Investigation of the Impact of Hydrogen Bonding Degree in Long Single-Stranded DNA (ssDNA) Generated with Dual Rolling Circle Amplification (RCA) on the Preparation and Performance of DNA Hydrogels
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Apparatus
2.3. Preparation of the Circular Templates
2.4. Preparation of the ssDNA Precursors Using Dual Rolling Circle Amplification (RCA)
2.5. Preparation of DNA Hydrogels with ssDNA Precursors
2.6. Preparation of BSA-Coated Au Nanoparticles (AuNPs–BSA)
2.7. Characterization Methods
3. Results
3.1. Mechanism of the Degree of Hydrogen Bonding Based on Dual RCA Strategy for Regulating the Mechanical Properties of DNA Hydrogels
3.2. Preparation and Characterization of RCA Products
3.3. Preparation and Morphological Characterization of DNA Hydrogels
3.4. Characterization of Mechanical Properties and Microstructure of DNA Hydrogels
3.5. Entrapment Efficiency Test of DNA Hydrogels
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Li, F.; Tang, J.; Geng, J.; Luo, D.; Yang, D. Polymeric DNA hydrogel: Design, synthesis and applications. Prog. Polym. Sci. 2019, 98, 101163. [Google Scholar] [CrossRef]
- Xu, P.F.; Noh, H.; Lee, J.H.; Domaille, D.W.; Nakatsuka, M.A.; Goodwin, A.P.; Cha, J.N. Imparting the unique properties of DNA into complex material architectures and functions. Mater. Today 2013, 16, 290–296. [Google Scholar] [CrossRef] [PubMed]
- Alemdaroglu, F.E.; Herrmann, A. DNA meets synthetic polymers—Highly versatile hybrid materials. Org. Biomol Chem 2007, 5, 1311–1320. [Google Scholar] [CrossRef] [Green Version]
- Cheng, W.; Wu, X.; Zhang, Y.; Wu, D.; Meng, L.; Chen, Y.; Tang, X. Recent applications of hydrogels in food safety sensing: Role of hydrogels. Trends Food Sci. Technol. 2022, 129, 244–257. [Google Scholar] [CrossRef]
- Yang, Z.; Chen, L.; McClements, D.J.; Qiu, C.; Li, C.; Zhang, Z.; Miao, M.; Tian, Y.; Zhu, K.; Jin, Z. Stimulus-responsive hydrogels in food science: A review. Food Hydrocoll. 2022, 124, 107218. [Google Scholar] [CrossRef]
- Li, J.; Mo, L.; Lu, C.H.; Fu, T.; Yang, H.H.; Tan, W. Functional nucleic acid-based hydrogels for bioanalytical and biomedical applications. Chem. Soc. Rev. 2016, 45, 1410–1431. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kahn, J.S.; Hu, Y.; Willner, I. Stimuli-Responsive DNA-Based Hydrogels: From Basic Principles to Applications. Accounts Chem. Res. 2017, 50, 680–690. [Google Scholar] [CrossRef]
- Sheng, J.; Pi, Y.; Zhao, S.; Wang, B.; Chen, M.; Chang, K. Novel DNA nanoflower biosensing technologies towards next-generation molecular diagnostics. Trends Biotechnol. 2023, 41, 653–668. [Google Scholar] [CrossRef]
- Wang, Y.; Zhu, Y.; Hu, Y.; Zeng, G.; Zhang, Y.; Zhang, C.; Feng, C. How to Construct DNA Hydrogels for Environmental Applications: Advanced Water Treatment and Environmental Analysis. Small 2018, 14, 1703305. [Google Scholar] [CrossRef]
- Nnachi, R.C.; Sui, N.; Ke, B.; Luo, Z.; Bhalla, N.; He, D.; Yang, Z. Biosensors for rapid detection of bacterial pathogens in water, food and environment. Environ. Int. 2022, 166, 107357. [Google Scholar] [CrossRef]
- Sun, Z.; Song, C.; Wang, C.; Hu, Y.; Wu, J. Hydrogel-Based Controlled Drug Delivery for Cancer Treatment: A Review. Mol. Pharm. 2020, 17, 373–391. [Google Scholar] [CrossRef]
- Quazi, M.Z.; Park, N. DNA Hydrogel-Based Nanocomplexes with Cancer-Targeted Delivery and Light-Triggered Peptide Drug Release for Cancer-Specific Therapeutics. Biomacromolecules 2023, 24, 2127–2137. [Google Scholar] [CrossRef] [PubMed]
- Um, S.H.; Lee, J.B.; Park, N.; Kwon, S.Y.; Umbach, C.C.; Luo, D. Enzyme-catalysed assembly of DNA hydrogel. Nat. Mater. 2006, 5, 797–801. [Google Scholar] [CrossRef]
- Geng, J.; Yao, C.; Kou, X.; Tang, J.; Luo, D.; Yang, D. A Fluorescent Biofunctional DNA Hydrogel Prepared by Enzymatic Polymerization. Adv. Healthc. Mater. 2018, 7, 1700998. [Google Scholar] [CrossRef] [PubMed]
- Hu, W.; Wang, Z.; Xiao, Y.; Zhang, S.; Wang, J. Advances in crosslinking strategies of biomedical hydrogels. Biomater. Sci. 2019, 7, 843–855. [Google Scholar] [CrossRef] [PubMed]
- Pardo, Y.A.; Yancey, K.G.; Rosenwasser, D.S.; Bassen, D.M.; Butcher, J.T.; Sabin, J.E.; Ma, M.; Hamada, S.; Luo, D. Interfacing DNA hydrogels with ceramics for biofunctional architectural materials. Mater. Today 2022, 53, 98–105. [Google Scholar] [CrossRef]
- Iqbal, S.; Ahmed, F.; Xiong, H. Responsive-DNA hydrogel based intelligent materials: Preparation and applications. Chem. Eng. J. 2021, 420, 130384. [Google Scholar] [CrossRef]
- Xia, X.; Yang, H.; Cao, J.; Zhang, J.; He, Q.; Deng, R. Isothermal nucleic acid amplification for food safety analysis. TrAC Trends Anal. Chem. 2022, 153, 116641. [Google Scholar] [CrossRef]
- Cao, X.; Chen, C.; Zhu, Q. Biosensors based on functional nucleic acids and isothermal amplification techniques. Talanta 2023, 253, 123977. [Google Scholar] [CrossRef]
- Beyer, S.; Nickels, P.; Simmel, F.C. Periodic DNA nanotemplates synthesized by rolling circle amplification. Nano Lett. 2005, 5, 719–722. [Google Scholar] [CrossRef]
- Li, C.; Wang, Y.; Li, P.F.; Fu, Q. Construction of rolling circle amplification products-based pure nucleic acid nanostructures for biomedical applications. Acta Biomater. 2023, 160, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Tang, J.; Liang, A.; Yao, C.; Yang, D. Assembly of Rolling Circle Amplification-Produced Ultralong Single-Stranded DNA to Construct Biofunctional DNA Materials. Chemistry 2023, 29, e202202673. [Google Scholar] [CrossRef] [PubMed]
- Zhang, K.; Lv, S.; Lin, Z.; Li, M.; Tang, D. Bio-bar-code-based photoelectrochemical immunoassay for sensitive detection of prostate specific antigen using rolling circle amplification and enzymatic biocatalytic precipitation. Biosens. Bioelectron. 2018, 101, 159–166. [Google Scholar] [CrossRef] [PubMed]
- Ali, M.M.; Li, F.; Zhang, Z.; Zhang, K.; Kang, D.K.; Ankrum, J.A.; Le, X.C.; Zhao, W. Rolling circle amplification: A versatile tool for chemical biology, materials science and medicine. Chem. Soc. Rev. 2014, 43, 3324–3341. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.B.; Peng, S.; Yang, D.; Roh, Y.H.; Funabashi, H.; Park, N.; Rice, E.J.; Chen, L.; Long, R.; Wu, M.; et al. A mechanical metamaterial made from a DNA hydrogel. Nat. Nanotechnol. 2012, 7, 816–820. [Google Scholar] [CrossRef] [PubMed]
- Mao, X.; Chen, G.; Wang, Z.; Zhang, Y.; Zhu, X.; Li, G. Surface-immobilized and self-shaped DNA hydrogels and their application in biosensing. Chem. Sci. 2018, 9, 811–818. [Google Scholar] [CrossRef] [Green Version]
- Zeng, R.; Huang, Z.; Wang, Y.; Tang, D. Enzyme-encapsulated DNA hydrogel for highly efficient electrochemical sensing glucose. ChemElectroChem 2020, 7, 1537–1541. [Google Scholar] [CrossRef]
- Chen, Q.; Tian, R.; Liu, G.; Wen, Y.; Bian, X.; Luan, D.; Wang, H.; Lai, K.; Yan, J. Fishing unfunctionalized SERS tags with DNA hydrogel network generated by ligation-rolling circle amplification for simple and ultrasensitive detection of kanamycin. Biosens. Bioelectron. 2022, 207, 114187. [Google Scholar] [CrossRef]
- Xu, W.; Huang, Y.; Zhao, H.; Li, P.; Liu, G.; Li, J.; Zhu, C.; Tian, L. DNA Hydrogel with Tunable pH-Responsive Properties Produced by Rolling Circle Amplification. Chemistry 2017, 23, 18276–18281. [Google Scholar] [CrossRef]
- Yao, C.; Zhang, R.; Tang, J.; Yang, D. Rolling circle amplification (RCA)-based DNA hydrogel. Nat. Protoc. 2021, 16, 5460–5483. [Google Scholar] [CrossRef]
- Yao, C.; Tang, H.; Wu, W.; Tang, J.; Guo, W.; Luo, D.; Yang, D. Double Rolling Circle Amplification Generates Physically Cross-Linked DNA Network for Stem Cell Fishing. J. Am. Chem. Soc. 2020, 142, 3422–3429. [Google Scholar] [CrossRef]
- Wang, C.; Zhang, J. Recent Advances in Stimuli-Responsive DNA-Based Hydrogels. ACS Appl. Bio Mater. 2022, 5, 1934–1953. [Google Scholar] [CrossRef]
- Zhang, J.; Huang, H.; Song, G.; Huang, K.; Luo, Y.; Liu, Q.; He, X.; Cheng, N. Intelligent biosensing strategies for rapid detection in food safety: A review. Biosens. Bioelectron. 2022, 202, 114003. [Google Scholar] [CrossRef] [PubMed]
- Lin, X.; Wang, Z.; Jia, X.; Chen, R.; Qin, Y.; Bian, Y.; Sheng, W.; Li, S.; Gao, Z. Stimulus-responsive hydrogels: A potent tool for biosensing in food safety. Trends Food Sci. Technol. 2023, 131, 91–103. [Google Scholar] [CrossRef]
- Wang, H.; Wang, X.; Lai, K.; Yan, J. Stimulus-Responsive DNA Hydrogel Biosensors for Food Safety Detection. Biosensors 2023, 13, 320. [Google Scholar] [CrossRef] [PubMed]
- Yao, S.; Chang, Y.; Zhai, Z.; Sugiyama, H.; Endo, M.; Zhu, W.; Xu, Y.; Yang, Y.; Qian, X. DNA-Based Daisy Chain Rotaxane Nanocomposite Hydrogels as Dual-Programmable Dynamic Scaffolds for Stem Cell Adhesion. ACS Appl. Mater. Interfaces 2022, 14, 20739–20748. [Google Scholar] [CrossRef]
- Hu, Y.; Fan, C. Nanocomposite DNA hydrogels emerging as programmable and bioinstructive materials systems. Chem 2022, 8, 1554–1566. [Google Scholar] [CrossRef]
- Wahid, F.; Zhao, X.-J.; Jia, S.-R.; Bai, H.; Zhong, C. Nanocomposite hydrogels as multifunctional systems for biomedical applications: Current state and perspectives. Compos. Part B Eng. 2020, 200, 108208. [Google Scholar] [CrossRef]
- Lin, X.; Wang, X.; Zeng, L.; Wu, Z.L.; Guo, H.; Hourdet, D. Stimuli-Responsive Toughening of Hydrogels. Chem. Mat. 2021, 33, 7633–7656. [Google Scholar] [CrossRef]
- Zhao, X.; Chen, X.; Yuk, H.; Lin, S.; Liu, X.; Parada, G. Soft Materials by Design: Unconventional Polymer Networks Give Extreme Properties. Chem. Rev. 2021, 121, 4309–4372. [Google Scholar] [CrossRef]
- Jones, M.R.; Seeman, N.C.; Mirkin, C.A. Programmable materials and the nature of the DNA bond. Science 2015, 347, 1260901. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Frens, G. Controlled Nucleation for the Regulation of the Particle Size in Monodisperse Gold Suspensions. Nat. Phys. 1973, 241, 20. [Google Scholar] [CrossRef]
- Wang, W.; Tan, L.; Wu, J.; Li, T.; Xie, H.; Wu, D.; Gan, N. A universal signal-on electrochemical assay for rapid on-site quantitation of vibrio parahaemolyticus using aptamer modified magnetic metal-organic framework and phenylboronic acid-ferrocene co-immobilized nanolabel. Anal. Chim. Acta 2020, 1133, 128–136. [Google Scholar] [CrossRef] [PubMed]
- Nilsson, M.; Malmgren, H.; Samiotaki, M.; Kwiatkowski, M.; Chowdhary, B.P.; Landegren, U. Padlock probes: Circularizing oligonucleotides for localized DNA detection. Science 1994, 265, 2085–2088. [Google Scholar] [CrossRef]
- Wang, J.; Chao, J.; Liu, H.; Su, S.; Wang, L.; Huang, W.; Willner, I.; Fan, C. Clamped Hybridization Chain Reactions for the Self-Assembly of Patterned DNA Hydrogels. Angew. Chem.-Int. Edit. 2017, 56, 2171–2175. [Google Scholar] [CrossRef]
- Ye, D.; Li, M.; Zhai, T.; Song, P.; Song, L.; Wang, H.; Mao, X.; Wang, F.; Zhang, X.; Ge, Z.; et al. Encapsulation and release of living tumor cells using hydrogels with the hybridization chain reaction. Nat. Protoc. 2020, 15, 2163–2185. [Google Scholar] [CrossRef]
- Kahn, J.S.; Trifonov, A.; Cecconello, A.; Guo, W.; Fan, C.; Willner, I. Integration of Switchable DNA-Based Hydrogels with Surfaces by the Hybridization Chain Reaction. Nano Lett. 2015, 15, 7773–7778. [Google Scholar] [CrossRef]
- Pan, W.; Wen, H.; Niu, L.; Su, C.; Liu, C.; Zhao, J.; Mao, C.; Liang, D. Effects of chain flexibility on the properties of DNA hydrogels. Soft Matter 2016, 12, 5537–5541. [Google Scholar] [CrossRef]
- Bosnjak, N.; Silberstein, M.N. Pathways to tough yet soft materials. Science 2021, 374, 150–151. [Google Scholar] [CrossRef]
- Chen, M.; Wang, Y.; Zhang, J.; Peng, Y.; Li, S.; Han, D.; Ren, S.; Qin, K.; Li, S.; Gao, Z. Stimuli-responsive DNA-based hydrogels for biosensing applications. J. Nanobiotechnol. 2022, 20, 40. [Google Scholar] [CrossRef]
- Mo, F.; Jiang, K.; Zhao, D.; Wang, Y.; Song, J.; Tan, W. DNA hydrogel-based gene editing and drug delivery systems. Adv. Drug Deliv. Rev. 2021, 168, 79–98. [Google Scholar] [CrossRef] [PubMed]
- Hua, Z.; Yu, T.; Liu, D.; Xianyu, Y. Recent advances in gold nanoparticles-based biosensors for food safety detection. Biosens. Bioelectron. 2021, 179, 113076. [Google Scholar] [CrossRef] [PubMed]
DNA | Sequences (5′~3′) |
---|---|
Primer 1 | CACAGCTGAGGATAGGACAT |
Primer 2 | GGACATGCAAGCAGAGCACA |
Primer 3 | ATGTCCTATCCTCAGCTGTG |
PL-DNA-1 | Phosphorylated-CTCAGCTGTGATTCATACGTACCAACGCACACAGAATT TTTTTTATGTCCTATC |
PL-DNA-2 | Phosphorylated-TTGCATGTCCAGTTCTTTGTCCTGAGTTTTACTGTGCCT GCTGCTGTGCTCTGC |
PL-DNA-3 | Phosphorylated-CTCAGCTGTGATTCATACGTTGGTACGCACACAGAATT TTTTTTATGTCCTATC |
PL-DNA-4 | Phosphorylated-GATAGGACATAAAAAAAATTCTGTGTGCGTTGGTACGT ATGAATCACAGCTGAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, X.; Wang, H.; Zhang, H.; Yang, T.; Zhao, B.; Yan, J. Investigation of the Impact of Hydrogen Bonding Degree in Long Single-Stranded DNA (ssDNA) Generated with Dual Rolling Circle Amplification (RCA) on the Preparation and Performance of DNA Hydrogels. Biosensors 2023, 13, 755. https://doi.org/10.3390/bios13070755
Wang X, Wang H, Zhang H, Yang T, Zhao B, Yan J. Investigation of the Impact of Hydrogen Bonding Degree in Long Single-Stranded DNA (ssDNA) Generated with Dual Rolling Circle Amplification (RCA) on the Preparation and Performance of DNA Hydrogels. Biosensors. 2023; 13(7):755. https://doi.org/10.3390/bios13070755
Chicago/Turabian StyleWang, Xinyu, Huiyuan Wang, Hongmin Zhang, Tianxi Yang, Bin Zhao, and Juan Yan. 2023. "Investigation of the Impact of Hydrogen Bonding Degree in Long Single-Stranded DNA (ssDNA) Generated with Dual Rolling Circle Amplification (RCA) on the Preparation and Performance of DNA Hydrogels" Biosensors 13, no. 7: 755. https://doi.org/10.3390/bios13070755