Hepatitis Delta Virus Antigens Trigger Oxidative Stress, Activate Antioxidant Nrf2/ARE Pathway, and Induce Unfolded Protein Response
Abstract
:1. Introduction
2. Materials and Methods
2.1. Reagents
2.2. Plasmid Construction
2.3. Cell Culture Experiments and Reporter Assays
2.4. Quantification of ROS Production
2.5. Reverse-Transcription Quantitative Polymerase Chain Reaction (RT-qPCR)
2.6. Western Blotting
2.7. Infectious HDV Model
2.8. Statistical Analysis
3. Results
3.1. Model Description
3.2. Large Antigen of Hepatitis Delta Virus Triggers Oxidative Stress via Induction of NADPH Oxidases 1 and 4, Cytochrome P450 2E1, and ER Oxidoreductin 1α
3.3. Expression of the Large HDV Antigen Activates Antioxidant Defense Nrf2/ARE Pathway
3.4. Large HDV Antigen Provokes ER Stress and Concomitant Unfolded Protein Response
3.5. Current Infectious Models Do Not Allow Analysis of Changes Specifically in Infected Cells
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hughes, S.A.; Wedemeyer, H.; Harrison, P.M. Hepatitis delta virus. Lancet 2011, 378, 73–85. [Google Scholar] [CrossRef] [PubMed]
- Farci, P.; Niro, G.A. Clinical Features of Hepatitis D. Semin. Liver Dis. 2012, 32, 228–236. [Google Scholar] [CrossRef] [PubMed]
- Tseligka, E.D.; Clément, S.; Negro, F. HDV Pathogenesis: Unravelling Ariadne’s Thread. Viruses 2021, 13, 778. [Google Scholar] [CrossRef] [PubMed]
- Stockdale, A.J.; Kreuels, B.; Henrion, M.Y.R.; Giorgi, E.; Kyomuhangi, I.; de Martel, C.; Hutin, Y.; Geretti, A.M. The global prevalence of hepatitis D virus infection: Systematic review and meta-analysis. J. Hepatol. 2020, 73, 523–532. [Google Scholar] [CrossRef] [PubMed]
- Chen, H.-Y.; Shen, D.-T.; Ji, D.-Z.; Han, P.-C.; Zhang, W.-M.; Ma, J.-F.; Chen, W.-S.; Goyal, H.; Pan, S.; Xu, H.-G. Prevalence and burden of hepatitis D virus infection in the global population: A systematic review and meta-analysis. Gut 2019, 68, 512–521. [Google Scholar] [CrossRef] [PubMed]
- Miao, Z.; Zhang, S.; Ou, X.; Li, S.; Ma, Z.; Wang, W.; Peppelenbosch, M.P.; Liu, J.; Pan, Q. Estimating the Global Prevalence, Disease Progression, and Clinical Outcome of Hepatitis Delta Virus Infection. J. Infect. Dis. 2020, 221, 1677–1687. [Google Scholar] [CrossRef]
- Mentha, N.; Clément, S.; Negro, F.; Alfaiate, D. A review on hepatitis D: From virology to new therapies. J. Adv. Res. 2019, 17, 3–15. [Google Scholar] [CrossRef]
- Wong, S.K.; Lazinski, D.W. Replicating hepatitis delta virus RNA is edited in the nucleus by the small form of ADAR1. Proc. Natl. Acad. Sci. USA 2002, 99, 15118–15123. [Google Scholar] [CrossRef]
- Urban, S.; Neumann-Haefelin, C.; Lampertico, P. Hepatitis D virus in 2021: Virology, immunology and new treatment approaches for a difficult-to-treat disease. Gut 2021, 70, 1782–1794. [Google Scholar] [CrossRef]
- Gill, U.S. The immune landscape in hepatitis delta virus infection—Still an open field! J. Viral Hepat. 2023, 30, 21–25. [Google Scholar] [CrossRef]
- Kefalakes, H.; Koh, C.; Sidney, J.; Amanakis, G.; Sette, A.; Heller, T.; Rehermann, B. Hepatitis D Virus-Specific CD8+ T Cells Have a Memory-Like Phenotype Associated with Viral Immune Escape in Patients with Chronic Hepatitis D Virus Infection. Gastroenterology 2019, 156, 1805–1819.e9. [Google Scholar] [CrossRef] [PubMed]
- Kefalakes, H.; Horgan, X.J.; Jung, M.K.; Amanakis, G.; Kapuria, D.; Bolte, F.J.; Kleiner, D.E.; Koh, C.; Heller, T.; Rehermann, B. Liver-Resident Bystander CD8+ T Cells Contribute to Liver Disease Pathogenesis in Chronic Hepatitis D Virus Infection. Gastroenterology 2021, 161, 1567–1583.e9. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.; Filzmayer, C.; Ni, Y.; Sültmann, H.; Mutz, P.; Hiet, M.-S.; Vondran, F.W.R.; Bartenschlager, R.; Urban, S. Hepatitis D virus replication is sensed by MDA5 and induces IFN-β/λ responses in hepatocytes. J. Hepatol. 2018, 69, 25–35. [Google Scholar] [CrossRef] [PubMed]
- Pugnale, P.; Pazienza, V.; Guilloux, K.; Negro, F. Hepatitis delta virus inhibits alpha interferon signaling. Hepatology 2009, 49, 398–406. [Google Scholar] [CrossRef]
- Choi, S.H.; Jeong, S.H.; Hwang, S.B. Large Hepatitis Delta Antigen Modulates Transforming Growth Factor-β Signaling Cascades: Implication of Hepatitis Delta Virus–Induced Liver Fibrosis. Gastroenterology 2007, 132, 343–357. [Google Scholar] [CrossRef]
- Williams, V.; Brichler, S.; Khan, E.; Chami, M.; Dény, P.; Kremsdorf, D.; Gordien, E. Large hepatitis delta antigen activates STAT-3 and NF-κB via oxidative stress. J. Viral Hepat. 2012, 19, 744–753. [Google Scholar] [CrossRef]
- Takac, I.; Schröder, K.; Zhang, L.; Lardy, B.; Anilkumar, N.; Lambeth, J.D.; Shah, A.M.; Morel, F.; Brandes, R.P. The E-loop Is Involved in Hydrogen Peroxide Formation by the NADPH Oxidase Nox4. J. Biol. Chem. 2011, 286, 13304–13313. [Google Scholar] [CrossRef]
- Cullinan, S.B.; Zhang, D.; Hannink, M.; Arvisais, E.; Kaufman, R.J.; Diehl, J.A. Nrf2 Is a Direct PERK Substrate and Effector of PERK-Dependent Cell Survival. Mol. Cell. Biol. 2003, 23, 7198–7209. [Google Scholar] [CrossRef]
- Tunitskaya, V.L.; Eliseeva, O.V.; Valuev-Elliston, V.T.; Tyurina, D.A.; Zakirova, N.F.; Khomich, O.A.; Kalis, M.; Latyshev, O.E.; Starodubova, E.S.; Ivanova, O.N.; et al. Prokaryotic Expression, Purification and Immunogenicity in Rabbits of the Small Antigen of Hepatitis Delta Virus. Int. J. Mol. Sci. 2016, 17, 1721. [Google Scholar] [CrossRef]
- Ivanov, A.V.; Smirnova, O.A.; Ivanova, O.N.; Masalova, O.V.; Kochetkov, S.N.; Isaguliants, M.G. Hepatitis C Virus Proteins Activate NRF2/ARE Pathway by Distinct ROS-Dependent and Independent Mechanisms in HUH7 Cells. PLoS ONE 2011, 6, e24957. [Google Scholar] [CrossRef]
- Faraonio, R.; Vergara, P.; Di Marzo, D.; Pierantoni, M.G.; Napolitano, M.; Russo, T.; Cimino, F. p53 Suppresses the Nrf2-dependent Transcription of Antioxidant Response Genes. J. Biol. Chem. 2006, 281, 39776–39784. [Google Scholar] [CrossRef] [PubMed]
- Traylor, A.; Hock, T.; Hill-Kapturczak, N. Specificity protein 1 and Smad-dependent regulation of human heme oxygenase-1 gene by transforming growth factor-β1 in renal epithelial cells. Am. J. Physiol. Renal. Physiol. 2007, 293, F885–F894. [Google Scholar] [CrossRef] [PubMed]
- Ivanova, O.N.; Snezhkina, A.V.; Krasnov, G.S.; Valuev-Elliston, V.T.; Khomich, O.A.; Khomutov, A.R.; Keinanen, T.A.; Alhonen, L.; Bartosch, B.; Kudryavtseva, A.V.; et al. Activation of Polyamine Catabolism by N1,N11-Diethylnorspermine in Hepatic HepaRG Cells Induces Dedifferentiation and Mesenchymal-Like Phenotype. Cells 2018, 7, 275. [Google Scholar] [CrossRef] [PubMed]
- Kukhanova, M.K.; Tunitskaya, V.L.; Smirnova, O.A.; Khomich, O.A.; Zakirova, N.F.; Ivanova, O.N.; Ziganshin, R.; Bartosch, B.; Kochetkov, S.N.; Ivanov, A.V. Hepatitis C Virus RNA-Dependent RNA Polymerase Is Regulated by Cysteine S-Glutathionylation. Oxidative Med. Cell. Longev. 2019, 2019, 3196140. [Google Scholar] [CrossRef] [PubMed]
- Ivanov, A.V.; Smirnova, O.A.; Petrushanko, I.Y.; Ivanova, O.N.; Karpenko, I.L.; Alekseeva, E.; Sominskaya, I.; Makarov, A.A.; Bartosch, B.; Kochetkov, S.N.; et al. HCV Core Protein Uses Multiple Mechanisms to Induce Oxidative Stress in Human Hepatoma Huh7 Cells. Viruses 2015, 7, 2745–2770. [Google Scholar] [CrossRef] [PubMed]
- Lazinski, D.W.; Taylor, J.M. Relating structure to function in the hepatitis delta virus antigen. J. Virol. 1993, 67, 2672–2680. [Google Scholar] [CrossRef]
- Ni, Y.; Zhang, Z.; Engelskircher, L.; Verch, G.; Tu, T.; Lempp, F.A.; Urban, S. Generation and characterization of a stable cell line persistently replicating and secreting the human hepatitis delta virus. Sci. Rep. 2019, 9, 10021. [Google Scholar] [CrossRef]
- Khabir, M.; Aliche, A.Z.; Sureau, C.; Blanchet, M.; Labonté, P. Hepatitis Delta Virus Alters the Autophagy Process to Promote Its Genome Replication. J. Virol. 2020, 94, e01936-19. [Google Scholar] [CrossRef]
- Palatini, M.; Müller, S.F.; Kirstgen, M.; Leiting, S.; Lehmann, F.; Soppa, L.; Goldmann, N.; Müller, C.; Lowjaga, K.A.A.T.; Alber, J.; et al. IFITM3 Interacts with the HBV/HDV Receptor NTCP and Modulates Virus Entry and Infection. Viruses 2022, 14, 727. [Google Scholar] [CrossRef]
- Boudreau, H.E.; Emerson, S.U.; Korzeniowska, A.; Jendrysik, M.A.; Leto, T.L. Hepatitis C Virus (HCV) Proteins Induce NADPH Oxidase 4 Expression in a Transforming Growth Factor β-Dependent Manner: A New Contributor to HCV-Induced Oxidative Stress. J. Virol. 2009, 83, 12934–12946. [Google Scholar] [CrossRef]
- Kalyanaraman, B.; Darley-Usmar, V.; Davies, K.J.A.; Dennery, P.A.; Forman, H.J.; Grisham, M.B.; Mann, G.E.; Moore, K.; Roberts, L.J., 2nd; Ischiropoulos, H. Measuring reactive oxygen and nitrogen species with fluorescent probes: Challenges and limitations. Free Radic. Biol. Med. 2012, 52, 1–6. [Google Scholar] [CrossRef] [PubMed]
- Reis, J.; Massari, M.; Marchese, S.; Ceccon, M.; Aalbers, F.S.; Corana, F.; Valente, S.; Mai, A.; Magnani, F.; Mattevi, A. A closer look into NADPH oxidase inhibitors: Validation and insight into their mechanism of action. Redox Biol. 2020, 32, 101466. [Google Scholar] [CrossRef] [PubMed]
- Wu, D.; Cederbaum, A.I. Ethanol Cytotoxicity to a Transfected HepG2 Cell Line Expressing Human Cytochrome P4502E1. J. Biol. Chem. 1996, 271, 23914–23919. [Google Scholar] [CrossRef] [PubMed]
- Juan, C.A.; Perez de la Lastra, J.M.; Plou, F.J.; Pérez-Lebeña, E. The Chemistry of Reactive Oxygen Species (ROS) Revisited: Outlining Their Role in Biological Macromolecules (DNA, Lipids and Proteins) and Induced Pathologies. Int. J. Mol. Sci. 2021, 22, 4642. [Google Scholar] [CrossRef]
- Winterbourn, C.C. Reconciling the chemistry and biology of reactive oxygen species. Nat. Chem. Biol. 2008, 4, 278–286. [Google Scholar] [CrossRef]
- Sies, H. Oxidative stress: A concept in redox biology and medicine. Redox Biol. 2015, 4, 180–183. [Google Scholar] [CrossRef]
- Golikov, M.V.; Karpenko, I.L.; Lipatova, A.V.; Ivanova, O.N.; Fedyakina, I.T.; Larichev, V.F.; Zakirova, N.F.; Leonova, O.G.; Popenko, V.I.; Bartosch, B.; et al. Cultivation of Cells in a Physiological Plasmax Medium Increases Mitochondrial Respiratory Capacity and Reduces Replication Levels of RNA Viruses. Antioxidants 2022, 11, 97. [Google Scholar] [CrossRef]
- Ivanov, A.V.; Bartosch, B.; Smirnova, O.A.; Isaguliants, M.G.; Kochetkov, S.N. HCV and Oxidative Stress in the Liver. Viruses 2013, 5, 439–469. [Google Scholar] [CrossRef]
- Ivanov, A.V.; Valuev-Elliston, V.T.; Ivanova, O.N.; Kochetkov, S.N.; Starodubova, E.S.; Bartosch, B.; Isaguliants, M.G. Oxidative Stress during HIV Infection: Mechanisms and Consequences. Oxid. Med. Cell Longev. 2016, 2016, 8910396. [Google Scholar] [CrossRef]
- Khomich, O.A.; Kochetkov, S.N.; Bartosch, B.; Ivanov, A.V. Redox Biology of Respiratory Viral Infections. Viruses 2018, 10, 392. [Google Scholar] [CrossRef]
- Kamranvar, S.A.; Masucci, M.G. The Epstein–Barr virus nuclear antigen-1 promotes telomere dysfunction via induction of oxidative stress. Leukemia 2011, 25, 1017–1025. [Google Scholar] [CrossRef] [PubMed]
- Ivanov, A.V.; Valuev-Elliston, V.T.; Tyurina, D.A.; Ivanova, O.N.; Kochetkov, S.N.; Bartosch, B.; Isaguliants, M.G. Oxidative stress, a trigger of hepatitis C and B virus-induced liver carcinogenesis. Oncotarget 2016, 8, 3895–3932. [Google Scholar] [CrossRef]
- Tell, G.; Vascotto, C.; Tiribelli, C. Alterations in the redox state and liver damage: Hints from the EASL Basic School of Hepatology. J. Hepatol. 2013, 58, 365–374. [Google Scholar] [CrossRef] [PubMed]
- De Mochel, N.S.R.; Seronello, S.; Wang, S.H.; Ito, C.; Zheng, J.X.; Liang, T.J.; Lambeth, J.D.; Choi, J. Hepatocyte NAD(P)H oxidases as an endogenous source of reactive oxygen species during hepatitis C virus infection. Hepatology 2010, 52, 47–59. [Google Scholar] [CrossRef] [PubMed]
- Smirnova, O.A.; Ivanova, O.N.; Bartosch, B.; Valuev-Elliston, V.T.; Mukhtarov, F.; Kochetkov, S.N.; Ivanov, A.V. Hepatitis C Virus NS5A Protein Triggers Oxidative Stress by Inducing NADPH Oxidases 1 and 4 and Cytochrome P450 2E1. Oxidative Med. Cell. Longev. 2016, 2016, 8341937. [Google Scholar] [CrossRef]
- Lu, Y.; Cederbaum, A.I. CYP2E1 and oxidative liver injury by alcohol. Free. Radic. Biol. Med. 2008, 44, 723–738. [Google Scholar] [CrossRef]
- Gus’Kova, R.A.; Ivanov, I.I.; Kol’Tover, V.K.; Akhobadze, V.V.; Rubin, A.B. Permeability of bilayer lipid membranes for superoxide (O2−) radicals. Biochim. Biophys. Acta BBA Biomembr. 1984, 778, 579–585. [Google Scholar] [CrossRef]
- Han, D.; Antunes, F.; Canali, R.; Rettori, D.; Cadenas, E. Voltage-dependent Anion Channels Control the Release of the Superoxide Anion from Mitochondria to Cytosol. J. Biol. Chem. 2003, 278, 5557–5563. [Google Scholar] [CrossRef] [PubMed]
- Pak, V.V.; Ezeriņa, D.; Lyublinskaya, O.G.; Pedre, B.; Tyurin-Kuzmin, P.A.; Mishina, N.M.; Thauvin, M.; Young, D.; Wahni, K.; Martinez Gache, S.A.; et al. Ultrasensitive Genetically Encoded Indicator for Hydrogen Peroxide Identifies Roles for the Oxidant in Cell Migration and Mitochondrial Function. Cell Metab. 2020, 31, 642–653.e6. [Google Scholar] [CrossRef]
- Karpenko, I.L.; Valuev-Elliston, V.T.; Ivanova, O.N.; Smirnova, O.A.; Ivanov, A.V. Peroxiredoxins—The Underrated Actors during Virus-Induced Oxidative Stress. Antioxidants 2021, 10, 977. [Google Scholar] [CrossRef]
- Esworthy, R.S.; Doroshow, J.H.; Chu, F.-F. The beginning of GPX2 and 30 years later. Free. Radic. Biol. Med. 2022, 188, 419–433. [Google Scholar] [CrossRef] [PubMed]
- Aleksunes, L.M.; Manautou, J.E. Emerging Role of Nrf2 in Protecting Against Hepatic and Gastrointestinal Disease. Toxicol. Pathol. 2007, 35, 459–473. [Google Scholar] [CrossRef] [PubMed]
- Wu, S.; Lu, H.; Bai, Y. Nrf2 in cancers: A double-edged sword. Cancer Med. 2019, 8, 2252–2267. [Google Scholar] [CrossRef] [PubMed]
- Ahmed, S.M.U.; Luo, L.; Namani, A.; Wang, X.J.; Tang, X. Nrf2 signaling pathway: Pivotal roles in inflammation. Biochim. Biophys. Acta Mol. Basis Dis. 2017, 1863, 585–597. [Google Scholar] [CrossRef]
- Carvajal-Yepes, M.; Himmelsbach, K.; Schaedler, S.; Ploen, D.; Krause, J.; Ludwig, L.; Weiss, T.; Klingel, K.; Hildt, E. Hepatitis C Virus Impairs the Induction of Cytoprotective Nrf2 Target Genes by Delocalization of Small Maf Proteins. J. Biol. Chem. 2011, 286, 8941–8951. [Google Scholar] [CrossRef]
- Schaedler, S.; Krause, J.; Himmelsbach, K.; Carvajal-Yepes, M.; Lieder, F.; Klingel, K.; Nassal, M.; Weiss, T.S.; Werner, S.; Hildt, E. Hepatitis B Virus Induces Expression of Antioxidant Response Element-regulated Genes by Activation of Nrf2. J. Biol. Chem. 2010, 285, 41074–41086. [Google Scholar] [CrossRef]
- Jiang, Y.; Bao, H.; Ge, Y.; Tang, W.; Cheng, D.; Luo, K.; Gong, G.; Gong, R. Therapeutic targeting of GSK3β enhances the Nrf2 antioxidant response and confers hepatic cytoprotection in hepatitis C. Gut 2015, 64, 168–179. [Google Scholar] [CrossRef]
- Almanza, A.; Carlesso, A.; Chintha, C.; Creedican, S.; Doultsinos, D.; Leuzzi, B.; Luís, A.; McCarthy, N.; Montibeller, L.; More, S.; et al. Endoplasmic reticulum stress signalling—From basic mechanisms to clinical applications. FEBS J. 2019, 286, 241–278. [Google Scholar] [CrossRef]
- Bhattarai, K.R.; Alam Riaz, T.; Kim, H.-R.; Chae, H.-J. The aftermath of the interplay between the endoplasmic reticulum stress response and redox signaling. Exp. Mol. Med. 2021, 53, 151–167. [Google Scholar] [CrossRef]
- Xue, M.; Feng, L. The Role of Unfolded Protein Response in Coronavirus Infection and Its Implications for Drug Design. Front. Microbiol. 2021, 12, 808593. [Google Scholar] [CrossRef]
- Kaufman, R.J. Stress signaling from the lumen of the endoplasmic reticulum: Coordination of gene transcriptional and translational controls. Genes Dev. 1999, 13, 1211–1233. [Google Scholar] [CrossRef] [PubMed]
- Kong, L.; Li, S.; Huang, M.; Xiong, Y.; Zhang, Q.; Ye, L.; Liu, J.; Zhu, X.; Sun, R.; Guo, Y. The Roles of Endoplasmic Reticulum Overload Response Induced by HCV and NS4B Protein in Human Hepatocyte Viability and Virus Replication. PLoS ONE 2015, 10, e0123190. [Google Scholar] [CrossRef] [PubMed]
- Li, S.; Ye, L.; Yu, X.; Xu, B.; Li, K.; Zhu, X.; Liu, H.; Wu, X.; Kong, L. Hepatitis C virus NS4B induces unfolded protein response and endoplasmic reticulum overload response-dependent NF-κB activation. Virology 2009, 391, 257–264. [Google Scholar] [CrossRef] [PubMed]
- Ni, Y.; Lempp, F.A.; Mehrle, S.; Nkongolo, S.; Kaufman, C.; Fälth, M.; Stindt, J.; Königer, C.; Nassal, M.; Kubitz, R.; et al. Hepatitis B and D Viruses Exploit Sodium Taurocholate Co-transporting Polypeptide for Species-Specific Entry into Hepatocytes. Gastroenterology 2014, 146, 1070–1083.e6. [Google Scholar] [CrossRef] [PubMed]
- Ni, Y.; Urban, S. Hepatitis B Virus Infection of HepaRG Cells, HepaRG-hNTCP Cells, and Primary Human Hepatocytes. Methods Mol. Biol. 2017, 1540, 15–25. [Google Scholar] [CrossRef]
Plasmid | Orientation 1 | Sequence (5′-3′) | |
---|---|---|---|
pGL3-5xUPRE | Dir | CACAGGTGCTGACGTGGCATTCACAGGTGCTGACGTGGCATTCACAGGT and GCTGACGTGGCATTCACAGGTGCTGACGTGGCATTCACAGGTGCTGACGTGGCATTC | |
Rev | GTGAATGCCACGTCAGCACCTGTGAATGCCACGTCAGCACCTGTGGTAC and TCGAGAATGCCACGTCAGCACCTGTGAATGCCACGTCAGCACCTGTGAATGCCACGTCAGCACCT | ||
pGL3-ERSE | Dir | CCACCAATCGGAGGCCTCCACGACCACCAATCGGAGGCCTCCACGAC | |
Rev | TCGAGTCGTGGAGGCCTCCGATTGGTGGTCGTGGAGGCCTCCGATTGGTGGGTAC | ||
pGL3-AARE | Dir | CAACATTGCATCATCCCCGCAACATTGCATCATCCCCGCC | |
Rev | TCGAGGCGGGGATGATGCAATGTTGCGGGGATGATGCAATGTTGGTAC | ||
pGL3-Xbp1 | Dir | TTCCCTCGAGCGACAGAAGCAGAACTTTAG | |
Rev | TTCCGGTACCCCTGAGGTAATTCTCTGTTAG | Gene ID: 7494 | |
pGL3-Grp78 | Dir | TTCCCTCGAGCTTCATCTTGCCAGCCAGT | Gene ID: 3309 |
Rev | TTCCGGTACCCGAGATAGACAGCTGCTGAACCA |
Gene | Sequence (5′-3′) | GenBank Accession No. |
---|---|---|
Nox1 | CAATCTCTCTCCTGGAATGGCATCCT | NM_007052.5 |
CCTGCTGCTCGGATATGAATGGAGAA | ||
Nox4 | CTGCATGGTGGTGGTGCTAT | NM_016931.5 |
CCGGGAGGGTGGGTATCTAA | ||
TGFβ1 | TGGCGATACCTCAGCAAC | NM_000660.7 |
ACCCGTTGATGTCCACTTG | ||
COX2 | GCCAAGCACTTTTGGTGGAG | NM_000963.4 |
GGGACAGCCCTTCACGTTAT | ||
CYP2E1 | TTTAAGCCAGAACACTTCC | NM_000773.4 |
GCACACAACAAAAGAAACA | ||
Ero1α | TCATTGAAGAATGTGAACAA | NM_001382464.1 |
ATCATGCTTGGTCCACTGAA | ||
Nqo1 | CCGTGGATCCCTTGCAGAGA | NM_000903.3 |
AGGACCCTTCCGGAGTAAGA | ||
HO-1 | CCAGCAACAAAGTGCAAGATTC | NM_002133.3 |
TCACATGGCATAAAGCCCTACAG | ||
CHOP | AGAACCAGGAAACGGAAACAGA | NM_001195053.1 |
TCTCCTTCATGCGCTGCTTT | ||
Xbp1 | GTGCAGGCCCAGTTGTCACC | NM_005080.4 |
TCTGGGTAGACCTCTGGGAG | ||
Grp78 | CCACCTCCAATATCAACTTG | NM_005347.5 |
ACGATCAGGGCAACCGCATCA | ||
EDEM | CTGGGTTGGAAAGCAGAGTG | NM_014674.3 |
TCTCCTTCATTGCAGGCTTC | ||
GUS | CGTGGTTGGAGAGCTCATTTGGAA | NM_000181.4 |
ATTCCCCAGCACTCTCGTCGGT | ||
HDV | GGACCCCTTCAGCGAACA | M21012.1 |
CCTAGCATCTCCTCCTATCGCTAT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Smirnova, O.A.; Ivanova, O.N.; Mukhtarov, F.; Valuev-Elliston, V.T.; Fedulov, A.P.; Rubtsov, P.M.; Zakirova, N.F.; Kochetkov, S.N.; Bartosch, B.; Ivanov, A.V. Hepatitis Delta Virus Antigens Trigger Oxidative Stress, Activate Antioxidant Nrf2/ARE Pathway, and Induce Unfolded Protein Response. Antioxidants 2023, 12, 974. https://doi.org/10.3390/antiox12040974
Smirnova OA, Ivanova ON, Mukhtarov F, Valuev-Elliston VT, Fedulov AP, Rubtsov PM, Zakirova NF, Kochetkov SN, Bartosch B, Ivanov AV. Hepatitis Delta Virus Antigens Trigger Oxidative Stress, Activate Antioxidant Nrf2/ARE Pathway, and Induce Unfolded Protein Response. Antioxidants. 2023; 12(4):974. https://doi.org/10.3390/antiox12040974
Chicago/Turabian StyleSmirnova, Olga A., Olga N. Ivanova, Furkat Mukhtarov, Vladimir T. Valuev-Elliston, Artemy P. Fedulov, Petr M. Rubtsov, Natalia F. Zakirova, Sergey N. Kochetkov, Birke Bartosch, and Alexander V. Ivanov. 2023. "Hepatitis Delta Virus Antigens Trigger Oxidative Stress, Activate Antioxidant Nrf2/ARE Pathway, and Induce Unfolded Protein Response" Antioxidants 12, no. 4: 974. https://doi.org/10.3390/antiox12040974