Antioxidant and Anti-Inflammatory Effects of Thyme (Thymus vulgaris L.) Essential Oils Prepared at Different Plant Phenophases on Pseudomonas aeruginosa LPS-Activated THP-1 Macrophages
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Material and Distillation of Essential Oils
2.2. GC-MS and GC-FID
2.3. Cell Culture
2.4. Cell Viability Measurements
2.5. Reactive Oxygen Species (ROS) Measurements
2.6. Determination of Peroxidase (PX) Activity
2.7. Determination of Catalase (CAT) Activity
2.8. Determination of Superoxide Dismutase (SOD) Activity
2.9. Determination of Total Antioxidant Capacity (TAC)
2.10. Real-Time PCR Analysis
2.11. Enzyme-Linked Immunosorbent Assay (ELISA) Measurements
2.12. Statistical Analysis
3. Results
3.1. Effects of Thymol and TEOs on Cell Viability of THP-1 Cells
3.2. Composition of the Essential Oils Prepared at the Beginning and at the End of Flowering Period
3.3. Effects of Thymol and TEOs on Reactive Oxygen Species (ROS) Generated by LPS
3.4. Effects of Thymol and TEOs on Peroxidase (PX) Activity of LPS-Treated THP-1 Cells
3.5. Effects of Thymol and TEOs on Catalase (CAT) Activity of LPS-Treated THP-1 Cells
3.6. Effects of Thymol and TEOs on Superoxide Dismutase (SOD) Activity of LPS-Treated THP-1 Cells
3.7. Effects of Thymol and TEOs on Total Antioxidant Capacity (TAC) of LPS-Treated THP-1 Cells
3.8. Effects of Thymol and TEOs on mRNA Expression and Secretion of Proinflammatory Cytokines IL-6, IL-8, IL-1β, and TNF-α
3.9. Inhibitory Effect of Thymol, TEOs, and ACHP NFκB Inhibitor on mRNA Expression and Secretion of Proinflammatory Cytokines after P. aeruginosa LPS Pretreatment
3.10. Pretreatments with Thymol, TEOs, and ACHP NFκB Inhibitor Prevent the mRNA Expression and Secretion of Proinflammatory Cytokines of THP-1 Cells Exposed to P. aeruginosa LPS
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kowalczyk, A.; Przychodna, M.; Sopata, S.; Bodalska, A.; Fecka, I. Thymol and Thyme Essential Oil—New Insights into Selected Therapeutic Applications. Molecules 2020, 25, 4125. [Google Scholar] [CrossRef] [PubMed]
- Tariq, S.; Wani, S.; Rasool, W.; Shafi, K.; Bhat, M.A.; Prabhakar, A.; Shalla, A.H.; Rather, M.A. A Comprehensive Review of the Antibacterial, Antifungal and Antiviral Potential of Essential Oils and Their Chemical Constituents against Drug-Resistant Microbial Pathogens. Microb. Pathog. 2019, 134, 103580. [Google Scholar] [CrossRef] [PubMed]
- Thosar, N.; Basak, S.; Bahadure, R.N.; Rajurkar, M. Antimicrobial Efficacy of Five Essential Oils against Oral Pathogens: An in Vitro Study. Eur. J. Dent. 2013, 7, S071–S077. [Google Scholar] [CrossRef] [Green Version]
- Elbe, E.; Yigitturk, G.; Cavusoglu, T.; Uyanikgil, Y. Apoptotic Effects of Thymol, a Novel Monoterpene Phenol, on Different Types of Cancer. Bratislava Med. J. 2020, 121, 122–128. [Google Scholar] [CrossRef] [Green Version]
- Marchese, A.; Orhan, I.E.; Daglia, M.; Barbieri, R.; Di Lorenzo, A.; Nabavi, S.F.; Gortzi, O.; Izadi, M.; Nabavi, S.M. Antibacterial and Antifungal Activities of Thymol: A Brief Review of the Literature. Food Chem. 2016, 210, 402–414. [Google Scholar] [CrossRef] [PubMed]
- Heghes, S.C.; Filip, L.; Vostinaru, O.; Mogosan, C.; Miere, D.; Iuga, C.A.; Moldovan, M. Essential Oil-Bearing Plants From Balkan Peninsula: Promising Sources for New Drug Candidates for the Prevention and Treatment of Diabetes Mellitus and Dyslipidemia. Front. Pharmacol. 2020, 11, e00989. [Google Scholar] [CrossRef] [PubMed]
- Horváth, G.; Horváth, A.; Reichert, G.; Böszörményi, A.; Sipos, K.; Pandur, E. Three Chemotypes of Thyme (Thymus vulgaris L.) Essential Oil and Their Main Compounds Affect Differently the IL-6 and TNFα Cytokine Secretions of BV-2 Microglia by Modulating the NF-ΚB and C/EBPβ Signalling Pathways. BMC Complement. Med. Ther. 2021, 21, 148. [Google Scholar] [CrossRef]
- Yosr, Z.; Imen, B.H.Y.; Rym, J.; Chokri, M.; Mohamed, B. Sex-Related Differences in Essential Oil Composition, Phenol Contents and Antioxidant Activity of Aerial Parts in Pistacia lentiscus L. during Seasons. Ind. Crops Prod. 2018, 121, 151–159. [Google Scholar] [CrossRef]
- Pandur, E.; Balatinácz, A.; Micalizzi, G.; Mondello, L.; Horváth, A.; Sipos, K.; Horváth, G. Anti-Inflammatory Effect of Lavender (Lavandula angustifolia Mill.) Essential Oil Prepared during Different Plant Phenophases on THP-1 Macrophages. BMC Complement. Med. Ther. 2021, 21, 287. [Google Scholar] [CrossRef]
- Cazella, L.N.; Glamoclija, J.; Soković, M.; Gonçalves, J.E.; Linde, G.A.; Colauto, N.B.; Gazim, Z.C. Antimicrobial Activity of Essential Oil of Baccharis dracunculifolia DC (Asteraceae) Aerial Parts at Flowering Period. Front. Plant Sci. 2019, 10, e00027. [Google Scholar] [CrossRef] [Green Version]
- Galovičová, L.; Borotová, P.; Valková, V.; Vukovic, N.L.; Vukic, M.; Štefániková, J.; Ďúranová, H.; Kowalczewski, P.Ł.; Čmiková, N.; Kačániová, M. Thymus vulgaris Essential Oil and Its Biological Activity. Plants 2021, 10, 1959. [Google Scholar] [CrossRef] [PubMed]
- Gellatly, S.L.; Hancock, R.E.W. Pseudomonas aeruginosa: New Insights into Pathogenesis and Host Defenses. Pathog. Dis. 2013, 67, 159–173. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chai, Y.H.; Xu, J.F. How Does Pseudomonas aeruginosa Affect the Progression of Bronchiectasis? Clin. Microbiol. Infect. 2020, 26, 313–318. [Google Scholar] [CrossRef] [PubMed]
- Rodrigo-Troyano, A.; Suarez-Cuartin, G.; Peiró, M.; Barril, S.; Castillo, D.; Sanchez-Reus, F.; Plaza, V.; Restrepo, M.I.; Chalmers, J.D.; Sibila, O. Pseudomonas aeruginosa Resistance Patterns and Clinical Outcomes in Hospitalized Exacerbations of COPD. Respirology 2016, 21, 1235–1242. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yum, H.K.; Park, I.N.; Shin, B.M.; Choi, S.J. Recurrent Pseudomonas aeruginosa Infection in Chronic Lung Diseases: Relapse or Reinfection? Tuberc. Respir. Dis. 2014, 77, 172–177. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nguyen, L.; Garcia, J.; Gruenberg, K.; MacDougall, C. Multidrug-Resistant Pseudomonas Infections: Hard to Treat, But Hope on the Horizon? Curr. Infect. Dis. Rep. 2018, 20, 23. [Google Scholar] [CrossRef]
- Wang, S.; Xiang, D.; Tian, F.; Ni, M. Lipopolysaccharide from Biofilm-Forming Pseudomonas aeruginosa PAO1 Induces Macrophage Hyperinflammatory Responses. J. Med. Microbiol. 2021, 70, 001352. [Google Scholar] [CrossRef]
- Phuong, M.S.; Hernandez, R.E.; Wolter, D.J.; Hoffman, L.R.; Sad, S. Impairment in Inflammasome Signaling by the Chronic Pseudomonas aeruginosa Isolates from Cystic Fibrosis Patients Results in an Increase in Inflammatory Response. Cell Death Dis. 2021, 12, 241. [Google Scholar] [CrossRef]
- Buyck, J.M.; Tulkens, P.M.; Van Bambeke, F. Pharmacodynamic Evaluation of the Intracellular Activity of Antibiotics towards Pseudomonas aeruginosa PAO1 in a Model of THP-1 Human Monocytes. Antimicrob. Agents Chemother. 2013, 57, 2310–2318. [Google Scholar] [CrossRef] [Green Version]
- Pier, G.B. Pseudomonas aeruginosa Lipopolysaccharide: A Major Virulence Factor, Initiator of Inflammation and Target for Effective Immunity. Int. J. Med. Microbiol. 2007, 297, 277–295. [Google Scholar] [CrossRef] [Green Version]
- McIsaac, S.M.; Stadnyk, A.W.; Lin, T.-J. Toll-like Receptors in the Host Defense against Pseudomonas aeruginosa Respiratory Infection and Cystic Fibrosis. J. Leukoc. Biol. 2012, 92, 977–985. [Google Scholar] [CrossRef] [PubMed]
- Lin, C.K.; Kazmierczak, B.I. Inflammation: A Double-Edged Sword in the Response to Pseudomonas aeruginosa Infection. J. Innate Immun. 2017, 9, 250–261. [Google Scholar] [CrossRef] [PubMed]
- Kolbe, U.; Yi, B.; Poth, T.; Saunders, A.; Boutin, S.; Dalpke, A.H. Early Cytokine Induction Upon Pseudomonas aeruginosa Infection in Murine Precision Cut Lung Slices Depends on Sensing of Bacterial Viability. Front. Immunol. 2020, 11, e598636. [Google Scholar] [CrossRef]
- Mittal, M.; Siddiqui, M.R.; Tran, K.; Reddy, S.P.; Malik, A.B. Reactive Oxygen Species in Inflammation and Tissue Injury. Antioxidants Redox Signal. 2014, 20, 1126–1167. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Canton, M.; Sánchez-Rodríguez, R.; Spera, I.; Venegas, F.C.; Favia, M.; Viola, A.; Castegna, A. Reactive Oxygen Species in Macrophages: Sources and Targets. Front. Immunol. 2021, 12, e734229. [Google Scholar] [CrossRef] [PubMed]
- Herb, M.; Schramm, M. Functions of Ros in Macrophages and Antimicrobial Immunity. Antioxidants 2021, 10, 313. [Google Scholar] [CrossRef]
- Murata, T.; Shimada, M.; Sakakibara, S.; Yoshino, T.; Masuda, T.; Shintani, T.; Sato, H.; Koriyama, Y.; Fukushima, K.; Nunami, N.; et al. Synthesis and Structure-Activity Relationships of Novel IKK-β Inhibitors. Part 3: Orally Active Anti-Inflammatory Agents. Bioorganic Med. Chem. Lett. 2004, 14, 4019–4022. [Google Scholar] [CrossRef]
- Sanda, T.; Iida, S.; Ogura, H.; Asamitsu, K.; Murata, T.; Bacon, K.B.; Ueda, R.; Okamoto, T. Growth Inhibition of Multiple Myeloma Cells by a Novel IκB Kinase Inhibitor. Clin. Cancer Res. 2005, 11, 1974–1982. [Google Scholar] [CrossRef] [Green Version]
- Micalizzi, G.; Ragosta, E.; Farnetti, S.; Dugo, P.; Tranchida, P.Q.; Mondello, L.; Rigano, F. Rapid and Miniaturized Qualitative and Quantitative Gas Chromatography Profiling of Human Blood Total Fatty Acids. Anal. Bioanal. Chem. 2020, 412, 2327–2337. [Google Scholar] [CrossRef]
- Warnke, P.H.; Becker, S.T.; Podschun, R.; Sivananthan, S.; Springer, I.N.; Russo, P.A.J.; Wiltfang, J.; Fickenscher, H.; Sherry, E. The Battle against Multi-Resistant Strains: Renaissance of Antimicrobial Essential Oils as a Promising Force to Fight Hospital-Acquired Infections. J. Cranio-Maxillofac. Surg. 2009, 37, 392–397. [Google Scholar] [CrossRef]
- Iseppi, R.; Mariani, M.; Condò, C.; Sabia, C.; Messi, P. Essential Oils: A Natural Weapon against Antibiotic-Resistant Bacteria Responsible for Nosocomial Infections. Antibiotics 2021, 10, 417. [Google Scholar] [CrossRef] [PubMed]
- Horváth, G.; Ács, K. Essential Oils in the Treatment of Respiratory Tract Diseases Highlighting Their Role in Bacterial Infections and Their Anti-Inflammatory Action: A Review. Flavour Fragr. J. 2015, 30, 331–341. [Google Scholar] [CrossRef] [PubMed]
- Sharifi-Rad, M.; Varoni, E.M.; Iriti, M.; Martorell, M.; Setzer, W.N.; del Mar Contreras, M.; Salehi, B.; Soltani-Nejad, A.; Rajabi, S.; Tajbakhsh, M.; et al. Carvacrol and Human Health: A Comprehensive Review. Phyther. Res. 2018, 32, 1675–1687. [Google Scholar] [CrossRef] [PubMed]
- Marchese, A.; Arciola, C.R.; Coppo, E.; Barbieri, R.; Barreca, D.; Chebaibi, S.; Sobarzo-Sánchez, E.; Nabavi, S.F.; Nabavi, S.M.; Daglia, M. The Natural Plant Compound Carvacrol as an Antimicrobial and Anti-Biofilm Agent: Mechanisms, Synergies and Bio-Inspired Anti-Infective Materials. Biofouling 2018, 34, 630–656. [Google Scholar] [CrossRef] [PubMed]
- Balahbib, A.; El Omari, N.; Hachlafi, N.E.; Lakhdar, F.; El Menyiy, N.; Salhi, N.; Mrabti, H.N.; Bakrim, S.; Zengin, G.; Bouyahya, A. Health Beneficial and Pharmacological Properties of P-Cymene. Food Chem. Toxicol. 2021, 153, 112259. [Google Scholar] [CrossRef]
- Sousa, L.G.V.; Castro, J.; Cavaleiro, C.; Salgueiro, L.; Tomás, M.; Palmeira-Oliveira, R.; Martinez-Oliveira, J.; Cerca, N. Synergistic Effects of Carvacrol, α-Terpinene, γ-Terpinene, ρ-Cymene and Linalool against Gardnerella Species. Sci. Rep. 2022, 12, 4417. [Google Scholar] [CrossRef]
- El-Zayat, S.R.; Sibaii, H.; Mannaa, F.A. Toll-like Receptors Activation, Signaling, and Targeting: An Overview. Bull. Natl. Res. Cent. 2019, 43, 187. [Google Scholar] [CrossRef] [Green Version]
- Behzadi, P.; García-Perdomo, H.A.; Karpiński, T.M. Toll-Like Receptors: General Molecular and Structural Biology. J. Immunol. Res. 2021, 2021, 9914854. [Google Scholar] [CrossRef]
- Pérez-Rosés, R.; Risco, E.; Vila, R.; Peñalver, P.; Cañigueral, S. Biological and Nonbiological Antioxidant Activity of Some Essential Oils. J. Agric. Food Chem. 2016, 64, 4716–4724. [Google Scholar] [CrossRef]
- Llana-Ruiz-Cabello, M.; Gutiérrez-Praena, D.; Puerto, M.; Pichardo, S.; Jos, Á.; Cameán, A.M. In Vitro Pro-Oxidant/Antioxidant Role of Carvacrol, Thymol and Their Mixture in the Intestinal Caco-2 Cell Line. Toxicol. In Vitro 2015, 29, 647–656. [Google Scholar] [CrossRef]
- Nagoor Meeran, M.F.; Javed, H.; Al Taee, H.; Azimullah, S.; Ojha, S.K. Pharmacological Properties and Molecular Mechanisms of Thymol: Prospects for Its Therapeutic Potential and Pharmaceutical Development. Front. Pharmacol. 2017, 8, e00380. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, S.; Wang, X.; Wang, Y.; Leng, Q.; Sun, Y.; Hoffman, R.M.; Jin, H. The Anti-Oxidant Monoterpene p-Cymene Reduced the Occurrence of Colorectal Cancer in a Hyperlipidemia Rat Model by Reducing Oxidative Stress and Expression of Inflammatory Cytokines. Anticancer Res. 2021, 41, 1213–1218. [Google Scholar] [CrossRef] [PubMed]
- Ferreira, O.O.; Franco, C.D.J.P.; Varela, E.L.P.; Silva, S.G.; Cascaes, M.M.; Percário, S.; de Oliveira, M.S.; Andrade, E.H.D.A. Chemical Composition and Antioxidant Activity of Essential Oils from Leaves of Two Specimens of Eugenia Florida Dc. Molecules 2021, 26, 5848. [Google Scholar] [CrossRef] [PubMed]
- Gunaseelan, S.; Balupillai, A.; Govindasamy, K.; Ramasamy, K.; Muthusamy, G.; Shanmugam, M.; Thangaiyan, R.; Robert, B.M.; Nagarajan, R.P.; Ponniresan, V.K.; et al. Linalool Prevents Oxidative Stress Activated Protein Kinases in Single UVB-Exposed Human Skin Cells. PLoS ONE 2017, 12, e0176699. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Guo, Y.; Baschieri, A.; Amorati, R.; Valgimigli, L. Synergic Antioxidant Activity of γ-Terpinene with Phenols and Polyphenols Enabled by Hydroperoxyl Radicals. Food Chem. 2021, 345, 128468. [Google Scholar] [CrossRef]
- Khaleel, C.; Tabanca, N.; Buchbauer, G. α-Terpineol, a Natural Monoterpene: A Review of Its Biological Properties. Open Chem. 2018, 16, 349–361. [Google Scholar] [CrossRef]
- Surendran, S.; Qassadi, F.; Surendran, G.; Lilley, D.; Heinrich, M. Myrcene—What Are the Potential Health Benefits of This Flavouring and Aroma Agent? Front. Nutr. 2021, 8, e699666. [Google Scholar] [CrossRef]
- Guesmi, F.; Khantouche, L.; Mehrez, A.; Bellamine, H.; Landoulsi, A. Histopathological and Biochemical Effects of Thyme Essential Oil on H2O2 Stress in Heart Tissues. Hear. Lung Circ. 2020, 29, 308–314. [Google Scholar] [CrossRef]
- Deng, Q.; Wang, Y.; Zhang, Y.; Li, M.; Li, D.; Huang, X.; Wu, Y.; Pu, J.; Wu, M. Pseudomonas aeruginosa Triggers Macrophage Autophagy to Escape Intracellular Killing by Activation of the NLRP3 Inflammasome. Infect. Immun. 2015, 84, 56–66. [Google Scholar] [CrossRef] [Green Version]
- Parameswaran, N.; Patial, S. Tumor Necrosis Factor-a Signaling in Macrophages. Crit. Rev. Eukaryot. Gene Expr. 2010, 20, 87–103. [Google Scholar] [CrossRef]
- Rodrigues, V.; Cabral, C.; Évora, L.; Ferreira, I.; Cavaleiro, C.; Cruz, M.T.; Salgueiro, L. Chemical Composition, Anti-Inflammatory Activity and Cytotoxicity of Thymus zygis L. Subsp. Sylvestris (Hoffmanns. & Link) Cout. Essential Oil and Its Main Compounds. Arab. J. Chem. 2019, 12, 3236–3243. [Google Scholar] [CrossRef] [Green Version]
- Nagoor Meeran, M.F.; Jagadeesh, G.S.; Selvaraj, P. Thymol Attenuates Inflammation in Isoproterenol Induced Myocardial Infarcted Rats by Inhibiting the Release of Lysosomal Enzymes and Downregulating the Expressions of Proinflammatory Cytokines. Eur. J. Pharmacol. 2015, 754, 153–161. [Google Scholar] [CrossRef] [PubMed]
- Gholijani, N.; Gharagozloo, M.; Farjadian, S.; Amirghofran, Z. Modulatory Effects of Thymol and Carvacrol on Inflammatory Transcription Factors in Lipopolysaccharide-Treated Macrophages. J. Immunotoxicol. 2016, 13, 157–164. [Google Scholar] [CrossRef] [PubMed]
- Zhong, W.; Chi, G.; Jiang, L.; Soromou, L.W.; Chen, N.; Huo, M.; Guo, W.; Deng, X.; Feng, H. P-Cymene Modulates in Vitro and in Vivo Cytokine Production by Inhibiting MAPK and NF-ΚB Activation. Inflammation 2013, 36, 529–537. [Google Scholar] [CrossRef]
- Islam, A.U.S.; Hellman, B.; Nyberg, F.; Amir, N.; Jayaraj, R.L.; Petroainu, G.; Adem, A. Myrcene Attenuates Renal Inflammation and Oxidative Stress in the Adrenalectomized Rat Model. Molecules 2020, 25, 4492. [Google Scholar] [CrossRef]
- Anastasiou, C.; Buchbauer, G. Essential Oils as Immunomodulators: Some Examples. Open Chem. 2017, 15, 352–370. [Google Scholar] [CrossRef]
- Ramalho, T.R.D.O.; Pacheco De Oliveira, M.T.; Lima, A.L.D.A.; Bezerra-Santos, C.R.; Piuvezam, M.R. Gamma-Terpinene Modulates Acute Inflammatory Response in Mice. Planta Med. 2015, 81, 1248–1254. [Google Scholar] [CrossRef] [Green Version]
- Da Silveira E Sá, R.D.C.; Andrade, L.N.; De Sousa, D.P. Sesquiterpenes from Essential Oils and Anti-Inflammatory Activity. Nat. Prod. Commun. 2015, 10, 1767–1774. [Google Scholar] [CrossRef] [Green Version]
- Pope, R.M.; Leutz, A.; Ness, S.A. C/EBPβ Regulation of the Tumor Necrosis Factor α Gene. J. Clin. Investig. 1994, 94, 1449–1455. [Google Scholar] [CrossRef] [Green Version]
- Greten, F.R.; Arkan, M.C.; Bollrath, J.; Hsu, L.C.; Goode, J.; Miething, C.; Göktuna, S.I.; Neuenhahn, M.; Fierer, J.; Paxian, S.; et al. NF-ΚB Is a Negative Regulator of IL-1β Secretion as Revealed by Genetic and Pharmacological Inhibition of IKKβ. Cell 2007, 130, 918–931. [Google Scholar] [CrossRef] [Green Version]
- Franchi, L.; Stoolman, J.; Kanneganti, T.D.; Verma, A.; Ramphal, R.; Núñez, G. Critical Role for Ipaf in Pseudomonas aeruginosa-Induced Caspase-1 Activation. Eur. J. Immunol. 2007, 37, 3030–3039. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Primer | Gene Accession Number | Sequence 5′ → 3′ |
---|---|---|
IL-6 forward | NM_000600.5 | CTGAGAAAGGAGACATGTAACAAG |
IL-6 reverse | GGCAAGTCTCCTCATTGAATC | |
IL-8 forward | NM_000584.4 | CAGTGCATAAAGACATACTCC |
IL-8 reverse | CACTCTCAATCACTCTCAGT | |
IL-1β forward | NM_000576.3 | GAAATGATGGCTTATTACAGTGG |
IL-1β reverse | GGTGGTCGGAGATTCGTA | |
TNFα forward | NM_000594.4 | CTCTCTCTAATCAGCCCTCT |
TNFα reverse | CTTGAGGGTTTGCTACAACA | |
β-actin forward | NM_007393.5 | AGAAAATCTGGCACCACACC |
β-actin reverse | GGGGTGTTGAAGGTGTCAAA |
Percentage of Compound in the Thyme Essential Oils a | Relative Concentration of Compound in the Experiments (ng/mL) b | ||||||
---|---|---|---|---|---|---|---|
Compounds | MS Sim | LRI Exp | LRI Ref | Beginning of Flowering | End of Flowering | Beginning of Flowering | End of Flowering |
Tricyclene | 94 | 922 | 923 | 0.02 | 0.02 | 0.34 | 0.34 |
α-Thujene | 98 | 925 | 927 | 0.99 | 0.99 | 18.51 | 18.51 |
α-Pinene | 97 | 933 | 933 | 0.61 | 0.69 | 10.72 | 12.13 |
Camphene | 97 | 949 | 953 | 0.39 | 0.50 | 7.02 | 9.00 |
Sabinene | 95 | 972 | 972 | 0.02 | 0.01 | 0.36 | 0.18 |
Pent-4-enyl propanoate | 94 | 974 | 974 | 0.03 | 0.01 | 0.50 | 0.17 |
β-Pinene | 92 | 977 | 978 | 0.20 | 0.21 | 3.49 | 3.62 |
Vinyl amyl carbinol | 95 | 979 | 978 | 0.27 | 0.42 | 4.52 | 7.03 |
Octan-3-one | 93 | 984 | 986 | 0.03 | 0.03 | 0.48 | 0.48 |
Myrcene | 96 | 988 | 991 | 1.45 | 1.28 | 23.20 | 20.48 |
Octan-3-ol | 96 | 997 | 999 | 0.04 | 0.03 | 0.65 | 0.49 |
α-Phellandrene | 96 | 1006 | 1007 | 0.15 | 0.10 | 2.53 | 1.69 |
δ-3-Carene | 96 | 1009 | 1009 | 0.08 | 0.08 | 1.38 | 1.38 |
α-Terpinene | 98 | 1017 | 1018 | 1.40 | 0.82 | 22.40 | 13.12 |
p-Cymene | 96 | 1025 | 1025 | 12.89 | 20.64 | 221.71 | 355.01 |
Limonene | 96 | 1029 | 1030 | 0.29 | 0.34 | 4.88 | 5.73 |
β-Phellandrene | 94 | 1030 | 1031 | 0.07 | 0.08 | 1.15 | 1.31 |
Eucalyptol | 97 | 1032 | 1032 | 0.62 | 0.75 | 11.42 | 13.82 |
(Z)-, β-Ocimene | 90 | 1034 | 1035 | 0.01 | 0.01 | 0.16 | 0.16 |
(E)-, β-Ocimene | 95 | 1045 | 1046 | 0.03 | 0.02 | 0.48 | 0.32 |
γ-Terpinene | 95 | 1058 | 1058 | 15.18 | 6.01 | 24.29 | 9.62 |
3-Methylbut-2-enyl butanoate | 90 | 1063 | 1068 | 0.06 | 0.06 | 1.00 | 1.00 |
(Z)-Sabinene hydrate | 93 | 1070 | 1069 | 0.26 | 0.59 | 4.21 | 9.56 |
Terpinolene | 96 | 1086 | 1086 | 0.09 | 0.08 | 1.62 | 1.44 |
p-Cymenene | 94 | 1091 | 1093 | 0.01 | 0.02 | 0.17 | 0.35 |
Linalool | 97 | 1099 | 1101 | 1.46 | 2.15 | 2.54 | 3.74 |
(E)-Sabinene hydrate | 94 | 1102 | 1099 | 0.11 | 0.18 | 2.27 | 3.50 |
3-Methylbut-3-enyl 3-methylbutanoate | 90 | 1110 | 1114 | tr | 0.02 | 0.00 | 0.36 |
(Z)-, p-Menth-2-en-1-ol | 96 | 1126 | 1124 | 0.03 | 0.03 | 0.50 | 0.50 |
Camphor | 97 | 1149 | 1149 | 0.27 | 0.36 | 5.40 | 7.20 |
Borneol | 98 | 1173 | 1173 | 0.48 | 0.66 | 9.70 | 13.74 |
Terpinen-4-ol | 92 | 1182 | 1184 | 0.66 | 0.63 | 12.32 | 11.76 |
Hex-(3Z)-enyl-Butyrate | 92 | 1184 | 1187 | 0.01 | 0.03 | 0.18 | 0.54 |
p-Cymen-8-ol | 93 | 1189 | 1189 | 0.02 | 0.05 | 0.40 | 1.00 |
α-Terpineol | 97 | 1197 | 1195 | 0.12 | 0.15 | 2.26 | 2.82 |
(Z)-, Dihydro-carvone | 94 | 1200 | 1198 | 0.03 | 0.05 | 0.56 | 0.93 |
n-Decanal | 95 | 1206 | 1208 | 0.01 | 0.01 | 0.17 | 0.17 |
Thymol methyl ether | 94 | 1230 | 1229 | 0.19 | 0.62 | 3.50 | 11.41 |
Carvacryl methyl ether | 96 | 1239 | 1239 | 0.27 | 0.37 | 5.05 | 6.93 |
Neral | 96 | 1242 | 1238 | 0.01 | 0.01 | 0.17 | 0.17 |
Carvone | 95 | 1249 | 1246 | 0.01 | 0.02 | 0.18 | 0.36 |
Geranial | 97 | 1274 | 1268 | 0.02 | 0.02 | 0.34 | 0.34 |
Thymol | 94 | 1294 | 1293 | 55.81 | 54.21 | 1071.55 | 1040.83 |
Carvacrol | 94 | 1302 | 1300 | 2.30 | 2.90 | 44.94 | 56.67 |
Thymol acetate | 93 | 1345 | 1348 | 0.04 | nd | 0.80 | 0.00 |
Eugenol | 95 | 1354 | 1357 | 0.05 | 0.12 | 1.06 | 2.54 |
Isobornyl propionate * | 93 | 1376 | 1377 | 0.04 | 0.06 | 0.80 | 1.20 |
α-Copaene * | 88 | 1377 | 1375 | ||||
β-Bourbonene | 95 | 1385 | 1382 | 0.02 | 0.03 | 0.36 | 0.54 |
(Z)-Jasmone | 93 | 1394 | 1394 | nd | 0.01 | 0.00 | 0.19 |
(E)-Caryophyllene | 97 | 1421 | 1424 | 1.56 | 1.92 | 28.08 | 34.56 |
β-Copaene | 94 | 1431 | 1433 | 0.02 | 0.03 | 0.38 | 0.56 |
α-Humulene | 97 | 1457 | 1454 | 0.05 | 0.06 | 0.85 | 1.02 |
(Z)-Muurola-4(14),5-diene | 94 | 1464 | 1466 | tr | 0.01 | 0.00 | 0.18 |
Geranyl propanoate | 97 | 1468 | 1471 | 0.09 | 0.05 | 1.62 | 0.90 |
γ-Muurolene | 92 | 1476 | 1478 | 0.05 | 0.06 | 0.90 | 1.08 |
α-Amorphene | 90 | 1481 | 1482 | nd | 0.01 | 0.00 | 0.18 |
Germacrene D | 95 | 1482 | 1480 | 0.11 | 0.04 | 1.87 | 0.68 |
β-Selinene | 94 | 1491 | 1492 | tr | 0.01 | 0.00 | 0.18 |
γ-Amorphene | 87 | 1494 | 1490 | 0.02 | 0.02 | 0.36 | 0.36 |
α-Selinene | 89 | 1497 | 1501 | 0.01 | 0.01 | 0.18 | 0.18 |
α-Muurolene | 93 | 1500 | 1497 | 0.03 | 0.03 | 0.53 | 0.53 |
γ-Cadinene | 95 | 1515 | 1512 | 0.06 | 0.10 | 1.08 | 1.80 |
δ-Cadinene | 94 | 1520 | 1518 | 0.11 | 0.11 | 1.98 | 1.98 |
(E)-Calamenene | 90 | 1522 | 1527 | 0.02 | 0.03 | 0.40 | 0.60 |
(E)-Cadina-1,4-diene | 93 | 1534 | 1536 | 0.01 | 0.01 | 0.18 | 0.18 |
α-Cadinene | 95 | 1539 | 1538 | 0.01 | 0.01 | 0.18 | 0.18 |
Geranyl butyrate | 97 | 1554 | 1559 | 0.02 | 0.02 | 0.36 | 0.36 |
Caryophyllene oxide | 93 | 1585 | 1587 | 0.27 | 0.47 | 5.40 | 9.40 |
Humulene epoxide II | 89 | 1613 | 1613 | tr | 0.01 | 0.00 | 0.19 |
(Z)-Cubenol | 89 | 1618 | 1614 | 0.01 | 0.02 | 0.19 | 0.38 |
epi-γ-Eudesmol | 95 | 1626 | 1624 | 0.05 | 0.03 | 0.90 | 0.54 |
α-Cadinol | 94 | 1645 | 1641 | 0.06 | 0.12 | 1.29 | 2.58 |
Cadin-4-en-10-ol | 95 | 1658 | 1659 | 0.04 | 0.02 | 0.73 | 0.37 |
Total | 99.77 | 99.65 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pandur, E.; Micalizzi, G.; Mondello, L.; Horváth, A.; Sipos, K.; Horváth, G. Antioxidant and Anti-Inflammatory Effects of Thyme (Thymus vulgaris L.) Essential Oils Prepared at Different Plant Phenophases on Pseudomonas aeruginosa LPS-Activated THP-1 Macrophages. Antioxidants 2022, 11, 1330. https://doi.org/10.3390/antiox11071330
Pandur E, Micalizzi G, Mondello L, Horváth A, Sipos K, Horváth G. Antioxidant and Anti-Inflammatory Effects of Thyme (Thymus vulgaris L.) Essential Oils Prepared at Different Plant Phenophases on Pseudomonas aeruginosa LPS-Activated THP-1 Macrophages. Antioxidants. 2022; 11(7):1330. https://doi.org/10.3390/antiox11071330
Chicago/Turabian StylePandur, Edina, Giuseppe Micalizzi, Luigi Mondello, Adrienn Horváth, Katalin Sipos, and Györgyi Horváth. 2022. "Antioxidant and Anti-Inflammatory Effects of Thyme (Thymus vulgaris L.) Essential Oils Prepared at Different Plant Phenophases on Pseudomonas aeruginosa LPS-Activated THP-1 Macrophages" Antioxidants 11, no. 7: 1330. https://doi.org/10.3390/antiox11071330