 1025–1029. [Google Scholar] [CrossRef]
- Coordes, A.; Andreou, A.; Erben, U.; Stroh, T.; Blunert, K.; Slavova, N.; Siegmund, B.; Buhr, H.J.; Kroesen, A.J. Recombinant human beta 2-defensin fusion proteins as a tool to investigate defensin structure and function in small human intestinal tissue samples. Inflamm. Res. 2012, 61, 1411–1420. [Google Scholar] [CrossRef]
- Shin, J.E.; Choi, Y. Treponema denticola suppresses expression of human beta-defensin-2 in gingival epithelial cells through inhibition of TNFalpha production and TLR2 activation. Mol. Cells 2010, 29, 407–412. [Google Scholar] [CrossRef]
- Smithrithee, R.; Niyonsaba, F.; Kiatsurayanon, C.; Ushio, H.; Lkeda, S.; Okumura, K.; Ogawa, H. Human β-defensin-3 increases the expression of interleukin-37 through CCR6 in human keratinocytes. J. Dermatol. Sci. 2015, 77, 46–53. [Google Scholar] [CrossRef]
- Rizzo, A.; Paolillo, R.; Buommino, E.; Lanza, A.G.; Guida, L.; Annunziata, M.; Carratelli, C.R. Modulation of cytokine and β-defensin 2 expressions in human gingival fibroblasts infected with Chlamydia pneumoniae. Int. Immunopharmacol. 2008, 8, 1239–1247. [Google Scholar] [CrossRef]
- Selsted, M.E.; Ouellette, A.J. Mammalian defensins in the antimicrobial immune response. Nat. Immunol. 2005, 6, 551–557. [Google Scholar] [CrossRef]
- Cleemput, J.V.; Poelaert, K.C.; Laval, K.; Vanderheijden, N.; Dhaenens, M.; Daled, S.; Boyen, F.; Pasmans, F.; Nauwynck, H.J. An alphaherpesvirus exploits antimicrobial β-defensins to initiate respiratory tract infection. J. Virol. 2020, 94, e01676-19. [Google Scholar] [CrossRef] [Green Version]
- Rabinovitch, M. Profesional and non-professional phagocytes: An introduction. Trends Cell Biol. 1995, 5, 85–87. [Google Scholar] [CrossRef]
- Ghazizadeh, S.; Bolen, J.B.; Fleit, H.B. Tyrosine phosphorylation and association of Syk with Fc gamma RII in monocytic THP-1 cells. Biochem. J. 1995, 305, 669–674. [Google Scholar] [CrossRef]
- Greenberg, S. Signal transduction of phagocytosis. Trends Cell Biol. 1995, 5, 93–99. [Google Scholar] [CrossRef]
- Aderem, A.; Underhill, D.M. Mechanisms of phagocytosis in macrophages. Annu. Rev. Immunol. 1999, 17, 593–623. [Google Scholar] [CrossRef]
- Jin, X.; Zhang, M.; Zhu, X.M.; Fan, Y.R.; Du, C.G.; Bao, H.; Xu, S.G.; Tian, Q.Z.; Wang, Y.H.; Yang, Y.F. Modulation of ovine SBD-1 expression by Saccharomyces cerevisiae in ovine ruminal epithelial cells. BMC Vet. Res. 2018, 14, 134. [Google Scholar] [CrossRef] [PubMed]
- Kalantari, N.; Ghasemi, M.; Bayani, M.; Ghaffai, S. Effect of honey on mRNA expression of TNF-a, IL-1b and IL-6 following acute toxoplasmosis in mice. Cytokine 2016, 88, 85–90. [Google Scholar] [CrossRef] [PubMed]
- Huang, J.; Zhang, C.; Xu, W.; Lian, C.; Liu, X.; Wang, C.; Liu, J.Q. New lathyrane diterpenoids with anti-inflammatory activity isolated from the roots of Jatropha curcas L. J. Ethnopharmacol. 2021, 268, 113673. [Google Scholar] [CrossRef] [PubMed]
- Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE Guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 2009, 4, 611–622. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shamji, M.F.; Betre, H.; Kraus, V.B.; Chen, J.; Chilkoti, A.; Pichika, R.; Masuda, K.; Setton, L.A. Development and characterization of a fusion protein between thermally responsive elastin-like polypeptide and interleukin-1 receptor antagonist: Sustained release of a local anti-inflammatory therapeutic. Arthritis Rheum. 2007, 56, 3650–3661. [Google Scholar] [CrossRef]
- Wu, W.Y.; Fong, B.A.; Gilles, A.G.; Wood, D.W. Recombinant protein purification by self-cleaving elastin-like polypeptide fusion tag. Curr. Protoc. Protein Sci. 2009, 58, 26.4.1–26.4.18. [Google Scholar] [CrossRef]
- Wu, J.D.; Liu, B.; Mao, W.; Feng, S.; Yao, Y.; Bai, F.; Shen, Y.; Guleng, A.; Jirigala, B.; Cao, J. Prostaglandin E2 regulates activation of mouse peritoneal macrophages by Staphylococcus aureus through Toll-Like Receptor 2, Toll-Like Receptor 4 and NLRP3 Inflammasome Signaling. J. Innate Immun. 2020, 12, 154–169. [Google Scholar] [CrossRef]
- Liu, K.; Mao, W.; Liu, B.; Li, T.; Wu, J.D.; Fu, C.; Shen, Y.; Pei, L.; Cao, J. Live S. aureus and heat-killed S. aureus induce different inflammation-associated factors in bovine endometrial tissue in vitro. Mol. Immunol. 2021, 139, 123–130. [Google Scholar]
- Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef] [Green Version]
- Lin, C.; Wang, W.; Chen, S.; Chang, Y.; Hung, L.; Chen, C.; Chang, Y.W.; Hung, L.C.; Chen, C.Y.; Chen, Y.H. Lipopolysaccharide-Induced Nitric Oxide, Prostaglandin E2, and Cytokine Production of Mouse and Human Macrophages are Suppressed by Pheophytin-b. Int. J. Mol. Sci. 2017, 18, 22637. [Google Scholar]
- Stoll, H.; Dengjel, J.; Nerz, C.; Götz, F. Staphylococcus aureus deficient in lipidation of prelipoproteins is attenuated in growth and immune activation. Infect. Immun. 2015, 73, 2411–2423. [Google Scholar] [CrossRef] [Green Version]
- Liu, K.; Mao, W.; Liu, B.; Li, T.; Pei, L.; Cao, J.S.; Wang, F. Prostaglandin E2 promotes Staphylococcus aureus infection via EP4 receptor in bovine endometrium. Microb. Pathog. 2021, 158, 105019. [Google Scholar] [CrossRef]
- Wetering, S.V.; Mannesse-Lazeroms, S.P.G.; Sterkenburg, M.A.J.A.; Hiemstra, P.S. Neutrophil defensins stimulate the release of cytokines by airway epithelial cells: Modulation by dexamethasone. Inflamm. Res. 2002, 51, 8–15. [Google Scholar] [CrossRef]
- Linde, A.; Lushington, G.H.; Blecha, F.; Melgarejo, T. Rat cardiomyocytes express a classical epithelial beta-defensin. Am. J Anim. Vet. Sci. 2008, 3, 1–6. [Google Scholar] [CrossRef]
- Matzinger, P. Tolerance, danger, and the extended family. Annu. Rev. Immunol. 1994, 12, 991–1045. [Google Scholar] [CrossRef]
- He, S.; Wang, X.; Liu, Z.; Zhang, W.; Fang, J.; Xue, J.; Bao, H. Hydroxysafflor yellow a inhibits Staphylococcus aureus induced mouse endometrial inflammation via TLR2-Mediated NF-kB and MAPK Pathway. Inflammation 2021, 44, 835–845. [Google Scholar] [CrossRef]
- Cao, F.; Zhou, W.; Liu, G.; Xia, T.; Liu, M.; Mi, B.; Liu, Y. Staphylococcus aureus peptidoglycan promotes osteoclastogenesis via TLR2-mediated activation of the NF-κB/NFATc1 signaling pathway. Am. J. Transl. Res. 2017, 9, 5022–5030. [Google Scholar]
- Ravetch, J.V. Fc receptors: Rubor redux. Cell 1994, 78, 553–560. [Google Scholar] [CrossRef]
- Argyle, D.; Kitamura, T. Targeting Macrophage-Recruiting Chemokines as a Novel Therapeutic Strategy to Prevent the Progression of Solid Tumors. Front. Immunol. 2018, 9, 2629. [Google Scholar] [CrossRef] [Green Version]
- Filippo, K.D.; Dudeck, A.; Hasenberg, M.; Nye, E.; van Rooijen, N.; Hartmann, K.; Gunzer, M.; Roers, A.; Hogg, N. Mast cell and macrophage chemokines CXCL1/CXCL2 control the early stage of neutrophil recruitment during tissue inflammation. Blood 2013, 121, 4930–4937. [Google Scholar] [CrossRef]
Primer Name | Forward (5′-3′) | Reverse (5′-3′) | GenBank Accession No. |
---|---|---|---|
equine β-actin | GGCTCCCAGCAGATGAA | GCATTTGCGGTGGACGAT | AF035774.1 |
eBD-1 | CAGGTGTCGGCTATCTCACG | CCTTCCCGCCGTAACAAGT | XM_005606422.3 |
ass BD-1 | ATGTCCTCAGGTGTCGGCTA | ACAAGTGCCCTCAATCTTGGT | XM_014857440.1 |
ass β-actin | TGCGTGACATCAAGGAGAAG | ACAGGTCCTTACGGATGTCG | XM_014853634.1 |
mule BD-1 | CAGGTGTCGGCTATCTCACG | CCTTCCCGCCGTAACAAGT | KP710585 |
mule β-actin | CCAAGGGTGGATCCTTA | AGGAGGAATGGGAATATT | KU947963 |
TLR2 | TTTGCTCCTGCGAACTCC | GCCACGCCCACATCATTC | XM_006501460.4 |
IL-1β | ACCTTCCAGGATGAGGACATGA | CTAATGGGAACGTCACACACCA | AL808143.5 |
CCL2 | ATCCACGGCATACTATCAACATC | TCGTAGTCATACGGTGTGGTG | XM_036154586.1 |
CCL7 | CCACATGCTGCTATGTCAAGA | ACACCGACTACTGGTGATCCT | NM_013654.3 |
CXCL10 | CAGTGAGAATGAGGGCCATAGG | CGGATTCAGACATCTCTGCTCAT | XM_021161764.2 |
NF-κB P65 | TTCCCTCAGAGCCAGCCCAGG | AGCGGAATCGCATGCCCC | M61909.1 |
GAPDH | CAATGTGTCCGTCGTGGATCT | GTCCTCAGTGTAGCCCAAGATG | XM_036165840.1 |
Primer Name | Forward (5′-3′) |
---|---|
P1 | CTAATACGACTCACTATAGGGCAAGCAGTGGTATCACGCAGAGT |
P2 | CTAATACGACTCACTATAGGGC |
P3 | CCGCCGTAACAAGTGCCCTCAATC |
P4 | (dT) n-CGAAAGCGACAAGGCCGTGATCCCGAAAGC |
P5 | CGAAAGCGACAAGGCCGTGATCCCGAAAGC |
P6 | GGTGTCGGCTATCTCACGGGTCTCG |
P7 | GCTATCTCACGGGTCTCGGCCACAGGT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pei, L.; Liu, K.; Wei, W.; Su, H.; Li, F.; Feng, Y.; Wang, D.; Li, X.; Hou, Y.; Cao, G. Equus β-Defensin-1 Regulates Innate IMMUNE Response in S. aureus-Infected Mouse Monocyte Macrophage. Animals 2022, 12, 2958. https://doi.org/10.3390/ani12212958
Pei L, Liu K, Wei W, Su H, Li F, Feng Y, Wang D, Li X, Hou Y, Cao G. Equus β-Defensin-1 Regulates Innate IMMUNE Response in S. aureus-Infected Mouse Monocyte Macrophage. Animals. 2022; 12(21):2958. https://doi.org/10.3390/ani12212958
Chicago/Turabian StylePei, Le, Kun Liu, Wei Wei, Hong Su, Feng Li, Ying Feng, Daqing Wang, Xiunan Li, Yongyue Hou, and Guifang Cao. 2022. "Equus β-Defensin-1 Regulates Innate IMMUNE Response in S. aureus-Infected Mouse Monocyte Macrophage" Animals 12, no. 21: 2958. https://doi.org/10.3390/ani12212958