Chromosomal Location of xa19, a Broad-Spectrum Rice Bacterial Blight Resistant Gene from XM5, a Mutant Line from IR24
Abstract
:1. Introduction
2. Materials and Methods
2.1. Bacterial Races and Plant Materials
2.2. Genetic Analysis of xa19
2.3. Evaluation of Xoo Resistance
2.4. Inoculation of Xoo
2.5. Molecular Techniques
3. Results
3.1. The Reaction of XM5 to Japanese Xoo Races
3.2. Trisomic Analysis of xa19
3.3. Rough Mapping of xa19
3.4. Linkage Analysis of xa19
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- International Rice Genome Sequencing Project (IRGSP). The map-based sequence of the rice genome. Nature 2005, 436, 793–800. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gale, M.D.; Devos, K.M. Plant Comparative Genetics after 10 Years. Science 1998, 282, 656–659. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bennetzen, J.L.; Chen, M. Grass Genomic Synteny Illuminates Plant Genome Function and Evolution. Rice 2008, 1, 109–118. [Google Scholar] [CrossRef] [Green Version]
- Mansfield, J.; Genin, S.; Magori, S.; Citovsky, V.; Sriariyanum, M.; Ronald, P.; Dow, M.; Verdier, V.; Beer, S.V.; Machado, M.A.; et al. Top 10 Plant Pathogenic Bacteria in Molecular Plant Pathology: Top 10 Plant Pathogenic Bacteria. Mol. Plant Pathol. 2012, 13, 614–629. [Google Scholar] [CrossRef] [Green Version]
- Ezuka, A.; Kaku, H. A Historical Review of Bacterial Blight of Rice. Bull. Natl. Inst. Agrobiol. Resour. 2000, 15, 1–207. [Google Scholar]
- Ochiai, H.; Inoue, Y.; Takeya, M.; Sasaki, A.; Kaku, H. Genome Sequence of Xanthomonas oryzae pv. oryzae Suggests Contribution of Large Numbers of Effector Genes and Insertion Sequences to Its Race Diversity. JARQ 2005, 39, 275–287. [Google Scholar] [CrossRef] [Green Version]
- Lee, B.-M.; Park, Y.-J.; Park, D.-S.; Kang, H.-W.; Kim, J.-G.; Song, E.-S.; Park, I.-C.; Yoon, U.-H.; Hahn, J.-H.; Koo, B.-S.; et al. The Genome Sequence of Xanthomonas oryzae pathovar oryzae KACC10331, the Bacterial Blight Pathogen of Rice. Nucleic Acids Res. 2005, 33, 577–586. [Google Scholar] [CrossRef] [Green Version]
- Salzberg, S.L.; Sommer, D.D.; Schatz, M.C.; Phillippy, A.M.; Rabinowicz, P.D.; Tsuge, S.; Furutani, A.; Ochiai, H.; Delcher, A.L.; Kelley, D.; et al. Genome Sequence and Rapid Evolution of the Rice Pathogen Xanthomonas oryzae pv. oryzae PXO99A. BMC Genom. 2008, 9, 204. [Google Scholar] [CrossRef] [Green Version]
- Midha, S.; Bansal, K.; Kumar, S.; Girija, A.M.; Mishra, D.; Brahma, K.; Laha, G.S.; Sundaram, R.M.; Sonti, R.V.; Patil, P.B. Population Genomic Insights into Variation and Evolution of Xanthomonas oryzae pv. oryzae. Sci. Rep. 2017, 7, 40694. [Google Scholar] [CrossRef] [Green Version]
- Oliva, R.; Ji, C.; Atienza-Grande, G.; Huguet-Tapia, J.C.; Perez-Quintero, A.; Li, T.; Eom, J.-S.; Li, C.; Nguyen, H.; Liu, B.; et al. Broad-Spectrum Resistance to Bacterial Blight in Rice Using Genome Editing. Nat. Biotechnol. 2019, 37, 1344–1350. [Google Scholar] [CrossRef] [Green Version]
- Flor, H.H. Current Status of the Gene-For-Gene Concept. Annu. Rev. Phytopathol. 1971, 9, 275–296. [Google Scholar] [CrossRef]
- Jiang, N.; Yan, J.; Liang, Y.; Shi, Y.; He, Z.; Wu, Y.; Zeng, Q.; Liu, X.; Peng, J. Resistance Genes and Their Interactions with Bacterial Blight/Leaf Streak Pathogens (Xanthomonas oryzae) in Rice (Oryza sativa L.)—An Updated Review. Rice 2020, 13, 3. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Neelam, K.; Mahajan, R.; Gupta, V.; Bhatia, D.; Gill, B.K.; Komal, R.; Lore, J.S.; Mangat, G.S.; Singh, K. High-Resolution Genetic Mapping of a Novel Bacterial Blight Resistance Gene xa-45(t) Identified from Oryza glaberrima and Transferred to Oryza sativa. Theor. Appl. Genet. 2020, 133, 689–705. [Google Scholar] [CrossRef]
- Chen, S.; Wang, C.; Yang, J.; Chen, B.; Wang, W.; Su, J.; Feng, A.; Zeng, L.; Zhu, X. Identification of the Novel Bacterial Blight Resistance Gene Xa46(t) by Mapping and Expression Analysis of the Rice Mutant H120. Sci. Rep. 2020, 10, 12642. [Google Scholar] [CrossRef] [PubMed]
- Taura, S.; Ogawa, T.; Yoshimura, A.; Omura, T. Induction of Mutants Resistant to Bacterial Blight in Rice. Jpn. J. Breed. 1991, 41, 279–288. [Google Scholar] [CrossRef] [Green Version]
- Taura, S.; Ogawa, T.; Yoshimura, A.; Ikeda, R.; Omura, T. Identification of a Recessive Resistance Gene in Induced Mutant Line XM5 of Rice to Rice Bacterial Blight. Jpn. J. Breed. 1991, 41, 427–432. [Google Scholar] [CrossRef]
- Taura, S.; Ogawa, T.; Yoshimura, A.; Ikeda, R.; lwata, N. Identification of a Recessive Resistance Gene to Rice Bacterial Blight of Mutant Line XM6, Oryza sativa L. Jpn. J. Breed. 1992, 42, 7–13. [Google Scholar] [CrossRef] [Green Version]
- Busungu, C.; Taura, S.; Sakagami, J.-I.; Ichitani, K. Identification and Linkage Analysis of a New Rice Bacterial Blight Resistance Gene from XM14, a Mutant Line from IR24. Breed. Sci. 2016, 66, 636–645. [Google Scholar] [CrossRef] [Green Version]
- Busungu, C.; Taura, S.; Sakagami, J.-I.; Anai, T.; Ichitani, K. High-Resolution Mapping and Characterization of xa42, a Resistance Gene against Multiple Xanthomonas oryzae pv. oryzae Races in Rice (Oryza sativa L.). Breed. Sci. 2018, 68, 188–199. [Google Scholar] [CrossRef] [Green Version]
- Msami, J.A.; Kawaguchi, Y.; Ichitani, K.; Taura, S. Linkage Analysis of Rice Bacterial Blight Resistance Gene xa20 in XM6, a Mutant Line from IR24. Breed. Sci. 2021, 71, 144–154. [Google Scholar] [CrossRef]
- Viana, V.E.; Pegoraro, C.; Busanello, C.; Costa de Oliveira, A. Mutagenesis in Rice: The Basis for Breeding a New Super Plant. Front. Plant Sci. 2019, 10, 1326. [Google Scholar] [CrossRef]
- Ogawa, T.; Yamamoto, T.; Khush, G.S.; Mew, T.-W. Breeding of Near-Isogenic Lines of Rice with Single Genes for Resistance to Bacterial Blight Pathogen (Xanthomonas campestris pv. oryzae). Jpn. J. Breed. 1991, 41, 523–529. [Google Scholar] [CrossRef] [Green Version]
- Ichitani, K.; Taura, S.; Sato, M.; Kuboyama, T. Distribution of Hwc2-1, a causal gene of a hybrid weakness, in the World Rice Core collection and the Japanese Rice mini Core collection: Its implications for varietal differentiation and artificial selection. Breed. Sci. 2016, 66, 776–789. [Google Scholar] [CrossRef] [Green Version]
- Oka, H.-I. Phylogenetic differentiation of the cultivated rice plant I. Variation of various characters and character combinations among rice varieties. Jpn. J. Breed. 1953, 3, 33–43. [Google Scholar] [CrossRef] [Green Version]
- Sato, Y.-I. Variation in Spikelet Shape of the indica and japonica Rice Cultivars in Asian Origin. Jpn. J. Breed. 1991, 41, 121–134. [Google Scholar] [CrossRef] [Green Version]
- Wang, C.; Tan, M.; Xu, X.; Wen, G.; Zhang, D.; Lin, X. Localizing the Bacterial Blight Resistance Gene, Xa22(t), to a 100-Kilobase Bacterial Artificial Chromosome. Phytopathology 2003, 90, 1258–1262. [Google Scholar] [CrossRef] [Green Version]
- Li, Z.K.; Arif, M.; Zhong, D.B.; Fu, B.Y.; Xu, J.L.; Domingo-Rey, J.; Ali, J.; Vijayakumar, C.H.M.; Yu, S.B.; Khush, G.S. Complex Genetic Networks Underlying the Defensive System of Rice (Oryza sativa L.) to Xanthomonas oryzae pv. oryzae. Proc. Natl. Acad. Sci. USA 2006, 103, 7994–7999. [Google Scholar] [CrossRef] [Green Version]
- Djedatin, G.; Ndjiondjop, M.-N.; Sanni, A.; Lorieux, M.; Verdier, V.; Ghesquiere, A. Identification of Novel Major and Minor QTLs Associated with Xanthomonas oryzae pv. oryzae (African Strains) Resistance in Rice (Oryza sativa L.). Rice 2016, 9, 18. [Google Scholar] [CrossRef] [Green Version]
- Shah, S.; Tsuneyoshi, H.; Ichitani, K.; Taura, S. QTL Analysis Revealed One Major Genetic Factor Inhibiting Lesion Elongation by Bacterial Blight (Xanthomonas oryzae pv. oryzae) from a japonica Cultivar Koshihikari in Rice. Plants 2022, 11, 867. [Google Scholar] [CrossRef]
- Kubo, T.; Aida, Y.; Nakamura, K.; Tsunematsu, H.; Doi, K.; Yoshimura, A. Reciprocal Chromosome Segment Substitution Series Derived from Japonica and Indica Cross of Rice (Oryza sativa L.). Breed. Sci. 2002, 52, 319–325. [Google Scholar] [CrossRef] [Green Version]
- Khush, G.S.; Singh, R.J.; Sur, S.C.; Librojo, A.L. Primary Trisomics of Rice: Origin, Morphology, Cytology and Usein Linkage Mapping. Genetics 1984, 107, 141–163. [Google Scholar] [CrossRef]
- Ogawa, T.; Yamamoto, T.; Kaku, H.; Taura, S.; Khush, G.; Mew, T. Resistance to Rice Bacterial Leaf Blight: Report of April 1982-March 1988; Government of Japan: Tokyo, Japan; International Rice Research Institute: Manila, Philippines, 1988. [Google Scholar]
- Khush, G.S. Announcement -Change in the Designation of Trisomics of IR36. Rice Genet. Newsl. 1990, 7, 14. [Google Scholar]
- Kaku, H.; Kimura, T. Reaction Types of Rice Cultivars to Strains of Xanthomonas oxyzae. Bull. Chugoku Natl. Agric. Exp. Station. Ser. E Environ. Div. 1978, 13, 17–43. [Google Scholar]
- Kaku, H.; Kimura, T. Qualitative Resistance Reaction of Rice Cultivar Asominori to Certain Race II Strains of Xanthomonas campestris pv. oryzae. Jpn. J. Phytopathol. 1989, 55, 657–659. [Google Scholar] [CrossRef]
- Okumoto, Y.; Tanisaka, T. Trisomic Analysis of a Strong Photoperiod-Sensitivity Gene E1 in Rice (Oryza sativa L.). Euphytica 1997, 95, 301–307. [Google Scholar] [CrossRef]
- Iwata, N. Trisomic Analysis. In Science of the Rice Plant Vol. 3 Genetics; Matsuo, T., Futsuhara, Y., Kikuchi, F., Yamaguchi, H., Eds.; Food and Agriculture Policy Research Center: Tokyo, Japan, 1997; pp. 186–197. [Google Scholar]
- Temnykh, S.; DeClerck, G.; Lukashova, A.; Lipovich, L.; Cartinhour, S.; McCouch, S. Computational and experimental analysis of microsatellites in rice (Oryza sativa L.): Frequency, length variation, transposon associations, and genetic marker potential. Genome Res. 2001, 8, 1441–1452. [Google Scholar] [CrossRef] [Green Version]
- McCouch, S.R.; Teytelman, L.; Xu, Y.; Lobos, K.B.; Clare, K.; Walton, M.; Fu, B.; Maghirang, R.; Li, Z.; Xing, Y.; et al. Development and Mapping of 2240 New SSR Markers for Rice (Oryza sativa L.). DNA Res. 2002, 9, 199–207. [Google Scholar] [CrossRef]
- Chen, X.; Temnykh, S.; Xu, Y.; Cho, Y.G.; McCouch, S.R. Development of a Microsatellite Framework Map Providing Genome-Wide Coverage in Rice (Oryza sativa L.). Theor. Appl. Genet. 1997, 95, 553–567. [Google Scholar] [CrossRef]
- Panaud, O.; Chen, X.; McCouch, S.R. Development of Microsatellite Markers and Characterization of Simple Sequence Length Polymorphism (SSLP) in Rice (Oryza sativa L.). Mol. Gen. Genet. 1996, 252, 597–607. [Google Scholar] [CrossRef]
- Iwata, H.; Ninomiya, S. AntMap: Constructing Genetic Linkage Maps Using an Ant Colony Optimization Algorithm. Breed. Sci. 2006, 56, 371–377. [Google Scholar] [CrossRef] [Green Version]
- Wakimoto, S. Biological and Physiological Properties of Xanthomonas oryzae Phage. Sci. Bull. Fac. Agric. Kyushu Univ. 1954, 14, 485–493, (In Japanese with English summary). [Google Scholar] [CrossRef]
- Kauffman, H.E.; Reddy, A.P.K.; Hsieh, S.P.Y.; Merca, S.D. An Improved Technique for Evaluating Resistance of Rice Varieties to Xanthomonas oryzae. Plant Dis. Rep. 1973, 57, 537–541. [Google Scholar]
- Dellaporta, S.L.; Wood, J.; Hicks, J.B. Plant DNA Minipreparation: Version II. Plant Mol. Biol. Rep. 1983, 1, 19–21. [Google Scholar] [CrossRef]
- Kawahara, Y.; de la Bastide, M.; Hamilton, J.P.; Kanamori, H.; McCombie, W.R.; Ouyang, S.; Schwartz, D.C.; Tanaka, T.; Wu, J.; Zhou, S.; et al. Improvement of the Oryza Sativa Nipponbare Reference Genome Using next Generation Sequence and Optical Map Data. Rice 2013, 6, 4. [Google Scholar] [CrossRef]
- Harushima, Y.; Yano, M.; Shomura, A.; Sato, M.; Shimano, T.; Kuboki, Y.; Yamamoto, T.; Lin, S.Y.; Antonio, B.A.; Parco, A.; et al. A High-Density Rice Genetic Linkage Map with 2275 Markers Using a Single F2 Population. Genetics 1998, 148, 479–494. [Google Scholar] [CrossRef]
- Kumar, P.N.; Sujatha, K.; Laha, G.S.; Rao, K.S.; Mishra, B.; Viraktamath, B.C.; Hari, Y.; Reddy, C.S.; Balachandran, S.M.; Ram, T.; et al. Identification and Fine-Mapping of Xa33, a Novel Gene for Resistance to Xanthomonas oryzae pv. oryzae. Phytopathology 2012, 102, 222–228. [Google Scholar] [CrossRef] [Green Version]
- Vikal, Y.; Chawla, H.; Sharma, R.; Lore, J.S.; Singh, K. Mapping of Bacterial Blight Resistance Gene xa8 in Rice (Oryza sativa L.). Indian J. Genet. 2014, 74, 589. [Google Scholar] [CrossRef]
- Mizobuchi, R.; Hirabayashi, H.; Kaji, R.; Nishizawa, Y.; Yoshimura, A.; Satoh, H.; Ogawa, T.; Okamoto, M. Isolation and Characterization of Rice Lesion-Mimic Mutants with Enhanced Resistance to Rice Blast and Bacterial Blight. Plant Sci. 2002, 163, 345–353. [Google Scholar] [CrossRef]
- Iwata, N.; Omura, T.; Satoh, H. Linkage Studies in Rice (Oryza sativa L.): On Some Mutants for Physiological Leaf Spots. J. Fac. Agric. Kyushu Univ. 1978, 22, 243–251. [Google Scholar] [CrossRef]
- Chen, X.; Hao, L.; Pan, J.; Zheng, X.; Jiang, G.; Jin, Y.; Gu, Z.; Qian, Q.; Zhai, W.; Ma, B. SPL5, a Cell Death and Defense-Related Gene, Encodes a Putative Splicing Factor 3b Subunit 3 (SF3b3) in Rice. Mol. Breed. 2012, 30, 939–949. [Google Scholar] [CrossRef]
- Sakai, H.; Lee, S.S.; Tanaka, T.; Numa, H.; Kim, J.; Kawahara, Y.; Wakimoto, H.; Yang, C.; Iwamoto, M.; Abe, T.; et al. Rice Annotation Project Database (RAP-DB): An Integrative and Interactive Database for Rice Genomics. Plant Cell Physiol. 2013, 54, e6. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Niño-Liu, D.O.; Ronald, P.C.; Bogdanove, A.J. Xanthomonas oryzae pathovars: Model Pathogens of a Model Crop. Mol. Plant Pathol. 2006, 7, 303–324. [Google Scholar] [CrossRef] [PubMed]
- Yang, B.; Sugio, A.; White, F.F. Os8N3 Is a Host Disease-Susceptibility Gene for Bacterial Blight of Rice. Proc. Natl. Acad. Sci. USA 2006, 103, 10503–10508. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, Q.; Yuan, M.; Zhou, Y.; Li, X.; Xiao, J.; Wang, S. A Paralog of the MtN3/Saliva Family Recessively Confers Race-Specific Resistance to Xanthomonas oryzae in Rice. Plant Cell Environ. 2011, 34, 1958–1969. [Google Scholar] [CrossRef]
- Hutin, M.; Sabot, F.; Ghesquière, A.; Koebnik, R.; Szurek, B. A Knowledge-Based Molecular Screen Uncovers a Broad-Spectrum OsSWEET14 Resistance Allele to Bacterial Blight from Wild Rice. Plant J. 2015, 84, 694–703. [Google Scholar] [CrossRef]
- Iyer, A.S.; McCouch, S.R. The Rice Bacterial Blight Resistance Gene xa5 Encodes a Novel Form of Disease Resistance. Mol. Plant Microbe Interact. 2004, 17, 1348–1354. [Google Scholar] [CrossRef] [Green Version]
- Satoh, H.; Matsusaka, H.; Kumamaru, T. Use of N-Methyl-N-Nitrosourea Treatment of Fertilized Egg Cells for Saturation Mutagenesis of Rice. Breed. Sci. 2010, 60, 475–485. [Google Scholar] [CrossRef] [Green Version]
- Suzuki, T.; Eiguchi, M.; Kumamaru, T.; Satoh, H.; Matsusaka, H.; Moriguchi, K.; Nagato, Y.; Kurata, N. MNU-Induced Mutant Pools and High Performance TILLING Enable Finding of Any Gene Mutation in Rice. Mol. Genet. Genom. 2008, 279, 213–223. [Google Scholar] [CrossRef]
- Zeng, X.; Luo, Y.; Vu, N.T.Q.; Shen, S.; Xia, K.; Zhang, M. CRISPR/Cas9-Mediated Mutation of OsSWEET14 in Rice Cv. Zhonghua11 Confers Resistance to Xanthomonas oryzae pv. oryzae without Yield Penalty. BMC Plant Biol. 2020, 20, 313. [Google Scholar] [CrossRef]
- Zhou, J.; Peng, Z.; Long, J.; Sosso, D.; Liu, B.; Eom, J.-S.; Huang, S.; Liu, S.; Vera Cruz, C.; Frommer, W.B.; et al. Gene Targeting by the TAL Effector PthXo2 Reveals Cryptic Resistance Gene for Bacterial Blight of Rice. Plant J. 2015, 82, 632–643. [Google Scholar] [CrossRef]
- Xu, Z.; Xu, X.; Gong, Q.; Li, Z.; Li, Y.; Wang, S.; Yang, Y.; Ma, W.; Liu, L.; Zhu, B.; et al. Engineering Broad-Spectrum Bacterial Blight Resistance by Simultaneously Disrupting Variable TALE-Binding Elements of Multiple Susceptibility Genes in Rice. Mol. Plant 2019, 12, 1434–1446. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Calvo-Baltanás, V.; Wang, J.; Chae, E. Hybrid Incompatibility of the Plant Immune System: An Opposite Force to Heterosis Equilibrating Hybrid Performances. Front. Plant Sci. 2021, 11, 576796. [Google Scholar] [CrossRef] [PubMed]
Marker Name | Direction | Primer Sequence | Location of Os-Nipponbare-Reference-IRGSP-1.0 of Chromosome 7 | ||
---|---|---|---|---|---|
From (bp) | To (bp) | Source | |||
RM481 | F | TAGCTAGCCGATTGAATGGC | 2,876,165 | 2,876,333 | [38] |
R | CTCCACCTCCTATGTTGTTG | ||||
RM7479 | F | CCAGTTGCAACAAAGCTCTG | 4,135,526 | 4,135,741 | [39] |
R | TAGGAGCGTTTGTAGGAGCG | ||||
RM6574 | F | AACCTCGAATTCCTTGGGAG | 4,682,829 | 4,682,937 | [39] |
R | TTCGACTCCAAGGAGTGCTC | ||||
RM21134 | F | GCTTCCTCGAGGGATGGTACGG | 4,947,993 | 4,948,107 | [1] |
R | GCTGAATTCCAACTTTCCGAGACC | ||||
RM8262 | F | CATTAGCCGTGGTGTATTTG | 5,299,401 | 5,299,600 | [39] |
R | TTTCATCCCTAGTGCCAAC | ||||
RM6728 | F | GGGTATGTGTCGCTATTTTA | 5,730,032 | 5,730,175 | [39] |
R | GAAATCTGGAATTTTCCCTA | ||||
RM5672 | F | CACCCTACAAGGAAACAAGC | 6,381,190 | 6,380,982 | [39] |
R | TGCCCAATATAGAGGCAACC | ||||
RM1253 | F | CTGAACTTGCCTGAGAACTC | 6,968,820 | 6,968,994 | [39] |
R | GACGACCTCTCCATGCTCG | ||||
RM3583 | F | TACAATTTGGCGACCTCCTC | 8,045,848 | 8,045,978 | [39] |
R | GGATGCCATGTCATCATCTG | ||||
RM3859 | F | TTGCAGATCGGTTTCCACTG | 8,878,209 | 8,878,399 | [39] |
R | GGTCCTGGATTCATGGTGTC | ||||
RM214 | F | CTGATGATAGAAACCTCTTCTC | 12,784,612 | 12,784,504 | [40] |
R | AAGAACAGCTGACTTCACAA | ||||
RM500 | F | GAGCTTGCCAGAGTGGAAAG | 15,911,539 | 15,911,794 | [38] |
R | GTTACACCGAGAGCCAGCTC | ||||
RM11 | F | TCTCCTCTTCCCCC GATC | 19,257,907 | 19,258,032 | [41] |
R | ATAGCGGGCGAGGCTTAG |
Rice Accession | Lesion Length 1 (cm) | ||||
---|---|---|---|---|---|
Race I | Race II | Race III | Race IV | Race V | |
T7174 | T7147 | T7133 | H75373 | H75304 | |
XM5 | 1.8 ± 0.2 | 1.1 ± 0.6 | 2.2 ± 1.0 | 2.5 ± 0.5 | 1.1 ± 0.3 |
IR24 | 24.6 ± 5.7 | 30.2 ± 6.7 | 29.0 ± 3.5 | 20.2 ± 1.5 | 21.0 ± 4.8 |
Kinmaze | 9.1 ± 3.1 | 13.9 ± 3.0 | 19.9 ± 4.0 | 5.7 ± 0.7 | 15.4 ± 2.3 |
IAS44 | 15.2 ± 3.9 | 19.7 ± 5.5 | 25.0 ± 1.2 | 11.4 ± 0.7 | 10.7 ± 1.1 |
Cross | Fraction of Population | χ2 | ||||||
---|---|---|---|---|---|---|---|---|
Reaction of F2 Plants 1 | Expected Ratio | |||||||
R | S | Total | 1:3 | 1:8 | 1:44 | 1:35 | ||
Triplo 1 × XM5 | Total | 9 | 18 | 27 | 1 | |||
Triplo 6 × XM5 | 2x | 44 | 165 | 209 | 1.737 | 20.914 ** 2 | ||
2x+1 | 1 | 75 | 76 | 22.737 ** | 0.287 | 0.602 | ||
Total | 45 | 240 | 285 | 12.895 ** | ||||
Triplo 7 × XM5 | 2x | 7 | 86 | 9 | 15.143 ** | 1.210 | ||
2x+1 | 0 | 49 | 49 | 16.333 ** | 1.114 | 1.400 | ||
Total | 7 | 135 | 142 | 30.507 ** | ||||
Triplo 9 × XM5 | Total | 54 | 178 | 232 | 0.368 | |||
Triplo 10 × XM5 | Total | 16 | 79 | 95 | 0.372 | |||
Triplo 11 × XM5 | Total | 46 | 189 | 235 | 3.689 |
F2 Plant No. 2 | Genotype of DNA Marker Loci 1 | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
RM481 | RM7479 | RM6574 | RM6728 | RM5672 | RM1253 | RM3583 | RM3859 | RM214 | RM500 | RM11 | |
1 | K | H | H | X | X | X | X | X | X | X | X |
2 | H | H | H | X | X | X | X | X | X | X | X |
3 | H | H | H | X | X | X | X | X | X | X | X |
4 | X | X | X | X | X | X | X | X | X | X | H |
5 | X | X | X | X | X | H | H | H | H | H | H |
6 | X | X | X | X | H | H | H | H | H | H | H |
7 | X | X | - | - | X | X | X | X | X | X | X |
8 | X | X | - | - | ND | X | X | ND | X | X | X |
9 | X | X | - | - | ND | X | X | X | X | X | X |
10 | X | X | - | - | X | X | X | X | X | X | X |
11 | X | X | - | - | X | X | X | X | X | H | H |
12 | X | X | - | - | X | X | X | X | X | X | X |
13 | X | X | - | - | X | X | X | X | X | X | X |
14 | X | X | - | - | ND | X | X | X | X | X | H |
15 | X | X | - | - | X | X | X | X | X | X | X |
16 | X | X | - | - | X | X | X | X | X | X | X |
17 | H | X | - | - | X | X | X | X | X | X | X |
18 | X | X | - | - | ND | X | X | X | X | X | X |
19 | X | X | - | - | ND | X | X | X | X | X | H |
20 | X | X | - | - | X | X | X | X | X | X | X |
21 | H | X | - | - | X | X | X | X | X | X | X |
22 | X | X | - | - | X | X | X | X | X | X | X |
23 | X | X | - | - | X | X | X | X | X | X | X |
24 | X | X | - | - | X | X | X | X | X | X | H |
25 | X | X | - | - | X | X | X | X | X | X | X |
26 | X | X | - | - | X | X | X | X | X | X | X |
27 | X | X | - | - | X | X | X | X | X | X | H |
28 | X | X | - | - | X | X | X | X | X | X | X |
29 | X | X | - | - | X | X | X | X | X | X | H |
30 | ND | X | - | - | X | X | X | X | X | X | X |
31 | X | X | - | - | X | X | X | X | X | X | H |
32 | X | X | - | - | X | X | X | X | X | X | X |
33 | X | X | - | - | X | X | X | X | X | X | X |
34 | X | X | - | - | X | X | X | X | X | X | X |
35 | X | X | - | - | X | X | X | X | X | X | X |
36 | X | X | - | - | X | X | X | X | X | X | H |
37 | X | X | - | - | X | X | X | X | X | X | X |
F2 Plant No. | Lesion Length (cm) | Genotypes of the DNA Marker Loci 1 | Segregation in F3 Plants 2 | ||||||
---|---|---|---|---|---|---|---|---|---|
RM6574 | RM21134 | RM8262 | RM6728 | RM5672 | R | S | Total | ||
1 | 16.0 | A | A | H | H | H | 7 | 22 | 29 |
2 | 48.3 | A | A | H | H | H | 10 | 14 | 24 |
3 | 42.5 | A | A | H | H | H | 8 | 20 | 28 |
4 | 19.3 | H | A | H | H | H | 5 | 24 | 29 |
5 | 17.0 | H | H | A | A | A | 0 | 29 | 29 |
6 | 18.9 | H | H | A | A | A | 0 | 24 | 24 |
7 | 24.3 | H | H | A | A | A | 0 | 29 | 29 |
8 | 26.8 | H | H | A | A | A | 0 | 24 | 24 |
9 | 13.7 | H | H | H | A | A | 0 | 20 | 20 |
10 | 1.9 | H | H | H | X | X | 29 | 0 | 29 |
11 | 49.3 | H | H | H | X | X | 5 | 15 | 20 |
12 | 16.6 | X | X | H | H | H | 7 | 22 | 29 |
13 | 18.1 | X | X | H | H | H | 5 | 23 | 28 |
14 | 14.0 | X | H | H | H | H | - 3 | - | |
15 | 29.0 | X | H | H | H | H | - | - | |
16 | 18.9 | X | H | H | H | H | - | - | |
17 | 13.0 | X | H | H | H | H | - | - | |
18 | 0.8 | X | X | X | X | H | - | - | |
19 | 0.3 | X | X | X | X | H | - | - | |
20 | 0.4 | X | X | X | X | H | - | - |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Taura, S.; Ichitani, K. Chromosomal Location of xa19, a Broad-Spectrum Rice Bacterial Blight Resistant Gene from XM5, a Mutant Line from IR24. Plants 2023, 12, 602. https://doi.org/10.3390/plants12030602
Taura S, Ichitani K. Chromosomal Location of xa19, a Broad-Spectrum Rice Bacterial Blight Resistant Gene from XM5, a Mutant Line from IR24. Plants. 2023; 12(3):602. https://doi.org/10.3390/plants12030602
Chicago/Turabian StyleTaura, Satoru, and Katsuyuki Ichitani. 2023. "Chromosomal Location of xa19, a Broad-Spectrum Rice Bacterial Blight Resistant Gene from XM5, a Mutant Line from IR24" Plants 12, no. 3: 602. https://doi.org/10.3390/plants12030602