Sulodexide Prevents Hyperglycemia-Induced Endothelial Dysfunction and Oxidative Stress in Porcine Retinal Arterioles
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Functional Studies in Retinal Arterioles
2.3. Detection of ROS in Retinal Arterioles
2.4. HPLC-Based Assays to Assess the Antioxidant Properties of Sulodexide
2.5. Quantitative PCR Analysis (qPCR)
2.6. Immunostainings
2.7. Statistical Analysis
3. Results
3.1. Responses of Retinal Arterioles
3.2. Levels of Reactive Oxygen Species
3.3. Sulodexide as an ROS or RNS Scavenger
3.4. Messenger-RNA Expression Levels in Isolated Retinal Arterioles
3.5. Expression of NOX Isoforms
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ding, J.; Wong, T.Y. Current epidemiology of diabetic retinopathy and diabetic macular edema. Curr. Diabetes Rep. 2012, 12, 346–354. [Google Scholar] [CrossRef]
- Eshaq, R.S.; Aldalati, A.M.Z.; Alexander, J.S.; Harris, N.R. Diabetic retinopathy: Breaking the barrier. Pathophysiol. Off. J. Int. Soc. Pathophysiol. 2017, 24, 229–241. [Google Scholar] [CrossRef]
- Klaassen, I.; Van Noorden, C.J.; Schlingemann, R.O. Molecular basis of the inner blood-retinal barrier and its breakdown in diabetic macular edema and other pathological conditions. Prog. Retin. Eye Res. 2013, 34, 19–48. [Google Scholar] [CrossRef] [PubMed]
- Gardiner, T.A.; Archer, D.B.; Curtis, T.M.; Stitt, A.W. Arteriolar involvement in the microvascular lesions of diabetic retinopathy: Implications for pathogenesis. Microcirculation 2007, 14, 25–38. [Google Scholar] [CrossRef] [PubMed]
- Tarr, J.M.; Kaul, K.; Chopra, M.; Kohner, E.M.; Chibber, R. Pathophysiology of diabetic retinopathy. ISRN Ophthalmol. 2013, 2013, 343560. [Google Scholar] [CrossRef]
- Gericke, A.; Suminska-Jasińska, K.; Bręborowicz, A. Sulodexide reduces glucose induced senescence in human retinal endothelial cells. Sci. Rep. 2021, 11, 11532. [Google Scholar] [CrossRef] [PubMed]
- Sies, H. Oxidative stress: A concept in redox biology and medicine. Redox Biol. 2015, 4, 180–183. [Google Scholar] [CrossRef]
- Azzi, A.; Davies, K.J.A.; Kelly, F. Free radical biology—Terminology and critical thinking. FEBS Lett. 2004, 558, 3–6. [Google Scholar] [CrossRef]
- Daiber, A.; Steven, S.; Vujacic-Mirski, K.; Kalinovic, S.; Oelze, M.; Di Lisa, F.; Münzel, T. Regulation of Vascular Function and Inflammation via Cross Talk of Reactive Oxygen and Nitrogen Species from Mitochondria or NADPH Oxidase-Implications for Diabetes Progression. Int. J. Mol. Sci. 2020, 21, 3405. [Google Scholar] [CrossRef]
- Guzman, L.; Balada, C.; Flores, G.; Alvarez, R.; Knox, M.; Vinet, R.; Martinez, J.L. t-Resveratrol Protects against Acute High Glucose Damage in Endothelial Cells. Plant Foods Hum. Nutr. 2018, 73, 235–240. [Google Scholar] [CrossRef]
- Sorescu, D.; Weiss, D.; Lassègue, B.; Clempus, R.E.; Szöcs, K.; Sorescu, G.P.; Valppu, L.; Quinn, M.T.; Lambeth, J.D.; Vega, J.D.; et al. Superoxide production and expression of nox family proteins in human atherosclerosis. Circulation 2002, 105, 1429–1435. [Google Scholar] [CrossRef] [PubMed]
- Radi, R. Oxygen radicals, nitric oxide, and peroxynitrite: Redox pathways in molecular medicine. Proc. Natl. Acad. Sci. USA 2018, 115, 5839–5848. [Google Scholar] [CrossRef] [PubMed]
- Brown, O.I.; Bridge, K.I.; Kearney, M.T. Nicotinamide Adenine Dinucleotide Phosphate Oxidases in Glucose Homeostasis and Diabetes-Related Endothelial Cell Dysfunction. Cells 2021, 10, 2315. [Google Scholar] [CrossRef]
- Cheung, N.; Mitchell, P.; Wong, T.Y. Diabetic retinopathy. Lancet 2010, 376, 124–136. [Google Scholar] [CrossRef]
- Lauver, D.A.; Booth, E.A.; White, A.J.; Poradosu, E.; Lucchesi, B.R. Sulodexide attenuates myocardial ischemia/reperfusion injury and the deposition of C-reactive protein in areas of infarction without affecting hemostasis. J. Pharmacol. Exp. Ther. 2005, 312, 794–800. [Google Scholar] [CrossRef]
- Yin, J.; Chen, W.; Ma, F.; Lu, Z.; Wu, R.; Zhang, G.; Wang, N.; Wang, F. Sulodexide pretreatment attenuates renal ischemia-reperfusion injury in rats. Oncotarget 2017, 8, 9986–9995. [Google Scholar] [CrossRef]
- Carroll, B.J.; Piazza, G.; Goldhaber, S.Z. Sulodexide in venous disease. J. Thromb. Haemost. 2019, 17, 31–38. [Google Scholar] [CrossRef] [PubMed]
- Weiss, R.; Niecestro, R.; Raz, I. The role of sulodexide in the treatment of diabetic nephropathy. Drugs 2007, 67, 2681–2696. [Google Scholar] [CrossRef]
- Suminska-Jasinska, K.; Polubinska, A.; Ciszewicz, M.; Mikstacki, A.; Antoniewicz, A.; Breborowicz, A. Sulodexide reduces senescence-related changes in human endothelial cells. Med. Sci. Monit. Int. Med. J. Exp. Clin. Res. 2011, 17, Cr222-6. [Google Scholar] [CrossRef]
- Sosinska-Zawierucha, P.; Mackowiak, B.; Staniszewski, R.; Suminska-Jasinska, K.; Maj, M.; Krasinski, Z.; Breborowicz, A. Sulodexide Slows Down the Senescence of Aortic Endothelial Cells Exposed to Serum from Patients with Peripheral Artery Diseases. Cell. Physiol. Biochem. Int. J. Exp. Cell. Physiol. Biochem. Pharmacol. 2018, 45, 2225–2232. [Google Scholar] [CrossRef]
- Giurdanella, G.; Lazzara, F.; Caporarello, N.; Lupo, G.; Anfuso, C.D.; Eandi, C.M.; Leggio, G.M.; Drago, F.; Bucolo, C.; Salomone, S. Sulodexide prevents activation of the PLA2/COX-2/VEGF inflammatory pathway in human retinal endothelial cells by blocking the effect of AGE/RAGE. Biochem. Pharmacol. 2017, 142, 145–154. [Google Scholar] [CrossRef] [PubMed]
- Broekhuizen, L.N.; Lemkes, B.A.; Mooij, H.L.; Meuwese, M.C.; Verberne, H.; Holleman, F.; Schlingemann, R.O.; Nieuwdorp, M.; Stroes, E.S.; Vink, H. Effect of sulodexide on endothelial glycocalyx and vascular permeability in patients with type 2 diabetes mellitus. Diabetologia 2010, 53, 2646–2655. [Google Scholar] [CrossRef] [PubMed]
- Jo, H.; Jung, S.H.; Kang, J.; Yim, H.B.; Kang, K.D. Sulodexide inhibits retinal neovascularization in a mouse model of oxygen-induced retinopathy. BMB Rep. 2014, 47, 637–642. [Google Scholar] [CrossRef] [PubMed]
- Zadeh, J.K.; Ruemmler, R.; Hartmann, E.K.; Ziebart, A.; Ludwig, M.; Patzak, A.; Xia, N.; Li, H.; Pfeiffer, N.; Gericke, A. Responses of retinal arterioles and ciliary arteries in pigs with acute respiratory distress syndrome (ARDS). Exp. Eye Res. 2019, 184, 152–161. [Google Scholar] [CrossRef] [PubMed]
- Gericke, A.; Goloborodko, E.; Sniatecki, J.J.; Steege, A.; Wojnowski, L.; Pfeiffer, N. Contribution of nitric oxide synthase isoforms to cholinergic vasodilation in murine retinal arterioles. Exp. Eye Res. 2013, 109, 60–66. [Google Scholar] [CrossRef]
- Birk, M.; Baum, E.; Zadeh, J.K.; Manicam, C.; Pfeiffer, N.; Patzak, A.; Helmstädter, J.; Steven, S.; Kuntic, M.; Daiber, A.; et al. Angiotensin II Induces Oxidative Stress and Endothelial Dysfunction in Mouse Ophthalmic Arteries via Involvement of AT1 Receptors and NOX2. Antioxidants 2021, 10, 1238. [Google Scholar] [CrossRef]
- Kalinovic, S.; Stamm, P.; Oelze, M.; Steven, S.; Kröller-Schön, S.; Kvandova, M.; Zielonka, J.; Münzel, T.; Daiber, A. Detection of extracellular superoxide in isolated human immune cells and in an animal model of arterial hypertension using hydropropidine probe and HPLC analysis. Free Radic. Biol. Med. 2021, 168, 214–225. [Google Scholar] [CrossRef] [PubMed]
- Vujacic-Mirski, K.; Bruns, K.; Kalinovic, S.; Oelze, M.; Kröller-Schön, S.; Steven, S.; Mojovic, M.; Korac, B.; Münzel, T.; Daiber, A. Development of an Analytical Assay for Electrochemical Detection and Quantification of Protein-Bound 3-Nitrotyrosine in Biological Samples and Comparison with Classical, Antibody-Based Methods. Antioxidants 2020, 9, 388. [Google Scholar] [CrossRef]
- Daiber, A.; Oelze, M.; Coldewey, M.; Kaiser, K.; Huth, C.; Schildknecht, S.; Bachschmid, M.; Nazirisadeh, Y.; Ullrich, V.; Mülsch, A.; et al. Hydralazine is a powerful inhibitor of peroxynitrite formation as a possible explanation for its beneficial effects on prognosis in patients with congestive heart failure. Biochem. Biophys. Res. Commun. 2005, 338, 1865–1874. [Google Scholar] [CrossRef]
- Daiber, A.; Zou, M.H.; Bachschmid, M.; Ullrich, V. Ebselen as a peroxynitrite scavenger in vitro and ex vivo. Biochem. Pharm. 2000, 59, 153–160. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Hein, T.W.; Xu, W.; Xu, X.; Kuo, L. Acute and Chronic Hyperglycemia Elicit JIP1/JNK-Mediated Endothelial Vasodilator Dysfunction of Retinal Arterioles. Investig. Ophthalmol. Vis. Sci. 2016, 57, 4333–4340. [Google Scholar] [CrossRef]
- Guduric-Fuchs, J.; Ringland, L.J.; Gu, P.; Dellett, M.; Archer, D.B.; Cogliati, T. Immunohistochemical study of pig retinal development. Mol. Vis. 2009, 15, 1915–1928. [Google Scholar]
- Sanchez, I.; Martin, R.; Ussa, F.; Fernandez-Bueno, I. The parameters of the porcine eyeball. Graefe’s Arch. Clin. Exp. Ophthalmol. 2011, 249, 475–482. [Google Scholar] [CrossRef]
- Nakazawa, T.; Kaneko, Y.; Mori, A.; Saito, M.; Sakamoto, K.; Nakahara, T.; Ishii, K. Attenuation of nitric oxide- and prostaglandin-independent vasodilation of retinal arterioles induced by acetylcholine in streptozotocin-treated rats. Vasc. Pharmacol. 2007, 46, 153–159. [Google Scholar] [CrossRef] [PubMed]
- Kristova, V.; Liskova, S.; Sotnikova, R.; Vojtko, R.; Kurtansky, A. Sulodexide improves endothelial dysfunction in streptozotocin-induced diabetes in rats. Physiol. Res. 2008, 57, 491–494. [Google Scholar] [CrossRef] [PubMed]
- Gabryel, B.; Jarzabek, K.; Machnik, G.; Adamczyk, J.; Belowski, D.; Obuchowicz, E.; Urbanek, T. Superoxide dismutase 1 and glutathione peroxidase 1 are involved in the protective effect of sulodexide on vascular endothelial cells exposed to oxygen-glucose deprivation. Microvasc. Res. 2016, 103, 26–35. [Google Scholar] [CrossRef]
- Achour, A.; Kacem, M.; Dibej, K.; Skhiri, H.; Bouraoui, S.; El May, M. One year course of oral sulodexide in the management of diabetic nephropathy. J. Nephrol. 2005, 18, 568–574. [Google Scholar]
- Conklin, D.J.; Guo, Y.; Jagatheesan, G.; Kilfoil, P.J.; Haberzettl, P.; Hill, B.G.; Baba, S.P.; Guo, L.; Wetzelberger, K.; Obal, D.; et al. Genetic Deficiency of Glutathione S-Transferase P Increases Myocardial Sensitivity to Ischemia-Reperfusion Injury. Circ Res 2015, 117, 437–449. [Google Scholar] [CrossRef] [PubMed]
- Coccheri, S.; Mannello, F. Development and use of sulodexide in vascular diseases: Implications for treatment. Drug Des. Dev. Ther. 2013, 8, 49–65. [Google Scholar] [CrossRef]
- Gambaro, G.; Kinalska, I.; Oksa, A.; Pont’uch, P.; Hertlová, M.; Olsovsky, J.; Manitius, J.; Fedele, D.; Czekalski, S.; Perusicová, J.; et al. Oral sulodexide reduces albuminuria in microalbuminuric and macroalbuminuric type 1 and type 2 diabetic patients: The Di.N.A.S. randomized trial. J. Am. Soc. Nephrol. 2002, 13, 1615–1625. [Google Scholar] [CrossRef] [PubMed]
- Heerspink, H.L.; Greene, T.; Lewis, J.B.; Raz, I.; Rohde, R.D.; Hunsicker, L.G.; Schwartz, S.L.; Aronoff, S.; Katz, M.A.; Eisner, G.M.; et al. Effects of sulodexide in patients with type 2 diabetes and persistent albuminuria. Nephrol. Dial. Transpl. 2008, 23, 1946–1954. [Google Scholar] [CrossRef] [PubMed]
- Ciszewicz, M.; Polubinska, A.; Antoniewicz, A.; Suminska-Jasinska, K.; Breborowicz, A. Sulodexide suppresses inflammation in human endothelial cells and prevents glucose cytotoxicity. Transl. Res. J. Lab. Clin. Med. 2009, 153, 118–123. [Google Scholar] [CrossRef]
- Nguyen, D.D.; Luo, L.J.; Yang, C.J.; Lai, J.Y. Highly Retina-Permeating and Long-Acting Resveratrol/Metformin Nanotherapeutics for Enhanced Treatment of Macular Degeneration. ACS Nano 2023, 17, 168–183. [Google Scholar] [CrossRef]
- Zadeh, J.K.; Garcia-Bardon, A.; Hartmann, E.K.; Pfeiffer, N.; Omran, W.; Ludwig, M.; Patzak, A.; Xia, N.; Li, H.; Gericke, A. Short-Time Ocular Ischemia Induces Vascular Endothelial Dysfunction and Ganglion Cell Loss in the Pig Retina. Int. J. Mol. Sci. 2019, 20, 4685. [Google Scholar] [CrossRef] [PubMed]
- Zadeh, J.K.; Zhutdieva, M.B.; Laspas, P.; Yuksel, C.; Musayeva, A.; Pfeiffer, N.; Brochhausen, C.; Oelze, M.; Daiber, A.; Xia, N.; et al. Apolipoprotein E Deficiency Causes Endothelial Dysfunction in the Mouse Retina. Oxidative Med. Cell. Longev. 2019, 2019, 5181429. [Google Scholar] [CrossRef]
- Cui, Y.; Xu, X.; Bi, H.; Zhu, Q.; Wu, J.; Xia, X.; Qiushi, R.; Ho, P.C.P. Expression modification of uncoupling proteins and MnSOD in retinal endothelial cells and pericytes induced by high glucose: The role of reactive oxygen species in diabetic retinopathy. Exp. Eye Res. 2006, 83, 807–816. [Google Scholar] [CrossRef]
- Deliyanti, D.; Alrashdi, S.F.; Touyz, R.M.; Kennedy, C.R.; Jha, J.C.; Cooper, M.E.; Jandeleit-Dahm, K.A.; Wilkinson-Berka, J.L. Nox (NADPH Oxidase) 1, Nox4, and Nox5 Promote Vascular Permeability and Neovascularization in Retinopathy. Hypertension 2020, 75, 1091–1101. [Google Scholar] [CrossRef]
- Al-Shabrawey, M.; Rojas, M.; Sanders, T.; Behzadian, A.; El-Remessy, A.; Bartoli, M.; Parpia, A.K.; Liou, G.; Caldwell, R.B. Role of NADPH oxidase in retinal vascular inflammation. Investig. Ophthalmol. Vis. Sci. 2008, 49, 3239–3244. [Google Scholar] [CrossRef]
- Li, J.; Wang, J.J.; Yu, Q.; Chen, K.; Mahadev, K.; Zhang, S.X. Inhibition of reactive oxygen species by Lovastatin downregulates vascular endothelial growth factor expression and ameliorates blood-retinal barrier breakdown in db/db mice: Role of NADPH oxidase 4. Diabetes 2010, 59, 1528–1538. [Google Scholar] [CrossRef]
- Meng, W.; Shah, K.P.; Pollack, S.; Toppila, I.; Hebert, H.L.; McCarthy, M.I.; Groop, L.; Ahlqvist, E.; Lyssenko, V.; Agardh, E.; et al. A genome-wide association study suggests new evidence for an association of the NADPH Oxidase 4 (NOX4) gene with severe diabetic retinopathy in type 2 diabetes. Acta Ophthalmol 2018, 96, e811–e819. [Google Scholar] [CrossRef] [PubMed]
- Gorin, Y.; Block, K. Nox4 and diabetic nephropathy: With a friend like this, who needs enemies? Free Radic. Biol. Med. 2013, 61, 130–142. [Google Scholar] [CrossRef]
- Jha, J.C.; Dai, A.; Holterman, C.E.; Cooper, M.E.; Touyz, R.M.; Kennedy, C.R.; Jandeleit-Dahm, K.A.M. Endothelial or vascular smooth muscle cell-specific expression of human NOX5 exacerbates renal inflammation, fibrosis and albuminuria in the Akita mouse. Diabetologia 2019, 62, 1712–1726. [Google Scholar] [CrossRef]
- Holterman, C.E.; Boisvert, N.C.; Thibodeau, J.F.; Kamto, E.; Novakovic, M.; Abd-Elrahman, K.S.; Ferguson, S.S.G.; Kennedy, C.R.J. Podocyte NADPH Oxidase 5 Promotes Renal Inflammation Regulated by the Toll-Like Receptor Pathway. Antioxid. Redox Signal. 2019, 30, 1817–1830. [Google Scholar] [CrossRef]
- Etoh, T.; Inoguchi, T.; Kakimoto, M.; Sonoda, N.; Kobayashi, K.; Kuroda, J.; Sumimoto, H.; Nawata, H. Increased expression of NAD(P)H oxidase subunits, NOX4 and p22phox, in the kidney of streptozotocin-induced diabetic rats and its reversibity by interventive insulin treatment. Diabetologia 2003, 46, 1428–1437. [Google Scholar] [CrossRef] [PubMed]
- Fu, Y.; Zhang, Y.; Wang, Z.; Wang, L.; Wei, X.; Zhang, B.; Wen, Z.; Fang, H.; Pang, Q.; Yi, F. Regulation of NADPH oxidase activity is associated with miRNA-25-mediated NOX4 expression in experimental diabetic nephropathy. Am. J. Nephrol. 2010, 32, 581–589. [Google Scholar] [CrossRef]
- Manea, S.A.; Constantin, A.; Manda, G.; Sasson, S.; Manea, A. Regulation of Nox enzymes expression in vascular pathophysiology: Focusing on transcription factors and epigenetic mechanisms. Redox. Biol. 2015, 5, 358–366. [Google Scholar] [CrossRef]
- Rastogi, R.; Geng, X.; Li, F.; Ding, Y. NOX Activation by Subunit Interaction and Underlying Mechanisms in Disease. Front. Cell. Neurosci. 2016, 10, 301. [Google Scholar] [CrossRef]
- Liu, H.; Yu, S.; Xu, W.; Xu, J. Enhancement of 26S proteasome functionality connects oxidative stress and vascular endothelial inflammatory response in diabetes mellitus. Arterioscler. Thromb. Vasc. Biol. 2012, 32, 2131–2140. [Google Scholar] [CrossRef]






| Gene | Forward | Reverse | Accession Number | 
|---|---|---|---|
| SIRT1 | GAGAAGGAAACAATGGGCCG | ACCAAACAGAAGGTTATCTCGGT | NM_001145750.2 | 
| FOXO1 | CGGCAGGCTGGAAGAATTCAA | CTCCCTCTGGGTTGAGCATC | NM_214014.3 | 
| HIF-1α | CTCCATTGCCTGCCTCTGAA | TGGGACTGTTAGGCTCAGGT | NM_001123124.1 | 
| VEGF-A | CGAGGCAAGAAAATCCCTGT | GCGAGTCTGTGTTTTTGCAGG | NM_214084.1 | 
| NFκB | AACAACCCCTTCCAAGTTCCC | GCACGGTTGTCAAAGATGGG | NM_001114281.1 | 
| RANTES | ATGGCAGCAGTCGTCTTTATC | TGCACGAGTTCAGGCTCAAG | NM_001129946.1 | 
| IL-6 | AGACCCTGAGGCAAAAGGGAAA | TCAGGTGCCCCAGCTACAT | NM_214399.1 | 
| MCP-1 | CTTGAATCCTCATCCTCCAGCA | CTGGAGAATTAATTGCATCTGGC | NM_214214.1 | 
| NOX2 | CACTTCACGCCACGATTCAC | TTGACTCGGGCGTTCACAC | NM_214043.2 | 
| NOX4 | GTCCCAGTGTGTCTGCGTTAG | TCTCGAAATCGTTCTGTCCAGTC | XM_013979249.2 | 
| NOX5 | AAGAGTCCTTCTTTGCTGAGAGA | CAGCCAGTGAACAGCACTGA | XM_021100544.1 | 
| SOD1 | GGGCACCATCTACTTCGAGC | CTGCACTGGTACAGCCTTGT | NM_001190422.1 | 
| SOD2 | GGCCTACGTGAACAACCTGA | AATTCCCCTTTGGGTTCCCC | NM_214127.2 | 
| SOD3 | GAAGAGCTGGAAAGGTGCCC | ATCTCCGTCACTTTGGCCTG | XM_021100523.1 | 
| CAT | GCTTCAACAGTGCCAACGAA | ACTGAAGTTCTTGACCGCTTTC | XM_021081498.1 | 
| GPX1 | AGTTTGGACATCAGGAAAATGCC | AGCATGAAGTTGGGCTCGAA | NM_214201.1 | 
| HO-1 | TGATGGCGTCCTTGTACCAC | GACCGGGTTCTCCTTGTTGT | NM_001004027.1 | 
| ACTB | TGGACTACCTCCTGTCTGCT | CCTAGGGGTGGGTTTCTGTG | XM_021086047.1 | 
| Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. | 
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Dauth, A.; Bręborowicz, A.; Ruan, Y.; Tang, Q.; Zadeh, J.K.; Böhm, E.W.; Pfeiffer, N.; Khedkar, P.H.; Patzak, A.; Vujacic-Mirski, K.; et al. Sulodexide Prevents Hyperglycemia-Induced Endothelial Dysfunction and Oxidative Stress in Porcine Retinal Arterioles. Antioxidants 2023, 12, 388. https://doi.org/10.3390/antiox12020388
Dauth A, Bręborowicz A, Ruan Y, Tang Q, Zadeh JK, Böhm EW, Pfeiffer N, Khedkar PH, Patzak A, Vujacic-Mirski K, et al. Sulodexide Prevents Hyperglycemia-Induced Endothelial Dysfunction and Oxidative Stress in Porcine Retinal Arterioles. Antioxidants. 2023; 12(2):388. https://doi.org/10.3390/antiox12020388
Chicago/Turabian StyleDauth, Alice, Andrzej Bręborowicz, Yue Ruan, Qi Tang, Jenia K. Zadeh, Elsa W. Böhm, Norbert Pfeiffer, Pratik H. Khedkar, Andreas Patzak, Ksenija Vujacic-Mirski, and et al. 2023. "Sulodexide Prevents Hyperglycemia-Induced Endothelial Dysfunction and Oxidative Stress in Porcine Retinal Arterioles" Antioxidants 12, no. 2: 388. https://doi.org/10.3390/antiox12020388
APA StyleDauth, A., Bręborowicz, A., Ruan, Y., Tang, Q., Zadeh, J. K., Böhm, E. W., Pfeiffer, N., Khedkar, P. H., Patzak, A., Vujacic-Mirski, K., Daiber, A., & Gericke, A. (2023). Sulodexide Prevents Hyperglycemia-Induced Endothelial Dysfunction and Oxidative Stress in Porcine Retinal Arterioles. Antioxidants, 12(2), 388. https://doi.org/10.3390/antiox12020388
 
        




 
       