Probing the Phytochemical Composition and Antioxidant Activity of Moringa oleifera under Ideal Germination Conditions
Abstract
:1. Introduction
2. Results and Discussion
2.1. Germination Studies
2.2. Seed Viability Test
2.3. Polyphenolic Compounds
2.4. Antioxidant Capacity
2.5. LC/ESI/QTOF-MS Identification of Phenolic Compounds in Moringa Seedlings
2.6. Polyamines
2.7. Antioxidative Enzymes
2.8. Non-Enzymatic Antioxidants
2.9. Compatible Solutes
2.10. Sugar Mobilization
2.11. Gene Expression Analysis
3. Materials and Methods
3.1. Plant Material
3.2. Seedling Establishment
3.3. Germination Studies
3.4. Seed Viability Test
3.5. Total Phenolic Compounds
3.6. In Vitro Antioxidant Assays
3.7. UPLC/ESI/QTOF-MS of Moringa Extracts
3.8. Polyamines
3.9. Antioxidative Enzymes
3.10. Antioxidant Molecules
3.11. Compatible Osmolytes
3.12. Nonstructural Carbohydrates
3.13. Semi-Quantitative Gene Expression Analysis
Primer Designing
3.14. Statistical Analysis
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Mangar, A.; Muetzel, S.; Malik, A.; Bhuker, A.; Mor, V.; Molenaar, A.; Sofkova-Bobcheva, S.; Pain, S.; McGill, C. Moringa oleifera L.: A Potential Plant for Greenhouse Gas Mitigation in Temperate Agriculture Systems. Agriculture 2022, 12, 1116. [Google Scholar] [CrossRef]
- Dzuvor, C.K.; Pan, S.; Amanze, C.; Amuzu, P.; Asakiya, C.; Kubi, F. Bioactive components from Moringa oleifera seeds: Production, functionalities and applications–a critical review. Crit. Rev. Biotechnol. 2022, 42, 271–293. [Google Scholar] [CrossRef]
- Padayachee, B.; Baijnath, H. An Updated Comprehensive Review of the Medicinal, Phytochemical, and Pharmacological Properties of Moringa oleifera. S. Afr. J. Bot. 2020, 129, 304–316. [Google Scholar] [CrossRef]
- Premi, M.; Sharma, H.K. Effect of Extraction Conditions on the Bioactive Compounds from Moringa oleifera (PKM 1) Seeds and Their Identification Using LC–MS. J. Food Meas. Charact. 2017, 11, 213–225. [Google Scholar] [CrossRef]
- Aisida, S.O.; Madubuonu, N.; Alnasir, M.H.; Ahmad, I.; Botha, S.; Maaza, M.; Ezema, F.I. Biogenic Synthesis of Iron Oxide Nanorods Using Moringa oleifera Leaf Extract for Antibacterial Applications. Appl. Nanosci. 2020, 10, 305–315. [Google Scholar] [CrossRef]
- Jahan, I.A.; Hossain, M.H.; Ahmed, K.S.; Sultana, Z.; Biswas, P.K.; Nada, K. Antioxidant Activity of Moringa oleifera Seed Extracts. Orient. Pharm. Exp. Med. 2018, 18, 299–307. [Google Scholar] [CrossRef]
- Aderinola, T.A.; Fagbemi, T.N.; Enujiugha, V.N.; Alashi, A.M.; Aluko, R.E. Amino Acid Composition and Antioxidant Properties of Moringa oleifera Seed Protein Isolate and Enzymatic Hydrolysates. Heliyon 2018, 4, e00877. [Google Scholar] [CrossRef]
- Kekana, T.W.; Marume, U.; Muya, C.M.; Nherera-Chokuda, F. V Moringa oleifera Leaf Meal as a Feed Supplement for Dairy Calves. S. Afr. J. Anim. Sci. 2021, 51, 550–559. [Google Scholar] [CrossRef]
- Punia, H.; Tokas, J.; Malik, A.; Bajguz, A.; El-Sheikh, M.A.; Ahmad, P. Ascorbate–Glutathione Oxidant Scavengers, Metabolome Analysis and Adaptation Mechanisms of Ion Exclusion in Sorghum under Salt Stress. Int. J. Mol. Sci. 2021, 22, 13249. [Google Scholar] [CrossRef]
- Leone, A.; Spada, A.; Battezzati, A.; Schiraldi, A.; Aristil, J.; Bertoli, S. Cultivation, Genetic, Ethnopharmacology, Phytochemistry and Pharmacology of Moringa oleifera Leaves: An Overview. Int. J. Mol. Sci. 2015, 16, 12791–12835. [Google Scholar] [CrossRef]
- Magalhães, E.R.B.; de Menezes, N.N.F.; Silva, F.L.; Garrido, J.W.A.; Sousa, M.A.D.S.B.; dos Santos, E.S. Effect of Oil Extraction on the Composition, Structure, and Coagulant Effect of Moringa oleifera Seeds. J. Clean. Prod. 2021, 279, 123902. [Google Scholar] [CrossRef]
- Saleem, A.; Saleem, M.; Akhtar, M.F. Antioxidant, Anti-Inflammatory and Antiarthritic Potential of Moringa oleifera Lam: An Ethnomedicinal Plant of Moringaceae Family. S. Afr. J. Bot. 2020, 128, 246–256. [Google Scholar] [CrossRef]
- Punia, H.; Madan, S.; Malik, A.; Sethi, S.K. Stability Analysis for Quality Attributes in Durum Wheat (Triticum durum L.) Genotypes. Bangladesh J. Bot. 2019, 48, 967–972. [Google Scholar] [CrossRef]
- Sreelatha, S.; Padma, P.R. Antioxidant Activity and Total Phenolic Content of Moringa oleifera Leaves in Two Stages of Maturity. Plant Foods Hum. Nutr. 2009, 64, 303–311. [Google Scholar] [CrossRef] [PubMed]
- Tokas, J.; Punia, H.; Malik, A.; Sangwan, S.; Devi, S.; Malik, S. Growth Performance, Nutritional Status, Forage Yield and Photosynthetic Use Efficiency of Sorghum [Sorghum bicolor (L.) Moench] under Salt Stress. Range Manag. Agrofor. 2021, 42, 59–70. [Google Scholar]
- Zubair, M.; Ramzani, P.M.A.; Rasool, B.; Khan, M.A.; Akhtar, I.; Turan, V.; Tauqeer, H.M.; Farhad, M.; Khan, S.A.; Iqbal, J. Efficacy of Chitosan-Coated Textile Waste Biochar Applied to Cd-Polluted Soil for Reducing Cd Mobility in Soil and Its Distribution in Moringa (Moringa oleifera L.). J. Environ. Manag. 2021, 284, 112047. [Google Scholar] [CrossRef] [PubMed]
- Malik, A.; Punia, H.; Singh, N.; Singh, P. Bionanomaterials-Mediated Seed Priming for Sustainable Agricultural Production. In Bionanotechnology: Emerging Applications of Bionanomaterials; Elsevier: Amsterdam, The Netherlands, 2022; pp. 77–99. [Google Scholar]
- Punia, H.; Tokas, J.; Malik, A.; Yashveer, S. Reconnoitering Bionanomaterials for Mitigation of Abiotic Stress in Plants. In Bionanotechnology: Emerging Applications of Bionanomaterials; Elsevier: Amsterdam, The Netherlands, 2022; pp. 101–126. [Google Scholar]
- Alshoaibi, A. Seed Germination, Seedling Growth and Photosynthetic Responses to Temperature in the Tropical Tree Moringa oleifera and Its Relative Desert, Moringa peregrina. Egypt. J. Bot. 2021, 61, 541–551. [Google Scholar] [CrossRef]
- Muhl, Q.E. Seed Germination, Tree Growth and Flowering Responses of Moringa oleifera Lam. (Horseradish Tree) to Temperature; University of Pretoria: Pretoria, South Africa, 2010. [Google Scholar]
- González-Burgos, E.; Ureña-Vacas, I.; Sánchez, M.; Gómez-Serranillos, M.P. Nutritional Value of Moringa oleifera Lam. Leaf Powder Extracts and Their Neuroprotective Effects via Antioxidative and Mitochondrial Regulation. Nutrients 2021, 13, 2203. [Google Scholar] [CrossRef]
- Ogbe, A.O.; Affiku, J.P. Proximate Study, Mineral and Anti-Nutrient Composition of Moringa oleifera Leaves Harvested from Lafia, Nigeria: Potential Benefits in Poultry Nutrition and Health. J. Microbiol. Biotechnol. Food Sci. 2021, 2021, 296–308. [Google Scholar]
- Manigandan, S.; Gunasekar, P.; Praveenkumar, T.R.; Sabir, J.S.M.; Mathimani, T.; Pugazhendhi, A.; Brindhadevi, K. Performance, Noise and Emission Characteristics of DI Engine Using Canola and Moringa oleifera Biodiesel Blends Using Soluble Multiwalled Carbon Nanotubes. Fuel 2021, 289, 119829. [Google Scholar] [CrossRef]
- Punia, H.; Tokas, J.; Bhadu, S.; Mohanty, A.K.; Rawat, P.; Malik, A. Proteome Dynamics and Transcriptome Profiling in Sorghum [Sorghum bicolor (L.) Moench] under Salt Stress. 3 Biotech 2020, 10, 412. [Google Scholar] [CrossRef] [PubMed]
- Milla, P.G.; Peñalver, R.; Nieto, G. Health Benefits of Uses and Applications of Moringa oleifera in Bakery Products. Plants 2021, 10, 318. [Google Scholar] [CrossRef] [PubMed]
- Bewley, J.D.; Black, M. Physiology and Biochemistry of Seeds in Relation to Germination: 1 Development, Germination, and Growth; Springer: Berlin/Heidelberg, Germany, 2014; ISBN 364266668X. [Google Scholar]
- Coello, K.E.; Frias, J.; Martínez-Villaluenga, C.; Cartea, M.E.; Abilleira, R.; Peñas, E. Potential of Germination in Selected Conditions to Improve the Nutritional and Bioactive Properties of Moringa (Moringa oleifera L.). Foods 2020, 9, 1639. [Google Scholar] [CrossRef] [PubMed]
- Ahmed Hassanein, A.M.; Abdulah Al-Soqeer, A. Evaluation of Seed Germination and Growth Characteristics of Moringa oleifera and M. Peregrina under Laboratory, Greenhouse and Field Conditions. Int. J. Agric. Biol. 2017, 19, 873–879. [Google Scholar] [CrossRef]
- Punia, H.; Tokas, J.; Mor, V.S.; Bhuker, A.; Malik, A.; Singh, N.; Alsahli, A.A.; Hefft, D.I. Deciphering Reserve Mobilization, Antioxidant Potential, and Expression Analysis of Starch Synthesis in Sorghum Seedlings under Salt Stress. Plants 2021, 10, 2463. [Google Scholar] [CrossRef]
- Pallavi, H.M.; Madalageri, M.B.; Vishwanath, K.; Biradar, I.B.; Thattimani, M. Decortication to Enhance Seed Value and Standardization of Quick Viability Test in Drumstick (Moringa oleifera L.). Environ. Ecol. 2015, 33, 1558–1561. [Google Scholar]
- Kak, A.; Pandey, C.; Gupta, V. Assessment of Viability of Jatropha curcas L. Seeds Using the Tetrazolium Test. Seed Sci. Technol. 2009, 37, 512–515. [Google Scholar] [CrossRef]
- Xue, T.T.; Liu, J.; Shen, Y.B.; Liu, G.Q. Methods for Rapid Determination of Pecan (CARYA illinoensis) Seed Viability. Seed Sci. Technol. 2017, 45, 455–464. [Google Scholar] [CrossRef]
- Fotouo-M, H.; Vorster, J.; Du Toit, E.S.; Robbertse, P.J. The Effect of Natural Long-Term Packaging Methods on Antioxidant Components and Malondialdehyde Content and Seed Viability Moringa oleifera Oilseed. S. Afr. J. Bot. 2020, 129, 17–24. [Google Scholar] [CrossRef]
- da Silva, R.R.; de Souza, R.R.; Coimbra, M.; Nery, F.; Alvarenga, A.; Paiva, R. Light Quality on Growth and Phenolic Compounds Accumulation in Moringa oleifera L. Grown in Vitro. Commun. Sci. 2020, 11, e3313. [Google Scholar] [CrossRef]
- Rahman, M.M.; Banu, L.A.; Rahman, M.M.; Shahjadee, U.F. Changes of the Enzymes Activity during Germination of Different Mungbean Varieties. Bangladesh J. Sci. Ind. Res. 2007, 42, 213–216. [Google Scholar] [CrossRef]
- Carciochi, R.A.; Manrique, G.D.; Dimitrov, K. Changes in Phenolic Composition and Antioxidant Activity during Germination of Quinoa Seeds (Chenopodium quinoa Willd.). Int. Food Res. J. 2014, 21, 767. [Google Scholar]
- Punia, H.; Tokas, J.; Malik, A.; Sangwan, S. Characterization of Phenolic Compounds and Antioxidant Activity in Sorghum [Sorghum bicolor (L.) Moench] Grains. Cereal Res. Commun. 2021, 49, 343–353. [Google Scholar] [CrossRef]
- Weidner, S.; Chrzanowski, S.; Karamać, M.; Król, A.; Badowiec, A.; Mostek, A.; Amarowicz, R. Analysis of Phenolic Compounds and Antioxidant Abilities of Extracts from Germinating Vitis Californica Seeds Submitted to Cold Stress Conditions and Recovery after the Stress. Int. J. Mol. Sci. 2014, 15, 16211–16225. [Google Scholar] [CrossRef]
- Wu, L.; Li, L.; Chen, S.; Wang, L.; Lin, X. Deep Eutectic Solvent-Based Ultrasonic-Assisted Extraction of Phenolic Compounds from Moringa oleifera L. Leaves: Optimization, Comparison and Antioxidant Activity. Sep. Purif. Technol. 2020, 247, 117014. [Google Scholar] [CrossRef]
- Punia, H.; Tokas, J.; Malik, A.; Satpal Rani, A.; Gupta, P.; Kumari, A.; Mor, V.S.; Bhuker, A.; Kumar, S. Solar radiation and nitrogen use efficiency for sustainable agriculture. In Resources Use Efficiency in Agriculture; Kumar, S., Meena, R.S., Jhariya, M.K., Eds.; Springer: Singapore, 2020; pp. 177–212. [Google Scholar]
- Santos, F.C.; Caixeta, F.; Clemente, A.C.S.; Pinho, E.V.; Rosa, S.D.V.F. Gene Expression of Antioxidant Enzymes and Coffee Seed Quality during Pre- and Post-Physiological Maturity. Genet. Mol. Res. 2014, 13, 10983–10993. [Google Scholar] [CrossRef]
- Adom, K.K.; Liu, R.H. Antioxidant Activity of Grains. J. Agric. Food Chem. 2002, 50, 6182–6187. [Google Scholar] [CrossRef]
- Gómez-Martínez, M.; Ascacio-Valdés, J.A.; Flores-Gallegos, A.C.; González-Domínguez, J.; Gómez-Martínez, S.; Aguilar, C.N.; Morlett-Chávez, J.A.; Rodríguez-Herrera, R. Location and Tissue Effects on Phytochemical Composition and in Vitro Antioxidant Activity of Moringa oleifera. Ind. Crops Prod. 2020, 151, 112439. [Google Scholar] [CrossRef]
- De-la-Cruz Chacón, I.; Riley-Saldaña, C.A.; González-Esquinca, A.R. Secondary Metabolites during Early Development in Plants. Phytochem. Rev. 2013, 12, 47–64. [Google Scholar] [CrossRef]
- Farooq, B.; Koul, B. Comparative analysis of the antioxidant, antibacterial and plant growth promoting potential of five Indian varieties of Moringa oleifera L. S. Afr. J. Bot. 2020, 129, 47–55. [Google Scholar] [CrossRef]
- Rodríguez-Pérez, C.; Quirantes-Piné, R.; Fernández-Gutiérrez, A.; Segura-Carretero, A. Optimization of Extraction Method to Obtain a Phenolic Compounds-Rich Extract from Moringa oleifera Lam Leaves. Ind. Crops Prod. 2015, 66, 246–254. [Google Scholar] [CrossRef]
- Oldoni, T.L.C.; Merlin, N.; Karling, M.; Carpes, S.T.; de Alencar, S.M.; Morales, R.G.F.; da Silva, E.A.; Pilau, E.J. Bioguided Extraction of Phenolic Compounds and UHPLC-ESI-Q-TOF-MS/MS Characterization of Extracts of Moringa oleifera Leaves Collected in Brazil. Food Res. Int. 2019, 125, 108647. [Google Scholar] [CrossRef] [PubMed]
- Coppin, J.P.; Xu, Y.; Chen, H.; Pan, M.-H.; Ho, C.-T.; Juliani, R.; Simon, J.E.; Wu, Q. Determination of Flavonoids by LC/MS and Anti-Inflammatory Activity in Moringa oleifera. J. Funct. Foods 2013, 5, 1892–1899. [Google Scholar] [CrossRef]
- Ma, L.; Shi, Y.; Siemianowski, O.; Yuan, B.; Egner, T.K.; Mirnezami, S.V.; Lind, K.R.; Ganapathysubramanian, B.; Venditti, V.; Cademartiri, L. Hydrogel-Based Transparent Soils for Root Phenotyping in Vivo. Proc. Natl. Acad. Sci. USA 2019, 116, 11063–11068. [Google Scholar] [CrossRef]
- Davarynejad, G.H.; Zarei, M.; Nasrabadi, M.E.; Ardakani, E. Effects of Salicylic Acid and Putrescine on Storability, Quality Attributes and Antioxidant Activity of Plum Cv. ‘Santa Rosa’. J. Food Sci. Technol. 2015, 52, 2053–2062. [Google Scholar] [CrossRef]
- Gill, S.S.; Anjum, N.A.; Hasanuzzaman, M.; Gill, R.; Trivedi, D.K.; Ahmad, I.; Pereira, E.; Tuteja, N. Glutathione and Glutathione Reductase: A Boon in Disguise for Plant Abiotic Stress Defense Operations. Plant Physiol. Biochem. 2013, 70, 204–212. [Google Scholar] [CrossRef]
- Mhamdi, A.; Queval, G.; Chaouch, S.; Vanderauwera, S.; Van Breusegem, F.; Noctor, G. Catalase Function in Plants: A Focus on Arabidopsis Mutants as Stress-Mimic Models. J. Exp. Bot. 2010, 61, 4197–4220. [Google Scholar] [CrossRef]
- Mittler, R.; Vanderauwera, S.; Gollery, M.; Van Breusegem, F. Reactive Oxygen Gene Network of Plants. Trends Plant Sci. 2004, 9, 490–498. [Google Scholar] [CrossRef]
- Rogozhin, V.V.; Verkhoturov, V.V.; Kurilyuk, T.T. The Antioxidant System of Wheat Seeds during Germination. Biol. Bull. Russ. Acad. Sci. 2001, 28, 126–133. [Google Scholar] [CrossRef]
- Azzam, C.R.; Zaki, S.N.S.; Bamagoos, A.A.; Rady, M.M.; Alharby, H.F. Soaking maize seeds in zeatin-type cytokinin biostimulators improves salt tolerance by enhancing the antioxidant system and photosynthetic efficiency. Plants. 2022, 11, 1004. [Google Scholar] [CrossRef]
- Punia, H.; Tokas, J.; Malik, A.; Singh, S.; Phogat, D.S.; Bhuker, A.; Mor, V.S.; Rani, A.; Sheokand, R.N. Discerning Morpho-Physiological and Quality Traits Contributing to Salinity Tolerance Acquisition in Sorghum [Sorghum bicolor (L.) Moench]. S. Afr. J. Bot. 2021, 140, 409–418. [Google Scholar] [CrossRef]
- Smith, I.K. Stimulation of Glutathione Synthesis in Photorespiring Plants by Catalase Inhibitors. Plant Physiol. 1985, 79, 1044–1047. [Google Scholar] [CrossRef] [PubMed]
- Apel, K.; Hirt, H. Reactive Oxygen Species: Metabolism, Oxidative Stress, and Signal Transduction. Annu. Rev. Plant Biol. 2004, 55, 373–399. [Google Scholar] [CrossRef] [PubMed]
- Lee, Y.-P.; Kim, S.-H.; Bang, J.-W.; Lee, H.-S.; Kwak, S.-S.; Kwon, S.-Y. Enhanced Tolerance to Oxidative Stress in Transgenic Tobacco Plants Expressing Three Antioxidant Enzymes in Chloroplasts. Plant Cell Rep. 2007, 26, 591–598. [Google Scholar] [CrossRef]
- Albrecht, V.; Weinl, S.; Blazevic, D.; D’Angelo, C.; Batistic, O.; Kolukisaoglu, Ü.; Bock, R.; Schulz, B.; Harter, K.; Kudla, J. The Calcium Sensor CBL1 Integrates Plant Responses to Abiotic Stresses. Plant J. 2003, 36, 457–470. [Google Scholar] [CrossRef]
- Bailly, C. Active Oxygen Species and Antioxidants in Seed Biology. Seed Sci. Res. 2004, 14, 93–107. [Google Scholar] [CrossRef]
- Ahmed, M.Z.; Gul, B.; Khan, M.A.; Watanabe, K.N. Characterization and Function of Sodium Exchanger Genes in Aeluropus lagopoides Under NaCl Stress. In Halophytes for Food Security in Dry Lands; Elsevier: Amsterdam, The Netherlands, 2016; pp. 1–16. [Google Scholar]
- Kappus, H. Lipid Peroxidation: Mechanisms, Analysis, Enzymology and Biological Relevance. Oxidative Stress 1985, 273, 273–310. [Google Scholar]
- Gupta, B.; Huang, B. Mechanism of Salinity Tolerance in Plants: Physiological, Biochemical, and Molecular Characterization. Int. J. Genom. 2014, 2014, 701596. [Google Scholar] [CrossRef]
- Dučić, T.; Lirić-Rajlić, I.; Mitrović, A.; Radotić, K. Activities of Antioxidant Systems during Germination of Chenopodium Rubrum Seeds. Biol. Plant 2003, 47, 527–533. [Google Scholar] [CrossRef]
- Qureshi, M.I.; Abdin, M.Z.; Ahmad, J.; Iqbal, M. Effect of Long-Term Salinity on Cellular Antioxidants, Compatible Solute and Fatty Acid Profile of Sweet Annie (Artemisia annua L.). Phytochemistry 2013, 95, 215–223. [Google Scholar] [CrossRef]
- Murthy, S.M.; Devaraj, V.R.; Anitha, P.; Tejavathi, D.H. Studies on the Activities of Antioxidant Enzymes under Induced Drought Stress in in Vivo and in Vitro Plants of Macrotyloma uniflorum (Lam.) Verdc. Recent Res. Sci. Technol. 2012, 4, 34–37. [Google Scholar]
- Latha, V.M.; Satakopan, V.N.; Jayasree, H. Salinity-Induced Changes in Phenol and Ascorbic Acid Content In Groundnut (Arachis hypogea) Leaves. Curr. Sci. 1989, 58, 151–152. [Google Scholar]
- Trejo-Téllez, L.I.; Estrada-Ortiz, E.; Gómez-Merino, F.C.; Becker, C.; Krumbein, A.; Schwarz, D. Flavonoid, Nitrate and Glucosinolate Concentrations in Brassica Species Are Differentially Affected by Photosynthetically Active Radiation, Phosphate and Phosphite. Front. Plant Sci. 2019, 10, 371. [Google Scholar] [CrossRef]
- Yang, Z.; Li, J.-L.; Liu, L.-N.; Xie, Q.; Sui, N. Photosynthetic Regulation under Salt Stress and Salt-Tolerance Mechanism of Sweet Sorghum. Front. Plant Sci. 2020, 10, 1722. [Google Scholar] [CrossRef] [PubMed]
- El-Badri, A.M.; Batool, M.; AA Mohamed, I.; Wang, Z.; Khatab, A.; Sherif, A.; Ahmad, H.; Khan, M.N.; Hassan, H.M.; Elrewainy, I.M. Antioxidative and Metabolic Contribution to Salinity Stress Responses in Two Rapeseed Cultivars during the Early Seedling Stage. Antioxidants 2021, 10, 1227. [Google Scholar] [CrossRef] [PubMed]
- Punia, H.; Tokas, J.; Malik, A.; Sangwan, S.; Rani, A.; Yashveer, S.; Alansi, S.; Hashim, M.J.; El-Sheikh, M.A. Genome-Wide Transcriptome Profiling, Characterization, and Functional Identification of NAC Transcription Factors in Sorghum under Salt Stress. Antioxidants 2021, 10, 1605. [Google Scholar] [CrossRef]
- Munns, R.; Tester, M. Mechanisms of Salinity Tolerance. Annu. Rev. Plant Biol. 2008, 59, 651–681. [Google Scholar] [CrossRef] [PubMed]
- Azeem, M.; Pirjan, K.; Qasim, M.; Mahmood, A.; Javed, T.; Muhammad, H.; Yang, S.; Dong, R.; Ali, B.; Rahimi, M. Salinity Stress Improves Antioxidant Potential by Modulating Physio-Biochemical Responses in Moringa oleifera Lam. Sci. Rep. 2023, 13, 2895. [Google Scholar] [CrossRef] [PubMed]
- Sultana, R.; Wang, X.; Azeem, M.; Hussain, T.; Mahmood, A.; Fiaz, S.; Qasim, M. Coumarin-Mediated Growth Regulations, Antioxidant Enzyme Activities, and Photosynthetic Efficiency of Sorghum Bicolor under Saline Conditions. Front. Plant Sci. 2022, 13, 799404. [Google Scholar] [CrossRef]
- Coelho, D.S.; Simoes, W.L.; Mendes, A.M.S.; Dantas, B.F.; Rodrigues, J.A.S.; de Souza, M.A. Germination and Initial Growth of Varieties of Forage Sorghum under Saline Stress/Germinacao e Crescimento Inicial de Variedades de Sorgo Forrageiro Submetidas Ao Estresse Salino. Rev. Bras. Eng. Agrícola Ambient. 2014, 18, 25–31. [Google Scholar] [CrossRef]
- Arafa, A.A.; Khafagy, M.A.; El-Banna, M.F. The Effect of Glycinebetaine or Ascorbic Acid on the Salt-Stress Induced Damages in Sorghum Plant Cells. Int. J. Bot. 2007, 3, 251–259. [Google Scholar] [CrossRef]
- Murata, N.; Mohanty, P.S.; Hayashi, H.; Papageorgiou, G.C. Glycinebetaine Stabilizes the Association of Extrinsic Proteins with the Photosynthetic Oxygen-Evolving Complex. FEBS Lett. 1992, 296, 187–189. [Google Scholar] [CrossRef] [PubMed]
- Ashraf, M.; Foolad, M.R. Roles of Glycine Betaine and Proline in Improving Plant Abiotic Stress Resistance. Environ. Exp. Bot. 2007, 59, 206–216. [Google Scholar] [CrossRef]
- Osman, G.; Munshi, A.A.F.; Mutawie, H. Genetic Variation and Relationships of Zea mays and Sorghum Species Using RAPD-PCR and SDS-PAGE of Seed Proteins. Afr. J. Biotechnol. 2013, 12, 4269–4276. [Google Scholar] [CrossRef]
- Afridi, M.S.; Ali, S.; Salam, A.; César Terra, W.; Hafeez, A.; Sumaira; Ali, B.; AlTami, M.S.; Ameen, F.; Ercisli, S. Plant Microbiome Engineering: Hopes or Hypes. Biology 2022, 11, 1782. [Google Scholar] [CrossRef]
- Gill, S.S.; Tuteja, N. Reactive Oxygen Species and Antioxidant Machinery in Abiotic Stress Tolerance in Crop Plants. Plant Physiol. Biochem. 2010, 48, 909–930. [Google Scholar] [CrossRef]
- Lin, M.; Jia, R.; Li, J.; Zhang, M.; Chen, H.; Zhang, D.; Zhang, J.; Chen, X. Evolution and Expression Patterns of the Trehalose-6-Phosphate Synthase Gene Family in Drumstick Tree (Moringa oleifera Lam.). Planta 2018, 248, 999–1015. [Google Scholar] [CrossRef]
- Zhang, J.; Yang, E.; He, Q.; Lin, M.; Zhou, W.; Pian, R.; Chen, X. Genome-Wide Analysis of the WRKY Gene Family in Drumstick (Moringa oleifera Lam.). PeerJ 2019, 7, e7063. [Google Scholar] [CrossRef]
- Aghdam, M.T.B.; Mohammadi, H.; Ghorbanpour, M. Effects of Nanoparticulate Anatase Titanium Dioxide on Physiological and Biochemical Performance of Linum Usitatissimum (Linaceae) under Well-Watered and Drought Stress Conditions. Braz. J. Bot. 2016, 39, 139–146. [Google Scholar] [CrossRef]
- Deng, L.-T.; Wu, Y.-L.; Li, J.-C.; OuYang, K.-X.; Ding, M.-M.; Zhang, J.-J.; Li, S.-Q.; Lin, M.-F.; Chen, H.-B.; Hu, X.-S. Screening Reliable Reference Genes for RT-QPCR Analysis of Gene Expression in Moringa oleifera. PLoS ONE 2016, 11, e0159458. [Google Scholar] [CrossRef]
- Hach, C.C.; Vanous, R.D.; Heer, J.M. Understanding Turbidity Measurement; Technical Information Series; Booklet 11; Hach Co.: Loveland, CO, USA, 1985. [Google Scholar]
- Swain, T.; Hillis, W.E. The Phenolic Constituents of Prunus Domestica. I.—The Quantitative Analysis of Phenolic Constituents. J. Sci. Food Agric. 1959, 10, 63–68. [Google Scholar] [CrossRef]
- Chen, W.; Provart, N.J.; Glazebrook, J.; Katagiri, F.; Chang, H.-S.; Eulgem, T.; Mauch, F.; Luan, S.; Zou, G.; Whitham, S.A. Expression Profile Matrix of Arabidopsis Transcription Factor Genes Suggests Their Putative Functions in Response to Environmental Stresses. Plant Cell 2002, 14, 559–574. [Google Scholar] [CrossRef] [PubMed]
- Johnson, G.; Schaal, L.A. Relation of Chlorogenic Acid to Scab Resistance in Potatoes. Science 1952, 115, 627–629. [Google Scholar] [CrossRef] [PubMed]
- Balbaa, S.I.; Zaki, A.Y.; El Shamy, A.M. Total Flavonoid and Rutin Content of the Different Organs of Sophora japonica L. J. Assoc. Off. Anal. Chem. 1974, 57, 752–755. [Google Scholar] [CrossRef]
- Benzie, I.F.F.; Strain, J.J. The Ferric Reducing Ability of Plasma (FRAP) as a Measure of “Antioxidant Power”: The FRAP Assay. Anal. Biochem. 1996, 239, 70–76. [Google Scholar] [CrossRef] [PubMed]
- Re, R.; Pellegrini, N.; Proteggente, A.; Pannala, A.; Yang, M.; Rice-Evans, C. Antioxidant Activity Applying an Improved ABTS Radical Cation Decolorization Assay. Free Radic. Biol. Med. 1999, 26, 1231–1237. [Google Scholar] [CrossRef] [PubMed]
- Slocum, R.D.; Flores, H.E.; Galston, A.W.; Weinstein, L.H. Improved Method for HPLC Analysis of Polyamines, Agmatine and Aromatic Monoamines in Plant Tissue. Plant Physiol. 1989, 89, 512–517. [Google Scholar] [CrossRef]
- Beauchamp, C.; Fridovich, I. Superoxide Dismutase: Improved Assays and an Assay Applicable to Acrylamide Gels. Anal. Biochem. 1971, 44, 276–287. [Google Scholar] [CrossRef]
- Nakano, Y.; Asada, K. Hydrogen Peroxide Is Scavenged by Ascorbate-Specific Peroxidase in Spinach Chloroplasts. Plant Cell Physiol. 1981, 22, 867–880. [Google Scholar]
- Aebi, H. [13] Catalase in Vitro. Methods Enzym. 1984, 105, 121–126. [Google Scholar]
- Shannon, L.M.; Kay, E.; Lew, J.Y. Peroxidase Isozymes from Horseradish Roots I. Isolation and Physical Properties. J. Biol. Chem. 1966, 241, 2166–2172. [Google Scholar] [CrossRef]
- Nagalakshmi, N.; Prasad, M.N. V Responses of Glutathione Cycle Enzymes and Glutathione Metabolism to Copper Stress in Scenedesmus Bijugatus. Plant Sci. 2001, 160, 291–299. [Google Scholar] [CrossRef] [PubMed]
- Lowry, O.H.; Rosebrough, N.J.; Farr, A.L.; Randall, R.J. Protein Measurement with the Folin Phenol Reagent. J. Biol. Chem. 1951, 193, 265–275. [Google Scholar] [CrossRef] [PubMed]
- Mukherjee, S.P.; Choudhuri, M.A. Implications of Water Stress-induced Changes in the Levels of Endogenous Ascorbic Acid and Hydrogen Peroxide in Vigna Seedlings. Physiol. Plant 1983, 58, 166–170. [Google Scholar] [CrossRef]
- Wellburn, A.R.; Lichtenthaler, H. Formulae and Program to Determine Total Carotenoids and Chlorophylls a and b of Leaf Extracts in Different Solvents. In Advances in Photosynthesis Research, Proceedings of the VIth International Congress on Photosynthesis, Brussels, Belgium, 1–6 August 1983; Springer: Dordrecht, The Netherlands, 1983; Volume 2, pp. 9–12. [Google Scholar]
- Bates, L.S.; Waldren, R.P.; Teare, I.D. Rapid Determination of Free Proline for Water-Stress Studies. Plant Soil 1973, 39, 205–207. [Google Scholar] [CrossRef]
- Grieve, C.M.; Grattan, S.R. Rapid Assay for Determination of Water Soluble Quaternary Ammonium Compounds. Plant Soil 1983, 70, 303–307. [Google Scholar] [CrossRef]
- Liu, X.; Shiomi, S.; Nakatsuka, A.; Kubo, Y.; Nakamura, R.; Inaba, A. Characterization of Ethylene Biosynthesis Associated with Ripening in Banana Fruit. Plant Physiol. 1999, 121, 1257–1265. [Google Scholar] [CrossRef] [PubMed]
Sample Tissue | Temperature | TP (mg GAE/100 DW g) | TF (mg RE/100 DW g) | Flavanols (mg/100g DW) | o-HP (mg/100 g DW) |
---|---|---|---|---|---|
Leaves | 25 °C | 844.21 ± 8.92 b | 39.24 ± 0.22 b | 0.195 ± 0.22 b | 0.874 ± 0.23 b |
30 °C | 940.73 ± 9.7 a | 45.34 ± 0.35 a | 0.292 ± 0.052 a | 0.924 ± 0.21 a | |
35 °C | 652.49 ± 4.8 c | 17.23 ± 0.11 c | 0.117 ± 0.23 c | 0.243 ± 0.11 c | |
Whole seedling | 25 °C | 615.26 ± 3.8 b | 26.87± 0.23 b | 0.211 ± 0.23 b | 0.854 ± 0.25 b |
30 °C | 785.26 ± 6.4 a | 35.24 ± 0.29 a | 0.255 ± 0.32 a | 0.875 ± 0.29 a | |
35 °C | 524.36 ± 4.6 c | 18.69 ± 0.12 c | 0.184 ± 0.36 c | 0.714 ± 0.22 c | |
Roots | 25 °C | 154.26 ± 1.4 b | 20.15 ± 0.12 b | 0.194 ± 0.16 b | 0.711 ± 0.23 b |
30 °C | 191.24 ± 1.7 a | 26.25 ± 0.13 a | 0.212 ± 0.15 a | 0.741 ± 0.31 a | |
35 °C | 142.24 ± 1.1 c | 14.25 ± 3.10 c | 0.165 ± 0.11 c | 0.658 ± 0.26 c | |
Seeds | 25 °C | 185.23 ± 2.6 b | 22.12 ± 0.22 b | 0.225 ± 0.22 b | 0.789 ± 0.31 b |
30 °C | 221.18 ± 3.1 a | 32.21 ± 0.13 a | 0.235 ± 0.26 a | 0.815 ± 0.36 a | |
35 °C | 165.28 ± 2.7 c | 16.54 ± 0.14 c | 0.174 ± 0.21 c | 0.615 ± 0.28 c |
Sample Tissue | Temperature | IC50 DPPH (µg/mL) | IC50 ABTS (µg/mL) | IC50 FRAP (µg/mL) |
---|---|---|---|---|
Leaves | 25 °C | 6.34 ± 0.22 b | 14.24 ± 0.22 b | 125.2 ± 1.22 b |
30 °C | 2.39 ± 0.11 a | 10.34 ± 0.35 a | 117.4 ± 1.02 a | |
35 °C | 9.77 ± 0.32 c | 19.23 ± 0.11 c | 257.5 ± 1.26 c | |
Whole seedling | 25 °C | 7.26 ± 0.8 b | 12.87 ± 0.23 b | 211.5 ± 1.23 b |
30 °C | 4.56 ± 0.4 a | 12.24 ± 0.29 a | 184.3 ± 1.12 a | |
35 °C | 12.36 ± 0.6 c | 20.69 ± 0.12 c | 235.4 ± 1.36 c | |
Roots | 25 °C | 11.26 ± 0.4 b | 15.15 ± 0.12 b | 194.2 ± 1.16 b |
30 °C | 9.24 ± 0.7 a | 13.25 ± 0.13 a | 165.8 ± 1.10 a | |
35 °C | 15.24 ± 0.1 c | 24.25 ± 0.15 c | 212.5 ± 1.21 c | |
Seeds | 25 °C | 13.23 ± 0.6 b | 18.12 ± 0.22 b | 225.1 ± 1.22 b |
30 °C | 10.18 ± 0.1 a | 15.21 ± 0.13 a | 174.2 ± 1.16 a | |
35 °C | 21.28 ± 0.7 c | 29.54 ± 0.14 c | 235.6 ± 1.31 c |
Rt (min) | Neutral Mass (Da) | Observed Mass m/z | Mass Error (ppm) | Adducts | Phenolic Compound |
---|---|---|---|---|---|
0.82 | 558.137 | 617.149 | −3.7 | +CH3COO | (+)-Gallocatechin hexaacetate |
0.83 | 606.195 | 665.210 | 2.2 | +CH3COO | 5,7-Dimethoxy-4′-hydroxyflavone-4′-O-alpha-L-rhamnose(1-->2)-beta-D-glucoside |
0.84 | 652.200 | 711.214 | −0.7 | +CH3COO | Nevadensin-7-O-[α-L-rhamnosyl(1-->6)]-beta-D-glucoside |
0.85 | 786.258 | 845.277 | 5.3 | +CH3COO | Echinacoside |
0.86 | 150.053 | 195.050 | −5.8 | +HCOO | Ribose |
0.87 | 342.110 | 341.105 | 4.6 | −H, +HCOO | 4′,5,6,7-Tetramethoxy-flavone |
0.87 | 342.116 | 387.112 | −5.8 | +HCOO | Maltose |
0.88 | 720.211 | 719.197 | −9.7 | −H | Chelidimerine |
0.90 | 180.063 | 179.055 | −4.1 | −H | Glucose |
0.95 | 88.016 | 133.014 | −2.9 | +HCOO | Pyruvic acid |
1.04 | 330.095 | 375.092 | −4.3 | +HCOO | Vanillic acid-4-O-β-D-glucopyranoside |
1.10 | 129.043 | 128.035 | −1.2 | −H | 5-Oxoproline |
1.18 | 332.074 | 331.069 | 5.7 | −H | 1-Galloyl-glucose |
1.26 | 425.045 | 424.036 | −5.2 | −H | Glucosinalbin |
1.54 | 138.032 | 137.026 | −6.4 | −H | Protocatechuic aldehyde |
1.67 | 466.111 | 511.109 | −0.3 | +HCOO | Taxifolin-3-O-glucoside |
1.98 | 466.111 | 511.112 | 4.7 | +HCOO | (2R,3R)-Taxifolin-3′-O-beta-D-glucopyranside |
2.16 | 449.108 | 508.122 | −0.7 | +CH3COO | Cyanidin-3-glucoside |
2.24 | 452.132 | 497.132 | 3.4 | +HCOO | Catechin-7-O-β-D-glucopyranoside |
2.35 | 304.058 | 349.057 | 0.4 | +HCOO | (2R,3R)-3,5,7,2′,6′-Pentahydroxyvflavanone |
2.44 | 180.042 | 225.042 | 5.6 | +HCOO | 3,4-Dihydroxycinnamic acid |
2.58 | 402.153 | 401.143 | −5.7 | −H, +HCOO | Benzyl alcohol xylopyranosyl-(1-->6)-glucopyranoside |
2.60 | 330.095 | 329.089 | 3.6 | −H | Vanillic acid-4-O-β-D-glucopyranoside |
2.69 | 326.100 | 385.115 | 2.8 | +CH3COO | 4-O-β-D-Glucopyranosyl-cis-cinnamic acid |
3.66 | 312.121 | 357.120 | 3.7 | +HCOO | Piscidic aciddiethyl ester |
4.13 | 326.137 | 371.135 | 0.4 | +HCOO | Eugenyl glucoside |
4.29 | 396.142 | 395.135 | 1.1 | −H | Propyl chlorogenate |
5.96 | 448.137 | 447.131 | 1.9 | −H | (2S)-5,7-Dihydroxy-6-methoxy-flavanone-7-O-β-D glucopyranoside |
7.02 | 316.261 | 315.252 | −7.2 | −H | Dihydroxy stearic acid |
8.37 | 598.314 | 597.305 | −3.3 | −H | Daturametelin H |
9.44 | 282.256 | 281.248 | −2.3 | −H | (E)-9-Octadecenoic acid |
10.72 | 414.386 | 473.403 | 6 | +CH3COO | 24-Ethyl cholesterol |
12.25 | 326.188 | 325.15 | 9.7 | −H | Pregna-4,16-diene-3,12,20-trione |
Sample Tissue | Temperature | Put * | Spd * | Spm * |
---|---|---|---|---|
Leaves | 25 °C | 382.47 ± 1.8 c | 314.21 ± 1.9 b | 39.64 ± 0.34 d |
30 °C | 457.64 ± 2.3 d | 357.95 ± 2.0 a | 45.16 ± 0.64 e | |
35 °C | 336.46 ± 1.4 b | 246.84 ± 1.1 e | 25.58 ± 0.62 c | |
Whole seedling | 25 °C | 297.69 ± 1.5 d | 271.21 ± 1.2 d | 23.98 ± 0.25 e |
30 °C | 364.12 ± 1.7 e | 287.46 ± 1.4 c | 26.57 ± 0.62 e | |
35 °C | 270.95 ± 1.2a | 164.28 ± 1.3 b | 18.59 ± 0.61 d | |
Roots | 25 °C | 155.69 ± 1.3a | 134.21 ± 1.1 d | 15.53 ± 0.98 a |
30 °C | 191.85 ± 1.2 b | 141.49 ± 1.2 c | 20.64 ± 0.21 d | |
35 °C | 233.54 ± 1.4 c | 123.65 ± 0.68 e | 10.86 ± 0.37 b | |
Seeds | 25 °C | 131.42 ± 1.1 c | 99.25 ± 0.95 d | 6.38 ± 0.23 a |
30 °C | 144.13 ± 1.3 d | 117.27 ± 1.2c | 10.52 ± 0.16 d | |
35 °C | 113.55 ± 0.43 e | 88.64 ± 0.67 e | 4.59 ± 0.03 a |
Genes | Accession Number | Primers | Sequence (5′-3′/3′-5′) |
---|---|---|---|
Cu/Zn-SOD | JQ284380.1 | Forward | ATCCTGCTGGCAAAGAACAT |
Reverse | ATCTGCATGGACAACGACAG | ||
GGP | AB924665.1 | Forward | CAAGCTCTTGGGGAAGTGAG |
Reverse | TCACCGAGCTCTGTTCATTG | ||
TPS | MG736641.1 | Forward | GGCCATTACAATGCCAGAGT |
Reverse | ACAATAGGTTCCACGGCAAG | ||
APX | JQ284377.1 | Forward | TTGAGGGTCGTCTTCCTGAT |
Reverse | GCAAAAGCCCTTCCTTCTCT | ||
GAPDH | JQ764560.1 | Forward | TGCTAGCTGCACTACCAACTG |
Reverse | TCCTGTGCTGCTAGGAATGA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bhuker, A.; Malik, A.; Punia, H.; McGill, C.; Sofkova-Bobcheva, S.; Mor, V.S.; Singh, N.; Ahmad, A.; Mansoor, S. Probing the Phytochemical Composition and Antioxidant Activity of Moringa oleifera under Ideal Germination Conditions. Plants 2023, 12, 3010. https://doi.org/10.3390/plants12163010
Bhuker A, Malik A, Punia H, McGill C, Sofkova-Bobcheva S, Mor VS, Singh N, Ahmad A, Mansoor S. Probing the Phytochemical Composition and Antioxidant Activity of Moringa oleifera under Ideal Germination Conditions. Plants. 2023; 12(16):3010. https://doi.org/10.3390/plants12163010
Chicago/Turabian StyleBhuker, Axay, Anurag Malik, Himani Punia, Craig McGill, Svetla Sofkova-Bobcheva, Virender Singh Mor, Nirmal Singh, Ajaz Ahmad, and Sheikh Mansoor. 2023. "Probing the Phytochemical Composition and Antioxidant Activity of Moringa oleifera under Ideal Germination Conditions" Plants 12, no. 16: 3010. https://doi.org/10.3390/plants12163010