The Association between Epidermal Growth Factor Receptor (EGFR) Gene Polymorphisms and Lung Cancer Risk
Abstract
:1. Introduction
2. Materials and Methods
2.1. Subjects
2.2. Blood Sampling
2.3. Genomic DNA Extraction
2.4. Genotyping Analysis
2.5. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Hoffman, R.M.; Sanchez, R. Lung Cancer Screening. Med. Clin. N. Am. 2017, 101, 769–785. [Google Scholar] [CrossRef] [PubMed]
- Inamura, K. Lung Cancer: Understanding Its Molecular Pathology and the 2015 WHO Classification. Front. Oncol. 2017, 7, 193. [Google Scholar] [CrossRef] [PubMed]
- Carnio, S.; Di Stefano, R.F.; Novello, S. Fatigue in lung cancer patients: Symptom burden and management of challenges. Lung Cancer 2016, 7, 73–82. [Google Scholar] [CrossRef] [PubMed]
- Polanski, J.; Jankowska-Polanska, B.; Rosinczuk, J.; Chabowski, M.; Szymanska-Chabowska, A. Quality of life of patients with lung cancer. Onco Targets Ther. 2016, 9, 1023–1028. [Google Scholar] [PubMed]
- Rahal, Z.; El Nemr, S.; Sinjab, A.; Chami, H.; Tfayli, A.; Kadara, H. Smoking and Lung Cancer: A Geo-Regional Perspective. Front. Oncol. 2017, 7, 194. [Google Scholar] [CrossRef] [PubMed]
- El-Telbany, A.; Ma, P.C. Cancer genes in lung cancer: Racial disparities: Are there any? Genes Cancer 2012, 3, 467–480. [Google Scholar] [CrossRef] [PubMed]
- Alberg, A.J.; Brock, M.V.; Ford, J.G.; Samet, J.M.; Spivack, S.D. Epidemiology of lung cancer: Diagnosis and management of lung cancer, 3rd ed: American College of Chest Physicians evidence-based clinical practice guidelines. Chest 2013, 143, e1S–e29S. [Google Scholar] [CrossRef] [PubMed]
- Yang, I.A.; Holloway, J.W.; Fong, K.M. Genetic susceptibility to lung cancer and co-morbidities. J. Thorac. Dis. 2013, 5 (Suppl. S5), S454–S462. [Google Scholar] [PubMed]
- Wee, P.; Wang, Z. Epidermal Growth Factor Receptor Cell Proliferation Signaling Pathways. Cancers 2017, 9, 52. [Google Scholar]
- Morin-Ben Abdallah, S.; Hirsh, V. Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors in Treatment of Metastatic Non-Small Cell Lung Cancer, with a Focus on Afatinib. Front. Oncol. 2017, 7, 97. [Google Scholar] [CrossRef] [PubMed]
- Cruz-Lopez, O.; Conejo-Garcia, A.; Nunez, M.C.; Kimatrai, M.; Garcia-Rubino, M.E.; Morales, F.; Gomez-Perez, V.; Campos, J.M. Novel substituted quinazolines for potent EGFR tyrosine kinase inhibitors. Curr. Med. Chem. 2011, 18, 943–963. [Google Scholar] [CrossRef] [PubMed]
- Araujo, A.; Ribeiro, R.; Azevedo, I.; Coelho, A.; Soares, M.; Sousa, B.; Pinto, D.; Lopes, C.; Medeiros, R.; Scagliotti, G.V. Genetic polymorphisms of the epidermal growth factor and related receptor in non-small cell lung cancer—A review of the literature. Oncologist 2007, 12, 201–210. [Google Scholar] [CrossRef] [PubMed]
- Yamamoto, H.; Toyooka, S.; Mitsudomi, T. Impact of EGFR mutation analysis in non-small cell lung cancer. Lung Cancer 2009, 63, 315–321. [Google Scholar] [CrossRef] [PubMed]
- Yatabe, Y.; Mitsudomi, T. Epidermal growth factor receptor mutations in lung cancers. Pathol. Int. 2007, 57, 233–244. [Google Scholar] [CrossRef] [PubMed]
- Choi, J.E.; Park, S.H.; Kim, K.M.; Lee, W.K.; Kam, S.; Cha, S.I.; Kim, C.H.; Kang, Y.M.; Kim, Y.C.; Han, S.B.; et al. Polymorphisms in the epidermal growth factor receptor gene and the risk of primary lung cancer: A case-control study. BMC Cancer 2007, 7, 199. [Google Scholar] [CrossRef] [PubMed]
- Gou, L.Y.; Niu, F.Y.; Wu, Y.L.; Zhong, W.Z. Differences in driver genes between smoking-related and non-smoking-related lung cancer in the Chinese population. Cancer 2015, 121 (Suppl. S17), 3069–3079. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jou, Y.S.; Lo, Y.L.; Hsiao, C.F.; Chang, G.C.; Tsai, Y.H.; Su, W.C.; Chen, Y.M.; Huang, M.S.; Chen, H.L.; Chen, C.J.; et al. Association of an EGFR intron 1 SNP with never-smoking female lung adenocarcinoma patients. Lung Cancer 2009, 64, 251–256. [Google Scholar] [CrossRef] [PubMed]
- Li, C.; Wei, R.; Jones-Hall, Y.L.; Vittal, R.; Zhang, M.; Liu, W. Epidermal growth factor receptor (EGFR) pathway genes and interstitial lung disease: An association study. Sci. Rep. 2014, 4, 4893. [Google Scholar] [CrossRef] [PubMed]
- Shitara, M.; Sasaki, H.; Yokota, K.; Okuda, K.; Hikosaka, Y.; Moriyama, S.; Yano, M.; Kawaguchi, T.; Kubo, A.; Takada, M.; et al. Polymorphisms in intron 1 of the EGFR gene in non-small cell lung cancer patients. Exp. Ther. Med. 2012, 4, 785–789. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lo, S.F.; Wan, L.; Lin, H.C.; Huang, C.M.; Chen, S.Y.; Liu, S.C.; Tsai, F.J. Association of rheumatoid arthritis risk with EGFR genetic polymorphisms in Taiwan’s Han Chinese population. Rheumatol. Int. 2012, 32, 2301–2306. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Fan, J.; Li, Y.; Lin, S.; Shu, P.; Ni, J.; Qin, S.; Zhang, Z. Polymorphisms in epidermal growth factor receptor (EGFR) and AKT1 as possible predictors of clinical outcome in advanced non-small-cell lung cancer patients treated with EGFR tyrosine kinase inhibitors. Tumour Biol. 2016, 37, 1061–1069. [Google Scholar] [CrossRef] [PubMed]
- Khabour, O.F.; Abu-Rumeh, L.; Al-Jarrah, M.; Jamous, M.; Alhashimi, F. Association of adiponectin protein and ADIPOQ gene variants with lumbar disc degeneration. Exp. Ther. Med. 2014, 8, 1340–1344. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chalela, R.; Curull, V.; Enriquez, C.; Pijuan, L.; Bellosillo, B.; Gea, J. Lung adenocarcinoma: From molecular basis to genome-guided therapy and immunotherapy. J. Thorac. Dis. 2017, 9, 2142–2158. [Google Scholar] [CrossRef] [PubMed]
- Sakuma, Y. Epithelial-to-mesenchymal transition and its role in EGFR-mutant lung adenocarcinoma and idiopathic pulmonary fibrosis. Pathol. Int. 2017, 67, 379–388. [Google Scholar] [CrossRef] [PubMed]
- Kageyama, R.; Merlino, G.T.; Pastan, I. Epidermal growth factor (EGF) receptor gene transcription. Requirement for Sp1 and an EGF receptor-specific factor. J. Biol. Chem. 1988, 263, 6329–6336. [Google Scholar] [PubMed]
- Guo, H.; Xing, Y.; Liu, R.; Chen, S.; Bian, X.; Wang, F.; Yang, C.; Wang, X. −216G/T (rs712829), a functional variant of the EGFR promoter, is associated with the pleural metastasis of lung adenocarcinoma. Oncol. Lett. 2013, 6, 693–698. [Google Scholar] [CrossRef] [PubMed]
- Jung, M.; Cho, B.C.; Lee, C.H.; Park, H.S.; Kang, Y.A.; Kim, S.K.; Chang, J.; Kim, D.J.; Rha, S.Y.; Kim, J.H.; et al. EGFR polymorphism as a predictor of clinical outcome in advanced lung cancer patients treated with EGFR-TKI. Yonsei Med. J. 2012, 53, 1128–1135. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Zhan, Z.; Wu, J.; Zhang, C.; Yang, Y.; Tong, S.; Sun, Z.; Qin, L.; Yang, X.; Dong, W. Association among polymorphisms in EGFR gene exons, lifestyle and risk of gastric cancer with gender differences in Chinese Han subjects. PLoS ONE 2013, 8, e59254. [Google Scholar] [CrossRef] [PubMed]
- Fung, C.; Zhou, P.; Joyce, S.; Trent, K.; Yuan, J.M.; Grandis, J.R.; Weissfeld, J.L.; Romkes, M.; Weeks, D.E.; Egloff, A.M. Identification of epidermal growth factor receptor (EGFR) genetic variants that modify risk for head and neck squamous cell carcinoma. Cancer Lett. 2015, 357, 549–556. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Aboobakar, I.F.; Johnson, W.M.; Stamer, W.D.; Hauser, M.A.; Allingham, R.R. Major review: Exfoliation syndrome; advances in disease genetics, molecular biology, and epidemiology. Exp. Eye Res. 2017, 154, 88–103. [Google Scholar] [CrossRef] [PubMed]
- Shao, S.; Niu, Y.; Zhang, X.; Kong, R.; Wang, J.; Liu, L.; Luo, X.; Zhang, J.; Song, R. Opposite Associations between Individual KIAA0319 Polymorphisms and Developmental Dyslexia Risk across Populations: A Stratified Meta-Analysis by the Study Population. Sci. Rep. 2016, 6, 30454. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sharpley, C.F.; Palanisamy, S.K.; Glyde, N.S.; Dillingham, P.W.; Agnew, L.L. An update on the interaction between the serotonin transporter promoter variant (5-HTTLPR), stress and depression, plus an exploration of non-confirming findings. Behav. Brain Res. 2014, 273, 89–105. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Zha, L.; Liao, D.; Li, X. A Meta-Analysis on the Relations between EGFR R521K Polymorphism and Risk of Cancer. Int. J. Genom. 2014, 2014, 312102. [Google Scholar] [CrossRef] [PubMed]
- Liu, W.; He, L.; Ramirez, J.; Krishnaswamy, S.; Kanteti, R.; Wang, Y.C.; Salgia, R.; Ratain, M.J. Functional EGFR germline polymorphisms may confer risk for EGFR somatic mutations in non-small cell lung cancer, with a predominant effect on exon 19 microdeletions. Cancer Res. 2011, 71, 2423–2427. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Zhang, H.; Wang, D.; Li, X. Association of genetic polymorphisms of EGFR with glioma in a Chinese population. Genet. Test. Mol. Biomark. 2015, 19, 59–62. [Google Scholar] [CrossRef] [PubMed]
- Sjostrom, S.; Andersson, U.; Liu, Y.; Brannstrom, T.; Broholm, H.; Johansen, C.; Collatz-Laier, H.; Henriksson, R.; Bondy, M.; Melin, B. Genetic variations in EGF and EGFR and glioblastoma outcome. Neuro-Oncology 2010, 12, 815–821. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, W.; Wu, X.; Zhang, W.; Montenegro, R.C.; Fackenthal, D.L.; Spitz, J.A.; Huff, L.M.; Innocenti, F.; Das, S.; Cook, E.H., Jr.; et al. Relationship of EGFR mutations, expression, amplification, and polymorphisms to epidermal growth factor receptor inhibitors in the NCI60 cell lines. Clin. Cancer Res. 2007, 13, 6788–6795. [Google Scholar] [CrossRef] [PubMed]
SNP | Primer Pairs | PCR Conditions * | Product Size |
---|---|---|---|
rs2072454 | 5′CATAAATGCGAAGAGCACATGCATCCTTC′3 5′CTGACTATGTCCCGCCACTGGATGCTCTCCG′3 | 35 cycles: 94 °C for 1 min, 66 °C for 45 s and 72 °C for 45 s. | 166 |
rs11543848 | 5′TCTGCCATGCCTTGTGCTCC′3 5′CCTGGAGCCTTATTTTTGATC′3 | 35 cycles: 94 °C for 1 min, 56 °C for 45 s and 72 °C for 45 s. | 171 |
rs712829 & rs712830 | 5′GAGCTAGACGTCCGGGCA′3 5′GCTCTCCCGATCAATACTGGA′3 | 35 cycles: 94 °C for 1 min, 64 °C for 60 s and 72 °C for 1 min. | 240 |
Variable | Lung Cancer Patients (n = 129) | Controls (n = 129) | p-Value |
---|---|---|---|
Age (years) | 61.8 ± 0.9 | 62.0 ± 0.8 | 0.94 |
Gender | |||
Males | 105 (81.4%) | 105 (81.4%) | 1.0 |
Females | 24 (18.6%) | 24 (18.6%) | |
Smoking status | |||
Smokers | 91 (70.5%) | 92 (71.3%) | 0.92 |
Ex-smokers | 11 (8.5%) | 11 (8.5%) | |
Non-smokers | 22 (17%) | 23 (17.8%) | |
Unknown | 5 (4%) | 3 (2.3%) |
SNP ID | Genotypic/Allele Pattern | Patients Frequencies | Controls Frequencies | p-Value |
---|---|---|---|---|
rs712829 | GG | 36 (29%) | 29 (22%) | <0.05 |
TT | 21 (17%) | 35 (27%) | ||
GT | 67 (54%) | 65 (50%) | ||
rs712830 | CC | 116 (93%) | 121 (94%) | 0.75 |
CA | 9 (7%) | 8 (6%) | ||
rs2072454 | CC | 19 (15%) | 15 (12%) | 0.60 |
TT | 60 (47%) | 57 (44%) | ||
CT | 50 (39%) | 57 (44%) | ||
rs11543848 | AA | 24 (19%) | 26 (20%) | 0.90 |
GG | 16 (13%) | 18 (14%) | ||
GA | 87 (69%) | 85 (66%) |
Haplotype | Rs29 | Rs30 | Rs54 | Rs48 | Frequency | Odd Ratio (95% CI) | p-Value |
---|---|---|---|---|---|---|---|
1 | T | C | T | A | 0.237 | 1.00 | --- |
2 | G | C | T | G | 0.1926 | 1.20 (0.31–4.61) | 0.79 |
3 | G | C | T | A | 0.1534 | 0.25 (0.03–21.82) | 0.17 |
4 | T | C | T | G | 0.1374 | 0.86 (0.13–5.54) | 0.88 |
5 | G | C | C | A | 0.0838 | 0.31 (0.03–3.30) | 0.33 |
6 | T | C | C | A | 0.0776 | 2.49 (0.24–26.01) | 0.45 |
7 | G | C | C | G | 0.0528 | 0.00 (inf-inf) | 1 |
8 | T | C | C | G | 0.0416 | 996,206 (996,198–996,214) | <0.001 |
9 | G | A | T | G | 0.0233 | 2.00 (0.11–35.14) | 0.64 |
Genotypes/Allele Pattern | Patients | Controls | p-Value |
---|---|---|---|
For rs712829 | |||
GG | 12 (28%) | 29 (22%) | 0.020 |
TT | 4 (9%) | 35 (27%) | |
GT | 27 (63%) | 65 (50%) | |
For rs712830 | |||
CC | 41 (95%) | 121 (94%) | 0.670 |
CA | 2 (5%) | 8 (6%) | |
For rs2072454 | |||
CC | 6 (14%) | 15 (12%) | 0.027 |
TT | 26 (60%) | 57 (44%) | |
CT | 11 (26%) | 57 (44%) | |
For rs11543848 | |||
AA | 8 (19%) | 26 (20%) | 0.073 |
GG | 2 (5%) | 18 (14%) | |
GA | 33 (77%) | 85 (66%) |
Haplotype | Rs29 | Rs30 | Rs54 | Rs48 | Frequency | Odd Ratio (95% CI) | p-Value |
---|---|---|---|---|---|---|---|
1 | T | C | T | A | 0.2118 | 1.00 | --- |
2 | G | C | T | A | 0.1748 | 1.00 (0.31–3.24) | 1 |
3 | G | C | T | G | 0.1552 | 0.93 (0.34–2.55) | 0.9 |
4 | T | C | T | G | 0.1228 | 1.38 (0.32–5.96) | 0.66 |
5 | G | C | C | G | 0.0953 | 1.08 (0.31–3.67) | 0.91 |
6 | T | C | C | A | 0.0794 | 1.46 (0.33–6.43) | 0.62 |
7 | G | C | C | A | 0.0681 | 0.69 (0.15–3.15) | 0.63 |
8 | T | C | C | G | 0.0629 | 168,507 (168,498–168,517) | <0.001 |
9 | G | A | T | G | 0.0156 | 0.71 (0.08–6.39) | 0.76 |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bashir, N.A.; Ragab, E.S.; Khabour, O.F.; Khassawneh, B.Y.; Alfaqih, M.A.; Momani, J.A. The Association between Epidermal Growth Factor Receptor (EGFR) Gene Polymorphisms and Lung Cancer Risk. Biomolecules 2018, 8, 53. https://doi.org/10.3390/biom8030053
Bashir NA, Ragab ES, Khabour OF, Khassawneh BY, Alfaqih MA, Momani JA. The Association between Epidermal Growth Factor Receptor (EGFR) Gene Polymorphisms and Lung Cancer Risk. Biomolecules. 2018; 8(3):53. https://doi.org/10.3390/biom8030053
Chicago/Turabian StyleBashir, Nabil A., Entesar S. Ragab, Omar F. Khabour, Basheer Y. Khassawneh, Mahmoud A. Alfaqih, and Jafar A. Momani. 2018. "The Association between Epidermal Growth Factor Receptor (EGFR) Gene Polymorphisms and Lung Cancer Risk" Biomolecules 8, no. 3: 53. https://doi.org/10.3390/biom8030053