Gene Expression Analysis of Microtubers of Potato Solanum tuberosum L. Induced in Cytokinin Containing Medium and Osmotic Stress
Abstract
:1. Introduction
2. Results
2.1. Microtuber Induction
2.2. Interaction Analysis of Proteins Directly Involved in Microtuberization
2.3. Gene Expression Analysis during Microtuberization
3. Discussion
4. Materials and Methods
4.1. Plant Material
4.1.1. Potato Shoot Micropropagation
4.1.2. Potato Microtuber Induction
4.1.3. Isolation of RNA and qPCR Analysis
4.1.4. Interaction Analysis of Proteins Directly Involved in Tuberization
5. Conclusions
- Microtubers were suitable plant material for the analysis of gene expression.
- High content of sucrose (8%) and gelrite (6 g/L) enhances microtuber number, size and germination compared to non-osmotic medium.
- Differential gene expression of genes analyzed in microtubers induced under osmotic stress confirmed the hypothesis that TCS and cytokinin signaling are coupled with genes that have been associated in tuberization.
- Improvement of the understanding in molecular mechanisms involved in potato microtuberization was achieved by STRING database bioinformatic tool.
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Birch, P.R.; Bryan, G.; Fenton, B.; Gilroy, E.M.; Hein, I.; Jones, J.T.; Prashar, M.A.; Taylor, M.A.; Torrance, L.; Toth, I.K. Crops that feed the world 8: Potato: Are the trends of increased global production sustainable? Food Secur. 2012, 4, 477–508. [Google Scholar] [CrossRef]
- Food and Agriculture Organization of the United Nations, Land Resources. FAO. 2017. Available online: http://www.fao.org/nr/land/databasesinformation-systems/en/ (accessed on 15 June 2017).
- Jackson, S.D. Multiple signaling pathways control tuber induction in potato. Plant Physiol. 1999, 119, 1–8. [Google Scholar] [CrossRef] [Green Version]
- Fernie, A.; Willmitzer, L. Molecular and Biochemical Triggers Development of Potato Tuber. Plant Physiol. 2001, 127, 1459–1465. [Google Scholar] [CrossRef] [PubMed]
- Visser, R.G.F.; Vreugdenhil, D.; Hendricks, T.; Jacobsen, E. Gene expression and carbohydrate content during stolon to tuber transition in potatoes (Solanum tuberosum). Physiol. Plant. 1994, 90, 285–292. [Google Scholar] [CrossRef]
- Farre, E.M.; Geigenberger, P.; Willmitzer, L.; Trethewey, R.N. A possible role for pyrophosphate in the coordination of cytosolic and plastidial carbon metabolism within the potato tuber. Plant Physiol. 2000, 123, 681–688. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Maharishi Tomar, R.; Changan, S.S. Potato Vitamins 7. In Potato: Nutrition and Food Security; Springer Nature Singapore Pte Ltd.: Singapore, 2020; p. 113. [Google Scholar]
- Hendriks, T.; Vreugdenhil, D.; Stiekema, W.J. Patatin and four serine proteinase inhibitor genes are differentially expressed during potato tuber development. Plant Mol. Biol. 1991, 17, 385–394. [Google Scholar] [CrossRef] [PubMed]
- Shewry, P.R. Tuber storage proteins. Ann. Bot. 2003, 91, 755–769. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wattimena, G.A. Micropropagation as an Alternative Technology for Potato Production in Indonesia. Ph.D. Thesis, University of Wisconsin-Madison, Madison, WI, USA, 1983; 202p. [Google Scholar]
- Abbott, A.J.; Belcher, A.R. Potato tuber formation in vitro. In Plant Tissue Culture and It’s Agricultural Application; Withers, L.A., Alderson, P.G., Eds.; Butterworths: London, UK, 1986; pp. 113–122. [Google Scholar]
- Lewis, C.E.; Walker, J.R.L.; Lancaster, J.E.; Conner, A.J. Light regulation of anthocyanin, flavonoid and phenolic acid biosynthesis in potato minitubers in vitro. Anst. J. Plant Physiol. 1998, 125, 915–922. [Google Scholar] [CrossRef]
- Mandolino, G.; de Marco, V.S.; Faeti, M.; Bagatta, A.; Carboni, P.; Ranalli, P. Stability of fingerprints of Solanum tuberosum plants derived from conventional tubers and vitrotubers. Plant Breed. 1996, 115, 439–444. [Google Scholar] [CrossRef]
- International Potato Center. CIP. 2018. Available online: https://cipotato.org/es/ (accessed on 15 March 2018).
- Baker, W.G. A method for the in vitro culturing of potato tuber. Science 1953, 118, 384. [Google Scholar] [CrossRef]
- Mes, M.G.; Menge, I. Potato shoot and tuber cultures in vitro. Physiol. Plant. 1954, 7, 637–649. [Google Scholar] [CrossRef]
- Donnelly, D.J.; Coleman, W.K.; Coleman, S.E. Potato microtuber production and performance: A review. Am. J. Potato Res. 2003, 80, 103–115. [Google Scholar] [CrossRef]
- Hannapel, D.J. Signalling the induction of tuber formation. In Potato Biology and Biotechnology: Advances and Perspectives; Vreug-denhil, D., Ed.; Elsevier: Amsterdam, The Netherlands, 2007; pp. 237–256. [Google Scholar]
- Vinterhalter, D.; Dragićević, I.; Vinterhalter, B. Potato in vitro culture techniques and biotechnology. In Fruit, Vegetable and Cereal Science and Biotechnology; Benkeblia, N., Tennant, P., Potato, I., Eds.; (Special Issue 1); Global Science Books; Kagawa University: Kagawa, Japan, 2008; Volume 2, pp. 16–45. [Google Scholar]
- Wakasa, Y.; Kasai, A.; Yamazaki, M.; Tabei, Y.; Tsuyama, M.; Igarashi, T.; Akada, S. Rapid analysis of GBSS1 and Vinv genes expressed in potato tubers using microtubers produced in liquid culture medium. Plant Cell Rep. 2020, 39, 1415–1424. [Google Scholar] [CrossRef] [PubMed]
- Khuri, S.; Moorby, J. Investigations into the role of sucrose in potato cv. Estima microtuber production in vitro. Ann. Bot. 1995, 75, 295–303. [Google Scholar] [CrossRef]
- Perl, A.; Aviv, D.; Willmitzer, L.; Galun, E. In vitro tuberization in transgenic potatoes harboring ß-glucoronidase linked to a patatin promoter: Effects of sucrose levels and photoperiods. Plant Sci. 1991, 73, 87–95. [Google Scholar] [CrossRef]
- Yu, W.C.; Joyce, P.J.; Cameron, D.C.; McCown, B.H. Sucrose utilization during potato microtuber growth in bioreactors. Plant Cell Rep. 2000, 19, 407–413. [Google Scholar] [CrossRef] [PubMed]
- Sauer, M.; Robert, S.; Kleine-Vehn, J. Auxin: Simply complicated. J. Exp. Bot. 2013, 64, 2565–2577. [Google Scholar] [CrossRef] [Green Version]
- El-Antably, H.M.M.; Wareing, P.F.; Hillman, J. Some physiological responses to DL-abscisin (dormin). Planta 1967, 73, 74–90. [Google Scholar] [CrossRef]
- Abdullah, Z.U.N.; Ahmad, R. Effect of ABA and GA3 on tuberization and some chemical constituents of potato. Plant Cell Physiol. 1980, 21, 1343–1346. [Google Scholar]
- Menzel, C.M. Tuberization in potato (Solanum tuberosum cultivar Sebago) at high temperatures: Responses to gibberellin and growth inhibitors. Anna Bot. 1980, 46, 259–266. [Google Scholar] [CrossRef]
- Suttle, J.C. Involvement of endogenous gibberellins in potato tuber dormancy and early sprout growth: A critical assessment. J. Plant Physiol. 2004, 161, 157–164. [Google Scholar] [CrossRef] [PubMed]
- Yamaguchi, S. Gibberellin metabolism and its regulation. Annu. Rev. Plant Biol. 2008, 59, 225–251. [Google Scholar] [CrossRef]
- Roumeliotis, E.; Kloosterman, B.; Oortwijn, M.; Kohlen, W.; Bouwmeester, H.J.; Visser, R.G.; Bachem, C.W. The effects of auxin and strigolactones on tuber initiation and stolon architecture in potato. J. Exp. Bot. 2012, 63, 4539–4547. [Google Scholar] [CrossRef]
- Xu, X.; Van Lammeren, A.M.M.; Vermeer, E.; Vreugdenhil, D. The role of gibberellin, absciscic acid, and sucrose in the regulation of potato tuber formation in vitro. Plant Physiol. 1998, 117, 575–584. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Melis, R.J.M.; van Staden, J. Tuberization and hormones. Z. Pflanz. Physiol. 1984, 11, 271–283. [Google Scholar] [CrossRef]
- Koda, Y.; Kikuta, Y.; Tazaki, H.; Tsujino, Y.; Sakamura, S.; Yoshihara, T. Potato tuber-inducing activities of jasmonic acid and related compounds. Phytochemistry 1991, 30, 1435–1438. [Google Scholar] [CrossRef]
- Pelacho, A.M.; Mingo-Castel, A.M. Jasmonic acid induces tuberization of potato stolons cultured in vitro. Plant Physiol. 1991, 97, 1253–1255. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Van den Berg, J.H.; Ewing, E.E. Jasmonates and their role in plant growth and development, with special reference to the control of potato tuberization: A review. Am. Potato J. 1991, 68, 781–794. [Google Scholar] [CrossRef]
- Koda, Y. Possible involvement of jasmonates in various morphogenic events. Physiol. Plant. 1997, 100, 639–646. [Google Scholar] [CrossRef]
- Barker, J.; Mapson, L.W. Studies in the respiratory and carbohydrate metabolism of plant tissues-Experimental studies of the formation of carbon dioxide and of the changes in lactic acid, sucrose and in certain fractions of keto-acids in potato tubers in air following anaerobic conditions. Proc. R. Soc. Lond. B. 1953, 141, 321–337. [Google Scholar]
- Palmer, C.E.; Smith, O.E. Cytokinins and tuber initiation in the potato Solanum tuberosum. Nature 1969, 221, 279–280. [Google Scholar] [CrossRef]
- Palmer, C.E.; Smith, O.E. Effect of kinetin on tuber formation on isolated stolons of Solanum tuberosum L. cultured in vitro. Plant Cell Physiol. 1970, 11, 303–314. [Google Scholar] [CrossRef]
- Van Staden, J.; Dimalla, G.G. Endogenous cytokinins and tuberization in the potato (Solanum tuberosum L.). Ann. Bot. 1976, 40, 1117–1119. [Google Scholar] [CrossRef]
- Sugiyama, T.; Hashizume, T. Cytokinins in developing tuberous roots of sweet potato. Agric. Biol. Chem. 1989, 53, 49–52. [Google Scholar]
- Frugier, F.; Kosuta, S.; Murray, J.D.; Crespi, M.; Szczyglowski, K. Cytokinin: Secret agent of symbiosis. Trends Plant Sci. 2008, 13, 115–120. [Google Scholar] [CrossRef]
- Miri, M.; Janakirama, P.; Held, M.; Ross, L.; Szczyglowski, K. Into the root: How cytokinin controls rhizobial infection. Trends Plant Sci. 2016, 21, 178–186. [Google Scholar] [CrossRef]
- Chen, H.; Rosin, F.M.; Prat, S.; Hannapel, D.J. Interacting transcription factors from the three-amino acid loop extension superclass regulate tuber formation. Plant Physiol. 2003, 132, 1391–1404. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Eviatar-Ribak, T.; Shalit-Kaneh, A.; Chappell-Maor, L.; Amsellem, Z.; Eshed, Y.; Lifschitz, E. A cytokinin-activating enzyme promotes tuber formation in tomato. Curr. Biol. 2013, 23, 1057–1064. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zwack, P.J.; Rashotte, A.M. Interactions between cytokinin signalling and abiotic stress responses. J. Exp. Bot. 2015, 66, 4863–4871. [Google Scholar] [CrossRef] [Green Version]
- Brütting, C.; Schäfer, M.; Vanková, R.; Gase, K.; Baldwin, I.T.; Meldau, S. Changes in cytokinins are sufficient to alter developmental patterns of defense metabolites in Nicotiana attenuata. Plant J. 2017, 89, 15–30. [Google Scholar] [CrossRef] [Green Version]
- Thu, N.B.A.; Hoang, X.L.T.; Truc, M.T.; Sulieman, S.; Thao, N.P.; Tran, L.P. Cytokinin signaling in plant response to abiotic stresses. In Mechanism of Plant Hormone Signaling Under Stress; Pandey, G., Ed.; John Wiley and Sons, Inc.: New Delhi, India, 2017; Volume 1, pp. 71–100. [Google Scholar]
- Kolachevskaya, O.O.; Alekseeva, V.V.; Sergeeva, L.I.; Rukavtsova, E.B.; Getman, I.A.; Vreugdenhil, D.; Buryanov, Y.I.; Romanov, G.A. Expression of auxin synthesis gene tms1 under control of tuber-specific promoter enhances potato tuberization in vitro. J. Int. Plant Biol. 2015, 57, 734–744. [Google Scholar] [CrossRef] [PubMed]
- Kolachevskaya, O.O.; Sergeeva, L.I.; Floková, K.; Getman, I.A.; Lomin, S.N.; Alekseeva, V.V.; Rukavtsova, E.B.; Buryanov, Y.I.; Romanov, G.A. Auxin synthesis gene tms1 driven by tuber-specific promoter alters hormonal status of transgenic potato plants and their responses to exogenous phytohormones. Plant Cell Rep. 2017, 36, 419–435. [Google Scholar] [CrossRef]
- Wang, D.; Cheng, L.; Wang, Y.; Zhang, F. Comparative proteomic analysis of potato (Solanum tuberosum L.) tuberization in vitro regulated by IAA. Am. J. Potato Res. 2018, 18, 440–446. [Google Scholar] [CrossRef]
- Lomin, S.N.; Myakushina, Y.A.; Kolachevskaya, O.O.; Getman, I.A.; Arkhipov, D.V.; Savelieva, E.M.; Romanov, G.A. Cytokinin perception in potato: New features of canonical players. J. Exp. Bot. 2018, 69, 3839–3853. [Google Scholar] [CrossRef] [PubMed]
- Arkhipov, D.V.; Lomin, S.N.; Myakushina, Y.A.; Savelieva, E.M.; Osolodkin, D.I.; Romanov, G.A. Modeling of Protein–Protein Interactions in Cytokinin Signal Transduction. Int. J. Mol. Sci. 2019, 20, 2096. [Google Scholar] [CrossRef] [Green Version]
- Hwang, I.; Chen, H.C.; Sheen, J. Two-component signal transduction pathways in Arabidopsis. Plant Physiol. 2002, 129, 500–515. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kakimoto, T. Perception and signal transduction of cytokinins. Ann. Rev. Plant Biol. 2003, 54, 605–627. [Google Scholar] [CrossRef] [PubMed]
- Heyl, A.; Schmülling, T. Cytokinin signal perception and transduction. Curr. Opin. Plant Biol. 2003, 6, 480–488. [Google Scholar] [CrossRef]
- Mizuno, T. Plant response regulators implicated in signal transduction and circadian rhythm. Curr. Opin. Plant Biol. 2004, 7, 499–505. [Google Scholar] [CrossRef]
- Ferreira, F.J.; Kieber, J.J. Cytokinin signaling. Curr. Opin. Plant Biol. 2005, 8, 518–525. [Google Scholar] [CrossRef]
- Aloni, R.; Aloni, E.; Langhans, M.; Ullrich, C.I. Role of cytokinin and auxin in shaping root architecture: Regulating vascular differentiation, lateral root initiation, root apical dominance and root gravitropism. Ann. Bot. 2006, 97, 883–893. [Google Scholar] [CrossRef]
- Müller, B.; Sheen, J. Advances in cytokinin signaling. Science 2007, 318, 68–69. [Google Scholar] [CrossRef]
- Cheng, L.; Wang, D.; Wang, Y.; Xue, H.; Zhang, F. An integrative overview of physiological and proteomic changes of cytokinin-induced potato (Solanum tuberosum L.) tuber development in vitro. Physiol. Plant. 2020, 168, 675–693. [Google Scholar] [CrossRef]
- Murashige, T.; Skoog, F. A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol. Plant. 1962, 15, 473–497. [Google Scholar] [CrossRef]
- Sarkar, B.; Mondal, S.S.; Nayek, S.S.; Saha, M.; Biswas, S. Integrated nutrient management for the productivity and quality improvement of potato under irrigated condition. Potato J. 2007, 34, 1–2. [Google Scholar]
- Dutt, S.; Manjul, A.S.; Raigond, P.; Singh, B.; Siddappa, S.; Bhardwaj, V.; Kardile, H.B. Key players associated with tuberization in potato: Potential candidates for genetic engineering. CRC Crit. Rev. Biotechnol. 2017, 37, 942–957. [Google Scholar] [CrossRef]
- Hannapel, D.J.; Sharma, P.; Lin, T.; Banerjee, A.K. The multiple signals that control tuber formation. Plant Physiol. 2017, 174, 845–856. [Google Scholar] [CrossRef] [Green Version]
- Klimaszewska, K.; Cyr, D.R.; Sutton, B.C.S. Influence of gelling agents on culture medium gel strength, water availability, tissue water potential, and maturation response in embryogenic cultures of Pinus strobus L. In Vitro Cell. Dev. Biol. Anim. 2000, 36, 279–286. [Google Scholar] [CrossRef]
- Hadeler, B.; Scholz, S.; Reski, R. Gelrite and agar differently influence cytokinin-sensitivity of a moss. J. Plant Physiol. 1995, 146, 369–371. [Google Scholar] [CrossRef]
- Scherer, P.A.; Müller, E.; Lippert, H.; Wolff, G. Multielement analysis of agar and gelrite impurities investigated by inductively coupled plasma emission spectrometry as well as physical properties of tissue culture media prepared with agar or the gellan gum gelrite. Acta Hortic. 1988, 226, 655–658. [Google Scholar] [CrossRef]
- Tran, L.S.P.; Nishiyama, R.; Yamaguchi-Shinozaki, K.; Shinozaki, K. Potential utilization of NAC transcription factors to enhance abiotic stress tolerance in plants by biotechnological approach. GM Crops 2010, 1, 32–39. [Google Scholar] [CrossRef] [PubMed]
- Hare, P.D.; Cress, W.A. Metabolic implications of stress-induced proline accumulation in plants. Plant Growth Regul. 1997, 21, 79–102. [Google Scholar] [CrossRef]
- Singh, K.K. The Saccharomyces cerevisiae Sln1p-Ssk1p two-component system mediates response to oxidative stress and in an oxidant-specific fashion. Free Radic. Biol. Med. 2000, 29, 1043–1050. [Google Scholar] [CrossRef]
- Bacete, L.; Hamann, T. The role of mechanoperception in plant cell wall integrity maintenance. Plants 2020, 9, 574. [Google Scholar] [CrossRef]
- Kiba, T.; Aoki, K.; Sakakibara, H.; Mizun, T. Arabidopsis response regulator, ARR22, ectopic expression of which results in phenotypes similar to the wol cytokinin-receptor mutant. Plant Cell Physiol. 2004, 45, 1063–1077. [Google Scholar] [CrossRef]
- Urao, T.A. Transmembrane Hybrid-Type in Arabidopsis Histidine Kinase Functions as an osmosensor. Plant Cell 1999, 11, 1743–1754. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tran, P.; Urao, T.; Qin, F.; Maruyama, K.; Kakimoto, T.; Shinozaki, K.; Shinozaki-Yamaguchi, K. Functional analysis of AHK1/ATHK1 and cytokinin receptor histidine kinases in response to abscisic acid, drought, and salt stress in Arabidopsis. Proc. Natl. Acad. Sci. USA 2007, 104, 20623–20628. [Google Scholar] [CrossRef] [Green Version]
- Nguyen, K.; Ha, C.; Nishiyama, A.; Watanabe, Y.; Leyva-Gonzalez, M.; Fujita, Y.; Tran, U.; Li, W.; Tanaka, M.; Seki, M.; et al. Arabidopsis cytokinin type B response regulators ARR1, ARR10, and ARR12 negatively regulate plant responses to drought. Proc. Natl. Acad. Sci. USA 2007, 113, 3090–3095. [Google Scholar] [CrossRef] [Green Version]
- Nishiyama, R.; Watanabe, Y.; Fujita, Y.; Le, D.T.; Kojima, M.; Werner, T.; Tran, L.S.P. Analysis of cytokinin mutants and regulation of cytokinin metabolic genes reveals important regulatory roles of cytokinins in drought, salt and abscisic acid responses, and abscisic acid biosynthesis. Plant Cell 2011, 23, 2169–2183. [Google Scholar] [CrossRef] [Green Version]
- Vahdati, K.; Bayat, S.; Ebrahimzadeh, H.; Jariteh, M.; Mirmasoumi, M. Effect of exogenous ABA on somatic embryo maturation and germination in Persian walnut (Juglans regia L.). Plant Cell Tiss. Org. 2008, 93, 163–171. [Google Scholar] [CrossRef]
- Wang, R.S.; Pandey, S.; Li, S.; Gookin, T.E.; Zhao, Z.; Albert, R.; Assmann, S.M. Common and unique elements of the ABA-regulated transcriptome of Arabidopsis guard cells. BMC Genom. 2011, 12, 1–24. [Google Scholar]
- Hwang, H.; Hong, J.W.; Lee, Y.N.; Ahn, I.P.; Yoon, I.S.; Kim, B.G. A rice orthologue of the ABA receptor, OsPYL/RCAR5, is a positive regulator of the ABA signal transduction pathway in seed germination and early seedling growth. J. Exp. Bot. 2012, 63, 1013–1024. [Google Scholar]
- Ochatt, S.J.; Revilla, M.A. From stress to embryos: Some of the problems for induction and maturation of somatic embryos. In In Vitro Embryogenesis in Higher Plants; Humana Press: New York, NY, USA, 2016; Volume 1, pp. 523–536. [Google Scholar]
- Bleecker, A.B.; Kende, H. Ethylene: A gaseous signal molecule in plants. Ann. Rev. Cell Dev. Biol. 2000, 16, 1–18. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wohlbach, D.J.; Quirino, B.F.; Sussman, M.R. Analysis of the Arabidopsis histidine kinase ATHK1 reveals a connection between vegetative osmotic stress sensing and seed maturation. Plant Cell 2008, 20, 1101–1117. [Google Scholar] [CrossRef] [Green Version]
- Kumar, M.N.; Jane, W.N.; Verslues, P.E. Role of the putative osmosensor Arabidopsis histidine kinase1 in dehydration avoidance and low-water-potential response. Plant Physiol. 2013, 161, 942–953. [Google Scholar] [CrossRef] [Green Version]
- Singh, M.; Kumar, J.; Singh, S.; Singh, V.P.; Prasad, S.M. Roles of osmoprotectants in improving salinity and drought tolerance in plants: A review. Rev. Environ. Sci. Biol./Technol. 2015, 14, 407–426. [Google Scholar] [CrossRef]
- Jeon, J.; Kim, J. Arabidopsis response Regulator1 and Arabidopsis histidine phosphotransfer Protein2 (AHP2), AHP3, and AHP5 function in cold signaling. Plant Physiol. 2013, 161, 408–424. [Google Scholar] [CrossRef] [Green Version]
- Jeon, J.; Cho, C.; Lee, M.R.; Van Binh, N.; Kim, J. CYTOKININ RESPONSE FACTOR2 (CRF2) and CRF3 regulate lateral root development in response to cold stress in Arabidopsis. Plant Cell 2016, 28, 1828–1843. [Google Scholar] [CrossRef] [Green Version]
- Cortleven, A.; Leuendorf, J.E.; Frank, M.; Pezzetta, D.; Bolt, S.; Schmülling, T. Cytokinin action in response to abiotic and biotic stresses in plants. Plant Cell Environ. 2019, 42, 998–1018. [Google Scholar] [CrossRef]
- Meng, W.J.; Cheng, Z.J.; Sang, Y.L.; Zhang, M.M.; Rong, X.F.; Wang, Z.W. Type-B ARABIDOPSIS RESPONSE REGULATORS specify the shoot stem cell niche by dual regulation of WUSCHEL. Plant Cell 2017, 29, 1357–1372. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hakman, I.; Hallberg, H.; Palovaara, J. The polar auxin transport inhibitor NPA impairs embryo morphology and increases the expression of an auxin efflux facilitator protein PIN during Picea abies somatic embryo development. Tree Physiol. 2009, 29, 483–496. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Su, Y.H.; Liu, Y.B.; Bai, B.; Zhang, X.S. Establishment of embryonic shoot-root axis is involved in auxin and cytokinin response during Arabidopsis somatic embryogenesis. Front. Plant Sci. 2015, 5, 792–801. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rosin, F.M.; Hart, J.K.; Horner, H.T.; Davies, P.J.; Hannapel, D.J. Overexpression of a knotted-like homeobox gene of potato alters vegetative development by decreasing gibberellin accumulation. Plant Physiol. 2003, 132, 106–117. [Google Scholar] [CrossRef] [Green Version]
- Nagasaki, H.; Sakamoto, T.; Sato, Y.; Matsuoka, M. Functional analysis of the conserved domains of a rice KNOX homeodomain protein, OSH15. Plant Cell 2001, 13, 2085–2098. [Google Scholar] [CrossRef] [Green Version]
- Bellaoui, M.; Pidkowich, M.S.; Samach, A.; Kushalappa, K.; Kohalmi, S.E.; Modrusan, Z.; Crosby, W.L.; Haughn, T.G.W. The Arabidopsis BELL1 and KNOX TALE homeodomain proteins interact through a domain conserved between plants and animals. Plant Cell 2001, 13, 2455–2470. [Google Scholar] [CrossRef] [Green Version]
- Chatterjee, M.; Banerjee, A.K.; Hannapel, D.J.A. BELL1-like gene of potato is light activated and wound inducible. Plant Physiol. 2007, 145, 1435–1443. [Google Scholar] [CrossRef] [Green Version]
- Scofield, S.; Dewitte, W.; Murray, J.A.H. STM sustains stem cell function in the Arabidopsis shoot apical meristem and controls KNOX gene expression independently of the transcriptional repressor AS1. Plant Sign. Behav. 2014, 9, e28934-1. [Google Scholar] [CrossRef] [Green Version]
- Endrizzi, K.; Moussian, B.; Haecker, A.; Levin, J.Z.; Laux, T. The SHOOT MERISTEMLESS gene is required for maintenance of undifferentiated cells in Arabidopsis shoot and floral meristems and acts at a different regulatory level than the meristem genes WUSCHEL and ZWILLE. Plant J. 1996, 10, 967–979. [Google Scholar] [CrossRef]
- Lenhard, M.; Jürgens, G.; Laux, T. The WUSCHEL and SHOOTMERISTEMLESS genes fulfil complementary roles in Arabidopsis shoot meristem regulation. Development 2002, 129, 3195–3206. [Google Scholar] [CrossRef]
- Berleth, T.; Jürgens, G. The role of the gene in monopteros Organizing the basal body region of the Arabidopsis embryo. Development 1993, 118, 575–587. [Google Scholar] [CrossRef]
- Przemeck, G.; Mattsson, J.; Hardtke, C.S. Studies on the role of the Arabidopsis gene monopteros in vascular development and plant cell axialization. Planta 1996, 200, 229–237. [Google Scholar] [CrossRef] [PubMed]
- Kirstein-Miles, J.; Scior, A.; Deuerling, E.; Morimot, R.I. The nascent polypeptide-associated complex is a key regulator of Proteostasis. EMBO J. 2013, 32, 1451–1468. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yamada, H.; Suzuki, T.; Terada, K.; Takei, K.; Ishikawa, K.; Miwa, K.; Mizuno, T. The Arabidopsis Histidine Kinase AHK4 is a Cytokinin-Binding Receptor Signals That transduces Cytokinin Across the Membrane. Plant Cell Physiol. 2001, 42, 1017–1023. [Google Scholar] [CrossRef] [PubMed]
- Lazar, G.; Zhang, H.; Goodman, H.M. The origin of the bifunctional dihydrofolate reductase-thymidylate synthase isogenes of Arabidopsis thaliana. Plant J. 1993, 3, 657–668. [Google Scholar] [CrossRef] [PubMed]
- Sharma, S.; Mustafiz, A.; Singla-Pareek, S.; Shankar Srivastava, P.; Sopory, S. Characterization of inducible stress and methylglyoxal triose phosphate isomerase (OscTPI) from rice. Plant Signal. Behav. 2012, 7, 1337–1345. [Google Scholar] [CrossRef] [Green Version]
- Yan, S.; Tang, Z.; Su, W.; Sun, W. Proteomic analysis of salt stress-responsive proteins in rice root. Proteomics 2005, 5, 235–244. [Google Scholar] [CrossRef]
- Riccardi, F.; Gazeau, P.; de Vienne, D.; Zivy, M. Protein Changes in Response to Water Deficit in Maize Progressive. Plant Physiol. 1998, 117, 1253–1263. [Google Scholar] [CrossRef] [Green Version]
- Salekdeh, G.; Siopongco, J.; Wade, L.; Ghareyazie, B.; Bennett, J. Proteomic analysis of rice drought stress and leaves During recovery. Proteomics 2002, 2, 1131–1145. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression usingreal-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Bustin, S.A.; Beaulieu, J.F.; Huggett, J.; Jaggi, R.; Kibenge, F.S.; Olsvik, P.A.; Penning, L.C.; Toegel, S. MIQE precis: Practical implementation of minimum standard guidelines for fluorescence-based quantitative real-time PCR exp. BMC Mol. Biol. 2010, 11, 74–80. [Google Scholar] [CrossRef] [Green Version]
- Szklarczyk, D.; Gable, A.L.; Lyon, D.; Junge, A.; Wyder, S.; Huerta-Cepas, J.; Jensen, L.J. STRINGv11: Protein-protein association networks with increased coverage supporting functional discovery in genome-wide experimental datasets. Nucleic Acids Res. 2019, 47, D607–D613. [Google Scholar] [CrossRef] [Green Version]
- Bombarely, A.; Menda, N.; Tecle, I.Y.; Buels, R.M.; Strickler, S.; Fischer-York, T.; Pujar, A.; Leto, J.; Gosselin, J.; Mueller, L.A. The Sol Genomics Network (solgenomics.net): Growing tomatoes using Perl. Nucleic Acids Res. 2010, 39, D1149–D1155. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- UniProt Consortium. UniProt: A hub for protein information. Nucleic Acids Res. 2014, 43, D204–D212. [Google Scholar]
- Sherry, S.T.; Ward, M.H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E.M.; Sirotkin, K. dbSNP: The NCBI database of genetic variation. Nucleic Acids Res. 2011, 29, 308–311. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Gen ID | Sequences | Tm (°C) | %GC | Amplicon | ID NCBI |
---|---|---|---|---|---|
StHK1 | L: TCGGAAAGCTCTGAATTCGT R: ATTCCATCCTTGACGAGACG | 64.4 64.3 | 45% 50% | 169 pb | XM_006340693.2 |
StHK3 | L: GTTCATGCAGGTTGGTCCTT R: TCATGCCATGGAAATCTGAA | 64.5 64.5 | 50% 40% | 242 pb | XM_006352114.2 |
StRR1 | L: TGTTGGGTCAGTGGTGAAAA R: CTCCGCTCGATTAGACTTGG | 64.2 64 | 45% 55% | 199 pb | XM_006345914.1 |
StHP4 | L: AAACGCCAAGCTGCTTACAT R: TAGGGTCCATTTTCCAATGC | 64 63.9 | 45% 45% | 188 pb | XM_015315420.1 |
StWUS | L: TTTCACATGGGTTGGTGTTG R: CTTCATGCATGGGGAAAAGT | 64.2 64.8 | 45% 45% | 180 pb | XM_006340669.2 |
StBEL5 | L: AACGCGAAAAAGCAAAGAAA R: GAAAATTCGCGGTCATTTGT | 63.9 64 | 55% 55% | 187 pb | NM_001287992.1 |
POTH15 | L: CTCGTCTCTTGGCTGCTTATC R: CTACTACTGTTACGGCCCATTG | 62.6 64.3 | 52% 50% | 115 pb | XM_006348098.2 |
POTH1 | L: AGAGACGATTACGCGGATAAAG R: GTCAAGATGGACGAGTTGGTATAG | 63.5 62.9 | 45% 45% | 101 pb | NM_001288425.1 |
NAC5 | L: GAGCAGGAGCGAGAAGAAGA R: TCCTCAATCTTTGCCTCACC | 64.3 64.5 | 55% 50% | 183 pb | XM_006340649.2 |
TIM | L: GCCTGTTTGGGCTATTGGTA R: TCAGCAGCCTTGATGATGATGTC | 64 64 | 50% 50% | 249 pb | CP055237.1 |
TPI | L: CGGTGAACCAAACACATTGA R: GAGAAGCTAAAGAAGTTGCCATT | 64.9 62 | 45% 39% | 153 pb | NM_001318582.1 |
MP | L: TGGAAAGATGGGTTCTTTGG R: CCTGCATTCCCTTCAACAAT | 64.1 64.2 | 45% 45% | 157 pb | XM_006341964.2 |
SEC3 | L: GATCTGCGGAAGGTGGTAAA R: CAGCAACTCCTCTGAGGTTAAG | 62.3 64.3 | 57% 58% | 102 pb | XM_006342542.2 |
Ef1-alpha | L: GCACTGGAGCATATCCGTTT R: TTTGGCCCTACTGGTTTGAC | 64.2 64.1 | 58% 58% | 244 pb | NM_001288491.1 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Herrera-Isidron, L.; Valencia-Lozano, E.; Rosiles-Loeza, P.Y.; Robles-Hernández, M.G.; Napsuciale-Heredia, A.; Cabrera-Ponce, J.L. Gene Expression Analysis of Microtubers of Potato Solanum tuberosum L. Induced in Cytokinin Containing Medium and Osmotic Stress. Plants 2021, 10, 876. https://doi.org/10.3390/plants10050876
Herrera-Isidron L, Valencia-Lozano E, Rosiles-Loeza PY, Robles-Hernández MG, Napsuciale-Heredia A, Cabrera-Ponce JL. Gene Expression Analysis of Microtubers of Potato Solanum tuberosum L. Induced in Cytokinin Containing Medium and Osmotic Stress. Plants. 2021; 10(5):876. https://doi.org/10.3390/plants10050876
Chicago/Turabian StyleHerrera-Isidron, Lisset, Eliana Valencia-Lozano, Pablo Yamild Rosiles-Loeza, Maria Guadalupe Robles-Hernández, Abigail Napsuciale-Heredia, and Jose Luis Cabrera-Ponce. 2021. "Gene Expression Analysis of Microtubers of Potato Solanum tuberosum L. Induced in Cytokinin Containing Medium and Osmotic Stress" Plants 10, no. 5: 876. https://doi.org/10.3390/plants10050876