Ellagic Acid Alleviates Oxidative Stress by Mediating Nrf2 Signaling Pathways and Protects against Paraquat-Induced Intestinal Injury in Piglets
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals and Experimental Design
2.2. Tissue Collection and Processing
2.3. Determinations of Serum SOD and CAT Activities, and MDA Levels
2.4. Determinations of Serum Diamine Oxidase and D-Lactate Concentrations
2.5. Intestinal Histological Evaluation
2.6. Immunofluorescence Staining
2.7. Quantitative Reverse Transcription-PCR Analyses
2.8. Western Blotting Analyses
2.9. Statistical Analysis
3. Results
3.1. EA Alleviates the Oxidative Stress and Eliminates the Growth Arrest Induced by PQ in Piglets
3.2. EA Supplementation Stimulates the Nrf2-HO1/NQO1 Signaling Pathway in Small Intestine of Piglets
3.3. EA Supplementation Improves the Intestinal Morphology of PQ-Challenged Piglets
3.4. EA Supplementation Maintains the Structure of Tight Junction and Decreases the Permeability of Intestinal Barrier in PQ Challenged Piglets
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
EA | Ellagic acid |
PQ | paraquet |
EL | low dose EA group; |
EM | middle dose EA group |
EH | high dose EA group |
SOD | superoxide dismutase |
MDA | malondialdehyde |
HO-1 | heme oxygenase-1 |
NQO1 | quinone oxidoreductase 1 |
ROS | reactive oxygen |
RNS | nitrogen species |
CAT | catalase |
GI | gastrointestinal |
DSS | Dextran Sulfate Sodium |
AhR | hydrocarbon receptor; BW, body weight |
ADG | Average daily gain |
ADFI | average daily feed intake |
GSH-Px | glutathione peroxidase; |
ELISA | enzyme-linked immunosorbent assay |
DAO | Diamine oxidase |
DLA | D-lactate |
BSA | Bovine Serum Albumin |
DAPI | 40, 6-diamidino-2-phenylindole |
cDNA | complementary deoxyribonucleic acid |
Ct | threshold cycle |
BCA | Bicinchoninic Acid |
SDS-PAGE | sodium dodecyl sulfate-polyacrylamide gel electrophoresis |
PVDF | poly vinylidene fluoride |
V/C | villus height to crypt depth |
GSH | glutathione |
References
- Clifford, M.N.; Scalbert, A.J. Ellagitannins–nature, occurrence and dietary burden. J. Sci. Food Agric. 2000, 80, 1118–1125. [Google Scholar] [CrossRef]
- Fahmy, H.; Hegazi, N.; El-Shamy, S.; Farag, M.A. Pomegranate juice as a functional food: A comprehensive review of its polyphenols, therapeutic merits, and recent patents. Food Funct. 2020, 11, 5768–5781. [Google Scholar] [CrossRef] [PubMed]
- Ríos, J.-L.; Giner, R.M.; Marín, M.; Recio, M.C. A Pharmacological Update of Ellagic Acid. Planta Med. 2018, 84, 1068–1093. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Uzar, E.; Alp, H.; Cevik, M.U.; Fırat, U.; Evliyaoglu, O.; Tufek, A.; Altun, Y. Ellagic acid attenuates oxidative stress on brain and sciatic nerve and improves histopathology of brain in streptozotocin-induced diabetic rats. Neurol. Sci. 2012, 33, 567–574. [Google Scholar] [CrossRef]
- Shah, T.A.; Parikh, M.; Patel, K.V.; Patel, K.G.; Joshi, C.G.; Gandhi, T.R. Evaluation of the effect of Punica granatum juice and punicalagin on NFκB modulation in inflammatory bowel disease. Mol. Cell. Biochem. 2016, 419, 65–74. [Google Scholar] [CrossRef]
- Alkathiri, B.; El-Khadragy, M.F.; Metwally, D.M.; Al-Olayan, E.M.; Bakhrebah, M.A.; Moneim, A.E.A. Pomegranate (Punica granatum) Juice Shows Antioxidant Activity against Cutaneous Leishmaniasis-Induced Oxidative Stress in Female BALB/c Mice. Int. J. Environ. Res. Public Health 2017, 14, 1592. [Google Scholar] [CrossRef] [Green Version]
- Shanmugam, M.; Rao, S.V.R. Effect of dietary ellagic acid supplementation on semen quality parameters in chickens. Anim. Prod. Sci. 2013, 55, 107–112. [Google Scholar] [CrossRef]
- Xu, Q.; Shen, M.; Han, Y.; Diao, H. Effects of Ellagic Acid Supplementation on Jejunal Morphology, Digestive Enzyme Activities, Antioxidant Capacity, and Microbiota in Mice. Front. Microbiol. 2021, 12, 793576. [Google Scholar] [CrossRef]
- Andrade, M.A.; Lima, V.; Silva, A.S.; Vilarinho, F.; Castilho, M.C.; Khwaldia, K.; Ramos, F. Pomegranate and grape by-products and their active compounds: Are they a valuable source for food applications? Trends Food Sci. Technol. 2019, 86, 68–84. [Google Scholar] [CrossRef]
- Alfei, S.; Turrini, F.; Catena, S.; Zunin, P.; Grilli, M.; Pittaluga, A.M.; Boggia, R. Ellagic acid a multi-target bioactive compound for drug discovery in CNS? A narrative review. Eur. J. Med. Chem. 2019, 183, 111724. [Google Scholar] [CrossRef]
- Sepand, M.R.; Ghahremani, M.H.; Razavi-Azarkhiavi, K.; Aghsami, M.; Rajabi, J.; Keshavarz-Bahaghighat, H.; Soodi, M. Ellagic acid confers protection against gentamicin-induced oxidative damage, mitochondrial dysfunction and apoptosis-related nephrotoxicity. J. Pharm. Pharmacol. 2016, 68, 1222–1232. [Google Scholar] [CrossRef]
- Ahsan, A.; Zheng, Y.R.; Wu, X.L.; Tang, W.D.; Liu, M.R.; Ma, S.J.; Jiang, L.; Hu, W.W.; Zhang, X.N.; Chen, Z. Urolithin A-activated autophagy but not mitophagy protects against ischemic neuronal injury by inhibiting ER stress in vitro and in vivo. CNS Neurosci. Ther. 2019, 25, 976–986. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yin, P.; Zhang, J.; Yan, L.; Yang, L.; Sun, L.; Shi, L.; Ma, C.; Liu, Y. Urolithin C, a gut metabolite of ellagic acid, induces apoptosis in PC12 cells through a mitochondria-mediated pathway. RSC Adv. 2017, 7, 17254–17263. [Google Scholar] [CrossRef] [Green Version]
- Larrosa, M.; Tomás-Barberán, F.A.; Espín, J.C. The dietary hydrolysable tannin punicalagin releases ellagic acid that induces apoptosis in human colon adenocarcinoma Caco-2 cells by using the mitochondrial pathway. J. Nutr. Biochem. 2006, 17, 611–625. [Google Scholar] [CrossRef] [PubMed]
- Cao, S.S.; Kaufman, R.J. Endoplasmic Reticulum Stress and Oxidative Stress in Cell Fate Decision and Human Disease. Antioxid. Redox Signal. 2014, 21, 396–413. [Google Scholar] [CrossRef]
- Zihni, C.; Mills, C.; Matter, K.; Balda, M. Tight junctions: From simple barriers to multifunctional molecular gates. Nat. Rev. Mol. Cell Biol. 2016, 17, 564–580. [Google Scholar] [CrossRef]
- Singh, R.; Chandrashekharappa, S.; Bodduluri, H.; Baby, B.V.; Hegde, B.; Kotla, N.G.; Hiwale, A.A.; Saiyed, T.; Patel, P.; Vijay-Kumar, M.; et al. Enhancement of the gut barrier integrity by a microbial metabolite through the Nrf2 pathway. Nat. Commun. 2019, 10, 89. [Google Scholar] [CrossRef] [Green Version]
- Kaspar, J.W.; Niture, S.K.; Jaiswal, A.K. Nrf2:INrf2 (Keap1) signaling in oxidative stress. Free Radic. Biol. Med. 2009, 47, 1304–1309. [Google Scholar] [CrossRef] [Green Version]
- Nguyen, T.; Nioi, P.; Pickett, C.B. The Nrf2-Antioxidant Response Element Signaling Pathway and Its Activation by Oxidative Stress. J. Biol. Chem. 2009, 284, 13291–13295. [Google Scholar] [CrossRef] [Green Version]
- Podder, B.; Kim, Y.-S.; Zerin, T.; Song, H.-Y. Antioxidant effect of silymarin on paraquat-induced human lung adenocarcinoma A549 cell line. Food Chem. Toxicol. 2012, 50, 3206–3214. [Google Scholar] [CrossRef]
- Zhang, Q.; Widmer, G.; Tzipori, S. A pig model of the human gastrointestinal tract. Gut Microbes 2013, 4, 193–200. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gonzalez, L.M.; Moeser, A.J.; Blikslager, A.T. Porcine models of digestive disease: The future of large animal translational research. Transl. Res. 2015, 166, 12–27. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lan, C.; Wang, J.; Li, L.; Li, H.; Li, L.; Su, Q.; Che, L.; Liu, L.; Di, M. Effects of different tidal volume ventilation on paraquat-induced acute lung injury in piglets. Med. Sci. Monit. Int. Med. J. Exp. Clin. Res. 2015, 21, 452. [Google Scholar]
- El-Aarag, B.; Magdy, M.; Alajmi, M.F.; Khalifa, S.A.; El-Seedi, H.R. Melittin Exerts Beneficial Effects on Paraquat-Induced Lung Injuries in Mice by Modifying Oxidative Stress and Apoptosis. Molecules 2019, 24, 1498. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Long, J.; Guo, Y.; Yang, J.; Henning, S.M.; Lee, R.-P.; Rasmussen, A.; Zhang, L.; Lu, Q.-Y.; Heber, D.; Li, Z. Bioavailability and bioactivity of free ellagic acid compared to pomegranate juice. Food Funct. 2019, 10, 6582–6588. [Google Scholar] [CrossRef] [PubMed]
- Nair, A.B.; Jacob, S. A simple practice guide for dose conversion between animals and human. J. Basic Clin. Pharm. 2016, 7, 27–31. [Google Scholar] [CrossRef] [Green Version]
- Xin, W.; Xugang, S.; Xie, C.; Li, J.; Hu, J.; Yin, Y.-L.; Deng, Z.-Y. The Acute and Chronic Effects of Monosodium l-Glutamate on Serum Iron and Total Iron-Binding Capacity in the Jugular Artery and Vein of Pigs. Biol. Trace Elem. Res. 2013, 153, 191–195. [Google Scholar] [CrossRef]
- Wang, W.; Blachier, F.; Fu, D.; Pan, J.; Yang, H.; Guo, J.; Chu, W.; Kong, X.; Yin, Y. Ontogenic expression of the amino acid transporter b(0,+) AT in suckling Huanjiang piglets: Effect of intra-uterine growth restriction. Br. J. Nutr. 2013, 110, 820–830. [Google Scholar] [CrossRef] [Green Version]
- Wang, J.; Zeng, L.; Tan, B.; Li, G.; Huang, B.; Xiong, X.; Li, F.; Kong, X.; Liu, G.; Yin, Y. Developmental changes in intercellular junctions and Kv channels in the intestine of piglets during the suckling and post-weaning periods. J. Anim. Sci. Biotechnol. 2016, 7, 4. [Google Scholar] [CrossRef] [Green Version]
- Zha, A.; Yuan, D.; Cui, Z.; Qi, M.; Liao, S.; Liao, P.; Tan, B. The Evaluation of the Antioxidant and Intestinal Protective Effects of Baicalin-Copper in Deoxynivalenol-Challenged Piglets. Oxidative Med. Cell. Longev. 2020, 2020, 5363546. [Google Scholar] [CrossRef] [Green Version]
- German, D.P. Inside the guts of wood-eating catfishes: Can they digest wood? J. Comp. Physiol. B 2009, 179, 1011–1023. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, W.; Shan, L.P.; Dong, X.S.; Liu, X.W.; Ma, T.; Liu, Z. Combined early fluid resuscitation and hydrogen inhalation attenuates lung and intestine injury. World J. Gastroenterol. 2013, 19, 492–502. [Google Scholar] [CrossRef] [PubMed]
- Qi, M.; Tan, B.; Wang, J.; Liao, S.; Li, J.; Cui, Z.; Shao, Y.; Ji, P.; Yin, Y. Postnatal growth retardation is associated with deteriorated intestinal mucosal barrier function using a porcine model. J. Cell. Physiol. 2020, 236, 2631–2648. [Google Scholar] [CrossRef] [PubMed]
- Xia, L.; Yang, Y.; Wang, J.; Jing, Y.; Yang, Q. Impact of TGEV infection on the pig small intestine. Virol. J. 2018, 15, 102. [Google Scholar] [CrossRef]
- Wang, J.; Wang, N.; Qi, M.; Li, J.; Yin, Y. Glutamine, Glutamate, and Aspartate Improves Morphology and Energy Production of Small Intestine in Piglets with Different Energy Levels Diets. Anim. Nutr. 2021, 8, 216–226. [Google Scholar] [CrossRef]
- Wang, J.; Xiao, Y.; Li, J.; Qi, M.; Tan, B. Serum biochemical parameters and amino acids metabolism are altered in piglets by early-weaning and proline and putrescine supplementations. Anim. Nutr. 2021, 7, 334–345. [Google Scholar] [CrossRef]
- Zhang, D.D.; Hannink, M. Distinct Cysteine Residues in Keap1 Are Required for Keap1-Dependent Ubiquitination of Nrf2 and for Stabilization of Nrf2 by Chemopreventive Agents and Oxidative Stress. Mol. Cell. Biol. 2003, 23, 8137–8151. [Google Scholar] [CrossRef] [Green Version]
- Wang, N.; Han, Q.; Wang, G.; Ma, W.-P.; Wang, J.; Wu, W.-X.; Guo, Y.; Liu, L.; Jiang, X.-Y.; Xie, X.-L.; et al. Resveratrol Protects Oxidative Stress-Induced Intestinal Epithelial Barrier Dysfunction by Upregulating Heme Oxygenase-1 Expression. Dig. Dis. Sci. 2016, 61, 2522–2534. [Google Scholar] [CrossRef]
- Paradis, T.; Bègue, H.; Basmaciyan, L.; Dalle, F.; Bon, F. Tight Junctions as a Key for Pathogens Invasion in Intestinal Epithelial Cells. Int. J. Mol. Sci. 2021, 22, 2506. [Google Scholar] [CrossRef]
- Sohrab, G.; Angoorani, P.; Tohidi, M.; Tabibi, H.; Kimiagar, M.; Nasrollahzadeh, J. Pomegranate (Punicagranatum) juice decreases lipid peroxidation, but has no effect on plasma advanced glycated end-products in adults with type 2 diabetes: A randomized double-blind clinical trial. Food Nutr. Res. 2015, 59, 28551. [Google Scholar] [CrossRef] [Green Version]
- Noori, M.; Jafari, B.; Hekmatdoost, A. Pomegranate juice prevents development of non-alcoholic fatty liver disease in rats by attenuating oxidative stress and inflammation. J. Sci. Food Agric. 2016, 97, 2327–2332. [Google Scholar] [CrossRef] [PubMed]
- Hao, Y.; Xing, M.; Gu, X. Research Progress on Oxidative Stress and Its Nutritional Regulation Strategies in Pigs. Animals 2021, 11, 1384. [Google Scholar] [CrossRef] [PubMed]
- Yuan, S.-B.; Chen, D.-W.; Zhang, K.-Y.; Yu, B. Effects of Oxidative Stress on Growth Performance, Nutrient Digestibilities and Activities of Antioxidative Enzymes of Weanling Pigs. Asian-Australas. J. Anim. Sci. 2007, 20, 1600–1605. [Google Scholar] [CrossRef]
- Silva-Guillen, Y.V.; Arellano, C.; Boyd, R.D.; Martinez, G.; Van Heugten, E. Growth performance, oxidative stress and immune status of newly weaned pigs fed peroxidized lipids with or without supplemental vitamin E or polyphenols. J. Anim. Sci. Biotechnol. 2020, 11, 22. [Google Scholar] [CrossRef]
- Li, Y.; Wang, P.; Yin, J.; Jin, S.; Su, W.; Tian, J.; Li, T.; Yao, K. Effects of ornithine α-ketoglutarate on growth performance and gut microbiota in a chronic oxidative stress pig model induced by d-galactose. Food Funct. 2019, 11, 472–482. [Google Scholar] [CrossRef]
- Cao, S.; Wu, H.; Wang, C.; Zhang, Q.; Jiao, L.; Lin, F.; Hu, C.H. Diquat-induced oxidative stress increases intestinal permeability, impairs mitochondrial function, and triggers mitophagy in piglets1. J. Anim. Sci. 2018, 96, 1795–1805. [Google Scholar] [CrossRef]
- Espin, J.C.; Larrosa, M.; Garcia-Conesa, M.T.; Tomas-Barberan, F. Biological significance of urolithins, the gut microbial ellagic Acid-derived metabolites: The evidence so far. Evid. Based Complement. Alternat. Med. 2013, 2013, 697–715. [Google Scholar] [CrossRef] [Green Version]
- Maurya, R.P.; Prajapat, M.K.; Singh, V.P.; Roy, M.; Todi, R.; Bosak, S.; Singh, S.K.; Choudhary, S.; Kumar, A.; Morekar, S.R. Serum Malondialdehyde as a Biomarker of Oxidative Stress in Patients with Primary Ocular Carcinoma: Impact on Response to Chemotherapy. Clin. Ophthalmol. 2021, 15, 871–879. [Google Scholar] [CrossRef]
- Mişe Yonar, S.; Yonar, M.E.; Yöntürk, Y.; Pala, A. Effect of ellagic acid on some haematological, immunological and antioxidant parameters of rainbow trout (Oncorhynchus mykiss). J. Anim. Physiol. Anim. Nutr. 2014, 98, 936–941. [Google Scholar] [CrossRef]
- Goudarzi, M.; Fatemi, I.; Siahpoosh, A.; Sezavar, S.H.; Mansouri, E.; Mehrzadi, S. Protective Effect of Ellagic Acid Against Sodium Arsenite-Induced Cardio- and Hematotoxicity in Rats. Cardiovasc. Toxicol. 2018, 18, 337–345. [Google Scholar] [CrossRef]
- Sun, Y.-Q.; Tao, X.; Men, X.-M.; Xu, Z.-W.; Wang, T. In vitro and in vivo antioxidant activities of three major polyphenolic compounds in pomegranate peel: Ellagic acid, punicalin, and punicalagin. J. Integr. Agric. 2017, 16, 1808–1818. [Google Scholar] [CrossRef] [Green Version]
- Wang, Y.; Zhang, H.; Liang, H.; Yuan, Q. Purification, antioxidant activity and protein-precipitating capacity of punicalin from pomegranate husk. Food Chem. 2012, 138, 437–443. [Google Scholar] [CrossRef] [PubMed]
- Bhattacharyya, A.; Chattopadhyay, R.; Mitra, S.; Crowe, S.E. Oxidative Stress: An Essential Factor in the Pathogenesis of Gastrointestinal Mucosal Diseases. Physiol. Rev. 2014, 94, 329–354. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ebrahimi, R.; Sepand, M.R.; Seyednejad, S.A.; Omidi, A.; Akbariani, M.; Gholami, M.; Sabzevari, O. Ellagic acid reduces methotrexate-induced apoptosis and mitochondrial dysfunction via up-regulating Nrf2 expression and inhibiting the IĸBα/NFĸB in rats. DARU J. Pharm. Sci. 2019, 27, 721–733. [Google Scholar] [CrossRef]
- Ding, X.; Jian, T.; Wu, Y.; Zuo, Y.; Li, J.; Lv, H.; Ma, L.; Ren, B.; Zhao, L.; Li, W. Ellagic acid ameliorates oxidative stress and insulin resistance in high glucose-treated HepG2 cells via miR-223/keap1-Nrf2 pathway. Biomed. Pharmacother. 2019, 110, 85–94. [Google Scholar] [CrossRef]
- Altamimi, J.Z.; AlFaris, N.A.; Alshammari, G.M.; Alagal, R.I.; Aljabryn, D.H.; Aldera, H.; Alrfaei, B.M.; Alkhateeb, M.A.; Yahya, M.A. Ellagic acid protects against diabetic nephropathy in rats by regulating the transcription and activity of Nrf2. J. Funct. Foods 2021, 79, 104397. [Google Scholar] [CrossRef]
- Wang, G.; He, X.; Zhu, G.; Li, D.; Shi, J.; Zhang, F. Ellagic acid supports neuron by regulating astroglia Nrf2. Biotechnol. Appl. Biochem. 2019, 66, 738–743. [Google Scholar] [CrossRef]
- Wei, Y.Z.; Zhu, G.F.; Zheng, C.Q.; Li, J.J.; Sheng, S.; Li, D.D.; Wang, G.Q.; Zhang, F. Ellagic Acid Protects from Rotenone-Induced Dopaminergic Neuronal Damage via Activation of Nrf2 Signaling in Astroglia. J. Cell Mol. Med. 2020, 24, 9446–9456. [Google Scholar] [CrossRef]
- Espín, J.C.; González-Barrio, R.; Cerdá, B.; López-Bote, C.; Rey, A.I.; Tomás-Barberán, F.A. Iberian Pig as a Model to Clarify Obscure Points in the Bioavailability and Metabolism of Ellagitannins in Humans. J. Agric. Food Chem. 2007, 55, 10476–10485. [Google Scholar] [CrossRef]
- Tocmo, R.; Le, B.; Heun, A.; van Pijkeren, J.P.; Parkin, K.; Johnson, J.J. Prenylated xanthones from mangosteen (Garcinia mangostana) activate the AhR and Nrf2 pathways and protect intestinal barrier integrity in HT-29 cells. Free Radic. Biol. Med. 2020, 163, 102–115. [Google Scholar] [CrossRef]
- Song, Z.H.; Tong, G.; Xiao, K.; Jiao, L.F.; Ke, Y.L.; Hu, C.H. L-Cysteine protects intestinal integrity, attenuates intestinal inflammation and oxidant stress, and modulates NF-κB and Nrf2 pathways in weaned piglets after LPS challenge. Innate Immun. 2016, 22, 152–161. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Xiao, K.; Yu, C.; Wang, L.; Liang, T.; Zhu, H.; Xu, X.; Liu, Y. Xylooligosaccharide attenuates lipopolysaccharide-induced intestinal injury in piglets via suppressing inflammation and modulating cecal microbial communities. Anim. Nutr. 2021, 7, 609–620. [Google Scholar] [CrossRef]
- Yang, S.; Yu, M. Role of Goblet Cells in Intestinal Barrier and Mucosal Immunity. J. Inflamm. Res. 2021, 14, 3171–3183. [Google Scholar] [CrossRef] [PubMed]
- Ying, M.; Yu, Q.; Zheng, B.; Wang, H.; Wang, J.; Chen, S.; Gu, Y.; Nie, S.; Xie, M. Cultured Cordyceps sinensis polysaccharides attenuate cyclophosphamide-induced intestinal barrier injury in mice. J. Funct. Foods 2019, 62, 103523. [Google Scholar] [CrossRef]
- Wen, Z.; Liu, W.; Li, X.; Chen, W.; Liu, Z.; Wen, J.; Liu, Z. A Protective Role of the NRF2-Keap1 Pathway in Maintaining Intestinal Barrier Function. Oxidative Med. Cell. Longev. 2019, 2019, 1759149. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mir, H.; Meena, A.S.; Chaudhry, K.; Shukla, P.K.; Gangwar, R.; Manda, B.; Padala, M.K.; Shen, L.; Turner, J.R.; Dietrich, P.; et al. Occludin deficiency promotes ethanol-induced disruption of colonic epithelial junctions, gut barrier dysfunction and liver damage in mice. Biochim. Biophys. Acta (BBA)-Gen. Subj. 2015, 1860, 765–774. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Itallie, C.V.; Anderson, J.M. Claudin interactions in and out of the tight junction. Tissue Barriers 2013, 1, e25247. [Google Scholar] [CrossRef] [Green Version]
- Ledwaba, S.E.; Costa, D.V.S.; Bolick, D.T.; Giallourou, N.; Medeiros, P.H.Q.S.; Swann, J.R.; Traore, A.N.; Potgieter, N.; Nataro, J.P.; Guerrant, R.L. Enteropathogenic Escherichia coli (EPEC) Infection Induces Diarrhea, Intestinal Damage, Metabolic Alterations and Increased Intestinal Permeability in a Murine Model. Front. Cell. Infect. Microbiol. 2020, 10, 595266. [Google Scholar] [CrossRef]
- Gao, M.; Jiang, Y.; Xiao, X.; Peng, Y.; Xiao, X.; Yang, M.J. Protective effect of pioglitazone on sepsis-induced intestinal injury in a rodent model. J. Surg. Res. 2015, 195, 550–558. [Google Scholar] [CrossRef]
Ingredients | |
---|---|
Corn | 32.50 |
Extruded corn | 30.00 |
Soybean meal | 10.14 |
Fermented soybean meal | 8.00 |
Fish meal | 5.00 |
Whey powder | 6.00 |
Mineral meal | 0.20 |
Calcium bicarbonate | 0.40 |
Soybean oil | 2.00 |
Glucose | 3.00 |
L-lysine (98%) | 0.55 |
D,L-methionine | 0.07 |
L-threonine | 0.20 |
L-tryptophan (98%) | 0.04 |
Organic acid Calcium | 0.60 |
Choline chloride | 0.01 |
Antioxidant | 0.05 |
Mineral premix 1 | 0.15 |
Vitamin premix 2 | 0.04 |
ZnO | 0.40 |
Acidifier | 0.70 |
Total | 100.00 |
Nutrient composition 3 | |
Digestive energy, MJ/kg | 15.80 |
Crude protein | 16.20 |
Calcium | 0.72 |
Total phosphorus | 0.66 |
Total Lysine | 1.46 |
Forward Primer 5′ to 3′ | Reverse Primer 5′ to 3′ | Accession Number | |
---|---|---|---|
NQO1 | CCAGCAGCCCGGCCAATCTG | AGGTCCGACACGGCGACCTC | NM_001159613.1 |
Nrf2 | CACCACCTCAGGGTAATA | GCGGCTTGAATGTTTGTC | XM_005671981.3 |
Keap1 | AGCTGGGATGCCTCAGTGTT | AGGCAAGTTCTCCCAGACATTC | NM_001114671.1 |
HO-1 | AGCTGTTTCTGAGCCTCCAA | CAAGACGGAAACACGAGACA | NM_001004027.1 |
β-actin | CTGCGGCATCCACGAAACT | AGGGCCGTGATCTCCTTCTG | XM_003124280.5 |
Control | PQ | EL | EM | EH | Pt | PEA | |
---|---|---|---|---|---|---|---|
Initial BW (kg) | 8.81 ± 0.34 | 8.82 ± 0.30 | 8.81 ± 0.32 | 8.81 ± 0.33 | 8.81 ± 0.33 | 1.000 | 1.000 |
Final BW (kg) | 15.60 ± 1.41 | 17.42 ± 1.16 | 17.32 ± 1.11 | 15.41 ± 1.34 | 16.71 ± 1.40 | 0.352 | 0.661 |
ADG (g/d) | 375.00 ± 60.00 | 413.09 ± 47.89 | 405.06 ± 45.39 | 372.22 ± 39.91 | 385.37 ± 57.23 | 0.630 | 0.938 |
ADFI (g/d) | 481.90 ± 94.21 | 601.51 ± 43.94 | 689.70 ± 47.09 | 523.10 ± 86.95 | 699.25 ± 69.57 | 0.301 | 0.200 |
F/G | 2.72 ± 0.24 | 2.83 ± 0.37 | 2.58 ± 0.41 | 2.79 ± 0.18 | 2.33 ± 1.77 | 0.816 | 0.736 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xiao, Y.; Huang, R.; Wang, N.; Deng, Y.; Tan, B.; Yin, Y.; Qi, M.; Wang, J. Ellagic Acid Alleviates Oxidative Stress by Mediating Nrf2 Signaling Pathways and Protects against Paraquat-Induced Intestinal Injury in Piglets. Antioxidants 2022, 11, 252. https://doi.org/10.3390/antiox11020252
Xiao Y, Huang R, Wang N, Deng Y, Tan B, Yin Y, Qi M, Wang J. Ellagic Acid Alleviates Oxidative Stress by Mediating Nrf2 Signaling Pathways and Protects against Paraquat-Induced Intestinal Injury in Piglets. Antioxidants. 2022; 11(2):252. https://doi.org/10.3390/antiox11020252
Chicago/Turabian StyleXiao, Yuxin, Rui Huang, Nan Wang, Yuankun Deng, Bie Tan, Yulong Yin, Ming Qi, and Jing Wang. 2022. "Ellagic Acid Alleviates Oxidative Stress by Mediating Nrf2 Signaling Pathways and Protects against Paraquat-Induced Intestinal Injury in Piglets" Antioxidants 11, no. 2: 252. https://doi.org/10.3390/antiox11020252