Carnosine Synthase (TsATPGD) Alleviates Lipid Peroxidation Under Transcriptional Control by an Nfe2-like Gene in Tridacna Squamosa
Abstract
:1. Introduction
2. Materials and Methods
2.1. Experimental Animals and Samples Collection
2.2. Analysis of TsNfe2l Protein Sequence
2.3. Molecular Cloning of TsNfe2l and TsMafK
2.4. Electrophoretic Mobility Shift Assay (EMSA) on TsNfe2l Activation
2.5. Dual-Luciferase Reporter Assay
2.6. Real-Time qPCR
2.7. Prediction of TsNfe2l Target Genes
2.8. Gill Tissue Culture
2.9. Assays on Lipid Peroxidation and Carnosine Content
3. Results
3.1. Molecular Cloning and Evolutionary Analysis of TsNfe2l
3.2. TsNfe2l Is a Transcription Factor That Recognizes the Typical Sequences of ARE
3.3. Prediction and Validation of Downstream Genes of TsNfe2l
3.4. TsNfe2l Regulates Lipid Peroxidation Through TsATPGD
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
CNC-bZIP | Cap’n’collar basic leucine zipper; |
bZIP-NFE2L | Basic leucine zipper nuclear factor, erythroid-derived 2-like; |
Nrf | Nuclear factor, erythroid 2 like; |
BACH | Bric-a-brac domain and cap’n’collar homolog; |
sMaf | Small musculoaponeurotic fibrosarcoma oncogene homolog; |
Keap1 | Kelch-like ECH associated protein 1; |
cDNA | Complementary deoxyribonucleic acid; |
PCR | Polymerase chain reaction; |
ORF | Open reading frame; |
GAPDH | Glyceraldehyde-3-phosphate dehydrogenase; |
qPCR | Quantitative real-time polymerase chain reaction; |
EMSA | Electrophoretic mobility shift assay; |
GO | Gene ontology; |
MDA | Malondialdehyde; |
LC-ESI-MS | Liquid chromatogram-electron spray ionization-mass spectrometer. |
References
- Leggat, W.; Rees, T.A.V.; Yellowlees, D. Meeting the photosynthetic demand for inorganic carbon in an alga-invertebrate association: Preferential use of CO2 by symbionts in the giant clam Tridacna gigas. Proc. R. Soc. B Biol. Sci. 2000, 267, 523–529. [Google Scholar] [CrossRef] [PubMed]
- Ip, Y.K.; Hiong, K.C.; Goh, E.J.K.; Boo, M.V.; Choo, C.Y.L.; Ching, B.; Wong, W.P.; Chew, S.F. The Whitish Inner Mantle of the Giant Clam, Tridacna squamosa, Expresses an Apical Plasma Membrane Ca2+-ATPase (PMCA) Which Displays Light-Dependent Gene and Protein Expressions. Front. Physiol. 2017, 8, 781. [Google Scholar] [CrossRef] [PubMed]
- Norton, J.H.; Shepherd, M.A.; Long, H.M.; Fitt, W.K. The Zooxanthellal tubular system in the giant clam. Biol. Bull. 1992, 183, 503–506. [Google Scholar] [CrossRef] [PubMed]
- Kurihara, T.; Yamada, H.; Inoue, K.; Iwai, K.; Hatta, M. Impediment to Symbiosis Establishment between Giant Clams and Symbiodinium Algae Due to Sterilization of Seawater. PLoS ONE 2013, 8, e61156. [Google Scholar] [CrossRef]
- Boo, M.V.; Hiong, K.C.; Goh, E.J.K.; Choo, C.Y.L.; Wong, W.P.; Chew, S.F.; Ip, Y.K. The ctenidium of the giant clam, Tridacna squamosa, expresses an ammonium transporter 1 that displays light-suppressed gene and protein expression and may be involved in ammonia excretion. J. Comp. Physiol. B Biochem. Syst. Environ. Physiol. 2018, 188, 765–777. [Google Scholar] [CrossRef]
- Hiong, K.C.; Koh, C.Z.Y.; Boo, M.V.; Choo, C.Y.L.; Wong, W.P.; Chew, S.F.; Ip, Y.K. The colorful mantle of the giant clam, Tridacna squamosa, expresses a light-dependent manganese superoxide dismutase to ameliorate oxidative stresses due to its symbiotic association with zooxanthellae. Coral Reefs 2018, 37, 1039–1051. [Google Scholar] [CrossRef]
- Roberty, S.; Fransolet, D.; Cardol, P.; Plumier, J.C.; Franck, F. Imbalance between oxygen photoreduction and antioxidant capacities in Symbiodinium cells exposed to combined heat and high light stress. Coral Reefs 2015, 34, 1063–1073. [Google Scholar] [CrossRef]
- Nielsen, D.A.; Petrou, K.; Gates, R.D. Coral bleaching from a single cell perspective. Isme J. 2018, 12, 1558–1567. [Google Scholar] [CrossRef]
- Raghunath, A.; Sundarraj, K.; Nagarajan, R.; Arfuso, F.; Bian, J.; Kumar, A.P.; Sethi, G.; Perumal, E. Antioxidant response elements: Discovery, classes, regulation and potential applications. Redox Biol. 2018, 17, 297–314. [Google Scholar] [CrossRef]
- Apel, K.; Hirt, H. Reactive oxygen species: Metabolism, oxidative stress, and signal transduction. Annu. Rev. Plant Biol. 2004, 55, 373–399. [Google Scholar] [CrossRef]
- Kwong, M.; Kan, Y.W.; Chan, J.Y. The CNC basic leucine zipper factor, Nrf1, is essential for cell survival in response to oxidative stress-inducing agents–Role for Nrf1 in gamma-gcs(L) and g(ss) expression in mouse fibroblasts. J. Biol. Chem. 1999, 274, 37491–37498. [Google Scholar] [CrossRef] [PubMed]
- Kansanen, E.; Kuosmanen, S.M.; Leinonen, H.; Levonen, A.-L. The Keap1-Nrf2 pathway: Mechanisms of activation and dysregulation in cancer. Redox Biol. 2013, 1, 45–49. [Google Scholar] [CrossRef] [PubMed]
- Lu, S.; Wang, J.; Chitsaz, F.; Derbyshire, M.K.; Geer, R.C.; Gonzales, N.R.; Gwadz, M.; Hurwitz, D.I.; Marchler, G.H.; Song, J.S.; et al. CDD/SPARCLE: The conserved domain database in 2020. Nucleic Acids Res. 2020, 48, D265–D268. [Google Scholar] [CrossRef] [PubMed]
- Andrews, N.C. The NF-E2 transcription factor. Int. J. Biochem. Cell Biol. 1998, 30, 429–432. [Google Scholar] [CrossRef] [PubMed]
- Ohtsuji, M.; Katsuoka, F.; Kobayashi, A.; Aburatani, H.; Hayes, J.D.; Yamamoto, M. Nrf1 and Nrf2 Play Distinct Roles in Activation of Antioxidant Response Element-dependent Genes. J. Biol. Chem. 2008, 283, 33554–33562. [Google Scholar] [CrossRef]
- Xiaoping, L.I.N.; Wen, L.I.; Huahao, S. Progress on antioxidant transcription factor-Nrf2. Chin. J. Pathophysiol. 2011, 27, 1234–1239. [Google Scholar]
- Yang, F.; Jia, M.; Dai, R.-Y.; Xiang, Y.-C. Progress on the Biological Functions of Transmembrane Factor Nrf1. Prog. Biochem. Biophys. 2020, 47, 582–594. [Google Scholar] [CrossRef]
- Hu, J.J.; Wong, N.-K.; Ye, S.; Chen, X.; Lu, M.-Y.; Zhao, A.Q.; Guo, Y.; Ma, A.C.-H.; Leung, A.Y.-H.; Shen, J.; et al. Fluorescent Probe HKSOX-1 for Imaging and Detection of Endogenous Superoxide in Live Cells and In Vivo. J. Am. Chem. Soc. 2015, 137, 6837–6843. [Google Scholar] [CrossRef]
- Peng, T.; Wong, N.-K.; Chen, X.; Chan, Y.-K.; Ho, D.H.-H.; Sun, Z.; Hu, J.J.; Shen, J.; El-Nezami, H.; Yang, D. Molecular Imaging of Peroxynitrite with HKGreen-4 in Live Cells and Tissues. J. Am. Chem. Soc. 2014, 136, 11728–11734. [Google Scholar] [CrossRef]
- Stockwell, B.R. Ferroptosis turns 10: Emerging mechanisms, physiological functions, and therapeutic applications. Cell 2022, 185, 2401–2421. [Google Scholar] [CrossRef]
- Che, Z.; Zhou, Z.; Li, S.-Q.; Gao, L.; Xiao, J.; Wong, N.-K. ROS/RNS as molecular signatures of chronic liver diseases. Trends Mol. Med. 2023, 29, 951–967. [Google Scholar] [CrossRef]
- Dodson, M.; Castro-Portuguez, R.; Zhang, D.D. NRF2 plays a critical role in mitigating lipid peroxidation and ferroptosis. Redox Biol. 2019, 23, 101107. [Google Scholar] [CrossRef] [PubMed]
- Hahn, M.E.; Timme-Laragy, A.R.; Karchner, S.I.; Stegeman, J.J. Nrf2 and Nrf2-related proteins in development and developmental toxicity: Insights from studies in zebrafish (Danio rerio). Free Radic. Biol. Med. 2015, 88, 275–289. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.-L.; Liu, W.-X.; Wen, C.-G.; Qian, G.-M.; Hu, B.-Q.; Jian, S.-Q.; Yang, G.; Dong, J. Effect of microcystin on the expression of Nrf2 and its downstream antioxidant genes from Cristaria plicata. Aquat. Toxicol. 2020, 225, 105526. [Google Scholar] [CrossRef]
- Danielli, N.M.; Trevisan, R.; Mello, D.F.; Fischer, K.; Deconto, V.S.; Acosta, D.d.S.; Bianchini, A.; Dias Bainy, A.C.; Dafre, A.L. Upregulating Nrf2-dependent antioxidant defenses in Pacific oysters Crassostrea gigas: Investigating the Nrf2/Keapl pathway in bivalves. Comp. Biochem. Physiol. C-Toxicol. Pharmacol. 2017, 195, 16–26. [Google Scholar] [CrossRef]
- Bailey, T.L.; Johnson, J.; Grant, C.E.; Noble, W.S. The MEME Suite. Nucleic Acids Res. 2015, 43, W39–W49. [Google Scholar] [CrossRef]
- Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.; Xia, R. TBtools: An Integrative Toolkit Developed for Interactive Analyses of Big Biological Data. Mol. Plant 2020, 13, 1194–1202. [Google Scholar] [CrossRef]
- Grant, C.E.; Bailey, T.L.; Noble, W.S. FIMO: Scanning for occurrences of a given motif. Bioinformatics 2011, 27, 1017–1018. [Google Scholar] [CrossRef]
- Chan, Z.; Yong, Z.H.U.; Shui, X.U. Primary Culture Methods for Invertebrate Cells. Acta Zoonutrimenta Sin. 2011, 23, 203–209. [Google Scholar]
- Auzoux-Bordenave, S.; Fouchereau-Peron, M.; Helleouet, M.-N.; Doumenc, D. CGRP regulates the activity of mantle cells and hemocytes in abalone primary cell cultures (Haliotis tuberculata). J. Shellfish Res. 2007, 26, 887–894. [Google Scholar] [CrossRef]
- Gong, N.; Li, Q.; Huang, J.; Fang, Z.; Zhang, G.; Xie, L.; Zhang, R. Culture of outer epithelial cells from mantle tissue to study shell matrix protein secretion for biomineralization. Cell Tissue Res. 2008, 333, 493–501. [Google Scholar] [CrossRef] [PubMed]
- Mu-nan, H.A.N.; Xiao-hui, C.; Qi-ge, Q.I.; Xiao-ying, J.I.; Kai-shun, B.I. Determination of L-Carnosine and Its Related Substances by HPLC. Chin. Pharm. J. 2009, 44, 1111–1113. [Google Scholar]
- Maeda, K.; Ohno, T.; Igarashi, S.; Yoshimura, T.; Yamashiro, K.; Sakai, M. Aldehyde oxidase 1 gene is regulated by Nrf2 pathway. Gene 2012, 505, 374–378. [Google Scholar] [CrossRef] [PubMed]
- Wheeler, N.J.; Dinguirard, N.; Marquez, J.; Gonzalez, A.; Zamanian, M.; Yoshino, T.P.; Castillo, M.G. Sequence and structural variation in the genome of the Biomphalaria glabrata embryonic (Bge) cell line. Parasites Vectors 2018, 11, 496. [Google Scholar] [CrossRef] [PubMed]
- Tai, W.; Li, F.; Zhang, Z.; Li, C.; He, W.; Yin, D. Improved Antioxidative Efficacy of Turtles May be of Importance for Their Enhanced Longevity. Life Sci. Res. 2004, 8, 8–10. [Google Scholar]
- Nielsen, J.; Hedeholm, R.B.; Heinemeier, J.; Bushnell, P.G.; Christiansen, J.S.; Olsen, J.; Ramsey, C.B.; Brill, R.W.; Simon, M.; Steffensen, K.F.; et al. Eye lens radiocarbon reveals centuries of longevity in the Greenland shark (Somniosus microcephalus). Science 2016, 353, 702–704. [Google Scholar] [CrossRef]
- Ip, Y.K.; Hiong, K.C.; Lim, L.J.Y.; Choo, C.Y.L.; Boo, M.V.; Wong, W.P.; Neo, M.L.; Chew, S.F. Molecular characterization, light-dependent expression, and cellular localization of a host vacuolar-type H+-ATPase (VHA) subunit A in the giant clam, Tridacna squamosa, indicate the involvement of the host VHA in the uptake of inorganic carbon and its supply to the symbiotic zooxanthellae. Gene 2018, 659, 137–148. [Google Scholar] [CrossRef]
- Ip, Y.K.; Koh, C.Z.Y.; Hiong, K.C.; Choo, C.Y.L.; Boo, M.V.; Wong, W.P.; Neo, M.L.; Chew, S.F. Carbonic anhydrase 2-like in the giant clam, Tridacna squamosa: Characterization, localization, response to light, and possible role in the transport of inorganic carbon from the host to its symbionts. Physiol. Rep. 2017, 5, e13494. [Google Scholar] [CrossRef]
- Ip, Y.K.; Hiong, K.C.; Teng, J.H.Q.; Boo, M.V.; Choo, C.Y.L.; Wong, W.P.; Chew, S.F. The fluted giant clam (Tridacna squamosa) increases nitrate absorption and upregulates the expression of a homolog of SIALIN (H+:2NO(3)(-) cotransporter) in the ctenidium during light exposure. Coral Reefs 2020, 39, 451–465. [Google Scholar] [CrossRef]
- Bugno, M.; Daniel, M.; Chepelev, N.L.; Willmore, W.G. Changing gears in Nrf1 research, from mechanisms of regulation to its role in disease and prevention. Biochim. Et Biophys. Acta-Gene Regul. Mech. 2015, 1849, 1260–1276. [Google Scholar] [CrossRef]
- Zhang, Y.; Crouch, D.H.; Yamamoto, M.; Hayes, J.D. Negative regulation of the Nrf1 transcription factor by its N-terminal domain is independent of Keap1: Nrf1, but not Nrf2, is targeted to the endoplasmic reticulum. Biochem. J. 2006, 399, 373–385. [Google Scholar] [CrossRef] [PubMed]
- Husberg, C.; Murphy, P.; Martin, E.; Kolsto, A.B. Two domains of the human bZIP transcription factor TCF11 are necessary for transactivation. J. Biol. Chem. 2001, 276, 17641–17652. [Google Scholar] [CrossRef] [PubMed]
- Motohashi, H.; O’Connor, T.; Katsuoka, F.; Engel, J.D.; Yamamoto, M. Integration and diversity of the regulatory network composed of Maf and CNC families of transcription factors. Gene 2002, 294, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Wu, Y.; Qian, J.; He, Y.; Li, X.; Gong, Y. Research progress in structure, function and expression regulation of transcription factor NRF3. Chin. J. Pathophysiol. 2021, 37, 1493–1498. [Google Scholar]
- Pepe, A.E.; Xiao, Q.; Zampetaki, A.; Zhang, Z.; Kobayashi, A.; Hu, Y.; Xu, Q. Crucial Role of Nrf3 in Smooth Muscle Cell Differentiation From Stem Cells. Circ. Res. 2010, 106, U870–U892. [Google Scholar] [CrossRef]
- Chen, N.; Hu, M.F.; Jiang, T.Y.; Xiao, P.; Duan, J.A. Insights into the molecular mechanisms, structure-activity relationships and application prospects of polysaccharides by regulating Nrf2-mediated antioxidant response. In Carbohydrate Polymers; Elsevier: Amsterdam, The Netherlands, 2024; p. 333. [Google Scholar] [CrossRef]
- Qi, P.Z.; Tang, Z.R. The Nrf2 molecule trigger antioxidant defense against acute benzo(a)pyrene exposure in the thick shell mussel Mytilus coruscus. In Aquatic Toxicology; Elsevier: Amsterdam, The Netherlands, 2020; p. 226. [Google Scholar] [CrossRef]
- Doonan, L.B.; Hartigan, A.; Okamura, B.; Long, P.F. Stress-Free Evolution: The Nrf-Coordinated Oxidative Stress Response in Early Diverging Metazoans. Integr. Comp. Biol. 2019, 59, 799–810. [Google Scholar] [CrossRef]
- Sutherland, M.; Shankaranarayanan, R.; Schewe, T.; Nigam, S. Evidence for the presence of phospholipid hydroperoxide glutathione peroxidase in human platelets: Implications for its involvement in the regulatory network of the 12-lipoxygenase pathway of arachidonic acid metabolism. Biochem. J. 2001, 353, 91–100. [Google Scholar] [CrossRef]
- Zhu, Z.; Fan, X.; Lv, Y.; Lin, Y.; Wu, D.; Zeng, W. Glutamine protects rabbit spermatozoa against oxidative stress via glutathione synthesis during cryopreservation. Reprod. Fertil. Dev. 2017, 29, 2183–2194. [Google Scholar] [CrossRef]
- Choi, H.; Tostes, R.C.; Webb, R.C. Mitochondrial aldehyde dehydrogenase prevents ROS-induced vascular contraction in angiotensin-II hypertensive mice. J. Am. Soc. Hypertens. 2011, 5, 154–160. [Google Scholar] [CrossRef]
- The-Vinh, T.; Shin, E.-J.; Jeong, J.H.; Lee, J.W.; Lee, Y.; Jang, C.-G.; Nah, S.-Y.; Lei, X.G.; Toriumi, K.; Yamada, K.; et al. Protective Potential of the Glutathione Peroxidase-1 Gene in Abnormal Behaviors Induced by Phencyclidine in Mice. Mol. Neurobiol. 2017, 54, 7042–7062. [Google Scholar] [CrossRef]
- Gerlach, V.L.; Feaver, W.J.; Fischhaber, P.L.; Friedberg, E.C. Purification and characterization of pol kappa, a DNA polymerase encoded by the human DINB1 gene. J. Biol. Chem. 2001, 276, 92–98. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Ibrahimi, O.A.; Olsen, S.K.; Umemori, H.; Mohammadi, M.; Ornitz, D.M. Receptor specificity of the fibroblast growth factor family–The complete mammalian FGF family. J. Biol. Chem. 2006, 281, 15694–15700. [Google Scholar] [CrossRef]
- YunWei, D.; ShuangLin, D.; TingTing, J.I. Research Advances in the Heat Shock Proteins in Aquatic Animals. J. Ocean Univ. China 2008, 38, 39–44. [Google Scholar]
- Gartner, J.; Brosius, U.; Obie, C.; Watkins, P.A.; Valle, D. Restoration of PEX2 peroxisome assembly defects by overexpression of PMP70. Eur. J. Cell Biol. 1998, 76, 237–245. [Google Scholar] [CrossRef] [PubMed]
- Song, H.Y.; Rothe, M.; Goeddel, D.V. The tumor necrosis factor-inducible zinc finger protein A20 interacts with TRAF1/TRAF2 and inhibits NF-kappa B activation. Proc. Natl. Acad. Sci. USA 1996, 93, 6721–6725. [Google Scholar] [CrossRef] [PubMed]
- Drozak, J.; Veiga-da-Cunha, M.; Vertommen, D.; Stroobant, V.; Van Schaftingen, E. Molecular Identification of Carnosine Synthase as ATP-grasp Domain-containing Protein 1 (ATPGD1). J. Biol. Chem. 2010, 285, 9346–9356. [Google Scholar] [CrossRef]
- Pan, C.; Wang, C.; Fan, M.; Zhang, X.; Yan, X.; Liao, Z. Quantification of Histidine-containing Dipeptide, and Expression Analysis of Carnosine Synthase /Carnosinase in Mytilus coruscus. Chin. J. Biochem. Mol. Biol. 2020, 36, 1321–1332. [Google Scholar]
- Wang, S.; Zhang, J.; Jiao, W.; Li, J.; Xun, X.; Sun, Y.; Guo, X.; Huan, P.; Dong, B.; Zhang, L.; et al. Scallop genome provides insights into evolution of bilaterian karyotype and development. Nat. Ecol. Evol. 2017, 1, 0120. [Google Scholar] [CrossRef]
- Zhang, G.; Fang, X.; Guo, X.; Li, L.; Luo, R.; Xu, F.; Yang, P.; Zhang, L.; Wang, X.; Qi, H.; et al. The oyster genome reveals stress adaptation and complexity of shell formation. Nature 2012, 490, 49–54. [Google Scholar] [CrossRef]
Target Segment | Purpose | Sequence (5′→3′) |
---|---|---|
TsNfe2l | PCR amplification | ACCACACAAAGAAGAACGCCAAG |
TCACTCATACTTCCGATCATCATGTCT | ||
pGEX4T-1-TsNfe2l construction | CCGCGTGGATCCCCGGAATTCATGTTGAAACAATATTTCACAGATGGT | |
GTCACGATGCGGCCGCTCGAGTCACTCATACTTCCGATCATCATGT | ||
pcDNA3.1-TsNfe2l construction | GCCACCATGTTGAAACAATATTTCACAGATGGT | |
CTCATACTTCCGATCATCATGTCTTT | ||
TAGTCCAGTGTGGTGGAATTCGCCACCATGTTGAAACAATATTTC | ||
GAAGGGCCCTCTAGACTCGAGCTCATACTTCCGATCATCATGTCTTT | ||
qPCR | CGCAGCTCAGAATTGTCGGA | |
AACGGGACGGGTCGTAAGG | ||
TsMafK | PCR amplification | ATGCAGCAGTCGAGTATGAAGC |
TGGTGACGAAGTGAAGATGAAAT | ||
pGEX4T-1-TsMafK construction | CCGCGTGGATCCCCGGAATTCATGCAGCAGTCGAGTATGAAGCA | |
GTCACGATGCGGCCGCTCGAGTTACACCCGCGGCTCTGG | ||
qPCR | CTTCGCAATGAGGTGGATAGATTA | |
GGAAATCATGGGTGGCTTGG | ||
ARE | EMSA probe | GGCCTAACTGGCCGGTACC |
GGTGGCTTTACCAACAGTACCGG | ||
TsNfe2lΔMBR-HNfe2l2MBR | plasmid construction | TAGTCCAGTGTGGTGGAATTCGCCACCATGTTGAAACAATATTTC |
CTACAGGGAATGGAACGTTCAATTCCTGAATTCTTTTG | ||
GAACGTTCCATTCCCTGTAGAAAAAATCATTAA | ||
GAAGGGCCCTCTAGACTCGAGGTTTTTCTTAACATCTGGCTTCTTACT | ||
HNfe2l2ΔMBR-TsNfe2lMBR | plasmid construction | TAGTCCAGTGTGGTGGAATTCATGATGGACTTGGAGCTGCCG |
GTGAAAGGGATATGGAGAGCTTTTGCCCTAA | ||
GCTCTCCATATCCCTTTCACAATGGCACAGATAGTC | ||
GAAGGGCCCTCTAGACTCGAGCTCATACTTCCGATCATCATGTCTTT | ||
HNfe2l2Neh4 + 5-TsNfe2lMBR | plasmid construction | GCCACCATGCCCAAATCAGATGCTTTG |
TAGTCCAGTGTGGTGGAATTCGCCACCATGCCCAAATCA | ||
TGCCATTTTGGCTTCTGGACTTGGAACC | ||
GTCCAGAAGCCAAAATGGCAAACAGAAAAGGTAAAGGT | ||
GAAGGGCCCTCTAGACTCGAGCTCATACTTCCGATCATCATGTCTT | ||
TsATPGD promoter | PCR amplification | ATTAGATATTGTGATACAGCAGACTTGC |
CATCAACAAAGTTAAAGTGCTTCCA | ||
plasmid construction | GCGTGCTAGCCCGGGCTCGAGATTAGATATTGTGATACAGCAGACTTGC | |
CAGTACCGGAATGCCAAGCTTCATCAACAAAGTTAAAGTGCTTCCA | ||
EMSA probe | TTAGATATTGTGATACAGCAGACTTGCGATTAGATATTGTGATACAGCAGACTTGCGA | |
TCGCAAGTCTGCTGTATCACAATATCTAATCGCAAGTCTGCTGTATCACAATATCTAA | ||
Mutated EMSA probe | TTAGATATTGACTTACAGCAGACTTGCGATTAGATATTGACTTACAGCAGACTTGCGA | |
TCGCAAGTCTGCTGTAAGTCAATATCTAATCGCAAGTCTGCTGTAAGTCAATATCTAA | ||
TsATPGD | qPCR | ATCTACGGGACTGGGTGAAACG |
ACTGGTTCCATATCACCTCCTCTG | ||
TsNQO1 | qPCR | ATTTCCTGCGAGTACAACCA |
CAGCCTATTTCTCCCGTCA | ||
TsGPx | qPCR | AGTCATTGTGCCCGAGTGTCT |
TTGTTGCATCTGTGGGTCCTT | ||
TsTNFαP3 | qPCR | GCAAAGCAGGAGGTCAAAATAAC |
CCAAATAATGTGCAGTTCGGTTC | ||
TsDNApolκ | qPCR | CAAGATGTTCTCCAGGTTCG |
CGTTGATAGTTCTGGTGCTTTT | ||
TsPMP | qPCR | GTAGTGCCATTGTTAGAGGGCC |
CTGCCATCTGTCTCCTCTTCACT | ||
TsKeap1 | qPCR | TCCCAAGAAATCGAGTCGGTG |
ATACTGTTAAGCCTTTGCGTGCC | ||
TsGAPDH | qPCR | CTGGTATGGCTTTCCGAGTACCT |
TGCTGCTGTGCTCGTCTCC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, Z.; Wong, N.-K.; Mao, F.; Wu, S.; Yi, W.; Yu, Z.; Zhang, Y. Carnosine Synthase (TsATPGD) Alleviates Lipid Peroxidation Under Transcriptional Control by an Nfe2-like Gene in Tridacna Squamosa. Antioxidants 2024, 13, 1351. https://doi.org/10.3390/antiox13111351
Yang Z, Wong N-K, Mao F, Wu S, Yi W, Yu Z, Zhang Y. Carnosine Synthase (TsATPGD) Alleviates Lipid Peroxidation Under Transcriptional Control by an Nfe2-like Gene in Tridacna Squamosa. Antioxidants. 2024; 13(11):1351. https://doi.org/10.3390/antiox13111351
Chicago/Turabian StyleYang, Zhuo, Nai-Kei Wong, Fan Mao, Siwei Wu, Wenjie Yi, Ziniu Yu, and Yang Zhang. 2024. "Carnosine Synthase (TsATPGD) Alleviates Lipid Peroxidation Under Transcriptional Control by an Nfe2-like Gene in Tridacna Squamosa" Antioxidants 13, no. 11: 1351. https://doi.org/10.3390/antiox13111351
APA StyleYang, Z., Wong, N.-K., Mao, F., Wu, S., Yi, W., Yu, Z., & Zhang, Y. (2024). Carnosine Synthase (TsATPGD) Alleviates Lipid Peroxidation Under Transcriptional Control by an Nfe2-like Gene in Tridacna Squamosa. Antioxidants, 13(11), 1351. https://doi.org/10.3390/antiox13111351