Neutral Dietary Effects of Two MicroRNAs, Csu-Novel-260 and Csu-Mir-14, on the Non-Target Arthropod Folsomia candida
Abstract
:1. Introduction
2. Results
2.1. Binding Probability of miRNA and Target Genes
2.2. Response of F. candida to Chlorpyrifos
2.3. Stability of miRNA in Artificial Diet
2.4. Uptake of miRNA in F. candida
2.5. The Expression Levels of Target Genes of miRNA
2.6. Effects on Life-Table Parameters
3. Discussion
4. Materials and Methods
4.1. Insect Strain and Rearing
4.2. miRNAs and Testing Compounds
4.3. Binding Probability of miRNA and Target Genes in F. candida
4.4. Determination of Positive Control
4.5. Stability of miRNA in Artificial Diet
4.6. Uptake of miRNA and Expression Level of Target Genes in F. candida
4.7. miRNA Effects on Life-Table Parameters
4.8. Real-Time Quantitative PCR
4.9. Statistical Analysis
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Silver, K.; Cooper, A.M.; Zhu, K.Y. Strategies for enhancing the efficiency of RNA interference in insects. Pest Manag. Sci. 2021, 77, 2645–2658. [Google Scholar] [CrossRef] [PubMed]
- Burand, J.P.; Hunter, W.B. RNAi: Future in insect management. J. Invertebr. Pathol. 2013, 112, S68–S74. [Google Scholar] [CrossRef] [PubMed]
- Zhu, K.Y.; Palli, S.R. Mechanisms, Applications, and Challenges of Insect RNA Interference. Annu. Rev. Entomol. 2020, 65, 293–311. [Google Scholar] [CrossRef] [PubMed]
- List, F.; Tarone, A.M.; Zhu-Salzman, K.; Vargo, E.L. RNA meets toxicology: Efficacy indicators from the experimental design of RNAi studies for insect pest management. Pest Manag. Sci. 2022, 78, 3215–3225. [Google Scholar] [CrossRef] [PubMed]
- Baum, J.A.; Bogaert, T.; Clinton, W.; Heck, G.R.; Feldmann, P.; Ilagan, O.; Johnson, S.; Plaetinck, G.; Munyikwa, T.; Pleau, M.; et al. Control of coleopteran insect pests through RNA interference. Nat. Biotechnol. 2007, 25, 1322–1326. [Google Scholar] [CrossRef]
- Mao, Y.B.; Cai, W.J.; Wang, J.W.; Hong, G.J.; Tao, X.Y.; Wang, L.J.; Huang, Y.P.; Chen, X.Y. Silencing a cotton bollworm P450 monooxygenase gene by plant-mediated RNAi impairs larval tolerance of gossypol. Nat. Biotechnol. 2007, 25, 1307–1313. [Google Scholar] [CrossRef]
- Zheng, X.; Weng, Z.; Li, H.; Kong, Z.; Zhou, Z.; Li, F.; Ma, W.; Lin, Y.; Chen, H. Transgenic rice overexpressing insect endogenous microRNA csu-novel-260 is resistant to striped stem borer under field conditions. Plant Biotechnol. J. 2021, 19, 421–423. [Google Scholar] [CrossRef]
- He, K.; Xiao, H.; Sun, Y.; Situ, G.; Xi, Y.; Li, F. microRNA-14 as an efficient suppressor to switch off ecdysone production after ecdysis in insects. RNA Biol. 2019, 16, 1313–1325. [Google Scholar] [CrossRef]
- Gardini, M.A.F. Establishment of the Uruguayan Biosafety Framework and a Regulatory Perspective of Environmental Risk Assessment for Transgenic Crops Engineered with Complex Traits; Michigan State University: East Lansing, MI, USA, 2013. [Google Scholar]
- Roberts, A.F.; Devos, Y.; Lemgo, G.N.; Zhou, X. Biosafety research for non-target organism risk assessment of RNAi-based GE plants. Front. Plant Sci. 2015, 6, 958. [Google Scholar] [CrossRef]
- Casacuberta, J.M.; Devos, Y.; du Jardin, P.; Ramon, M.; Vaucheret, H.; Nogue, F. Biotechnological uses of RNAi in plants: Risk assessment considerations. Trends Biotechnol. 2015, 33, 145–147. [Google Scholar] [CrossRef]
- De Schutter, K.; Taning, C.N.T.; Van Daele, L.; Van Damme, E.J.M.; Dubruel, P.; Smagghe, G. RNAi-Based Biocontrol Products: Market Status, Regulatory Aspects, and Risk Assessment. Front. Insect Sci. 2022, 1. [Google Scholar] [CrossRef]
- Pinheiro, P.V.; de Faria, J.C. GMOs—Impact on Non-target Arthropods. GMOS 2020, 87–127. [Google Scholar] [CrossRef]
- Velez, A.M.; Jurzenski, J.; Matz, N.; Zhou, X.; Wang, H.; Ellis, M.; Siegfried, B.D. Developing an in vivo toxicity assay for RNAi risk assessment in honey bees, Apis mellifera L. Chemosphere 2016, 144, 1083–1090. [Google Scholar] [CrossRef]
- Pan, H.; Yang, X.; Bidne, K.; Hellmich, R.L.; Siegfried, B.D.; Zhou, X. Dietary Risk Assessment of v-ATPase A dsRNAs on Monarch Butterfly Larvae. Front. Plant Sci. 2017, 8, 242. [Google Scholar] [CrossRef]
- Pan, H.; Xu, L.; Noland, J.E.; Li, H.; Siegfried, B.D.; Zhou, X. Assessment of Potential Risks of Dietary RNAi to a Soil Micro-arthropod, Sinella curviseta Brook (Collembola: Entomobryidae). Front. Plant Sci. 2016, 7, 1028. [Google Scholar] [CrossRef] [PubMed]
- Pan, H.; Yang, X.; Romeis, J.; Siegfried, B.D.; Zhou, X. Dietary RNAi toxicity assay exhibits differential responses to ingested dsRNAs among lady beetles. Pest. Manag. Sci. 2020, 76, 3606–3614. [Google Scholar] [CrossRef]
- Haller, S.; Widmer, F.; Siegfried, B.D.; Zhuo, X.; Romeis, J. Responses of two ladybird beetle species (Coleoptera: Coccinellidae) to dietary RNAi. Pest Manag. Sci. 2019, 75, 2652–2662. [Google Scholar] [CrossRef]
- Bitzer, R.J.; Buckelew, L.D.; Pedigo, L.P. Effects of Transgenic Herbicide-Resistant Soybean Varieties and Systems on Surface-Active Springtails (Entognatha: Collembola). Environ. Entomol. 2002, 31, 449–461. [Google Scholar] [CrossRef]
- Fountain, M.T.; Hopkin, S.P. Folsomia candida (Collembola): A “standard” soil arthropod. Annu. Rev. Entomol. 2005, 50, 201–222. [Google Scholar] [CrossRef]
- Wang, B.F.; Wu, F.C.; Yin, J.Q.; Jiang, Z.L.; Song, X.Y.; Reddy, G.V.P. Use of Taxonomic and Trait-Based Approaches to Evaluate the Effect of Bt maize Expressing Cry1Ie Protein on Non-Target Collembola: A Case Study in Northeast China. Insects 2021, 12, 88. [Google Scholar] [CrossRef]
- Yang, Y.; Zhang, B.; Zhou, X.; Romeis, J.; Peng, Y.; Li, Y. Toxicological and Biochemical Analyses Demonstrate the Absence of Lethal or Sublethal Effects of cry1C- or cry2A-Expressing Bt Rice on the Collembolan Folsomia candida. Front. Plant Sci. 2018, 9, 131. [Google Scholar] [CrossRef] [PubMed]
- Zhang, B.; Yang, Y.; Zhou, X.; Shen, P.; Peng, Y.; Li, Y. A laboratory assessment of the potential effect of Cry1Ab/Cry2Aj-containing Bt maize pollen on Folsomia candida by toxicological and biochemical analyses. Environ. Pollut. 2017, 222, 94–100. [Google Scholar] [CrossRef]
- Yang, Y.; Chen, X.; Cheng, L.; Cao, F.; Romeis, J.; Li, Y.; Peng, Y. Toxicological and biochemical analyses demonstrate no toxic effect of Cry1C and Cry2A to Folsomia candida. Sci. Rep. 2015, 5, 15619. [Google Scholar] [CrossRef] [PubMed]
- Yu, L.; Berry, R.; Croft, B. Effects of Bacillus thuringiensis toxins in transgenic cotton and potato on Folsomia candida (Collembola: Isotomidae) and Oppia nitens (Acari: Orbatidae). J. Econ. Entomol. 1997, 90, 113–118. [Google Scholar] [CrossRef]
- Boeckman, C.J.; Anderson, J.A.; Linderblood, C.; Olson, T.; Roper, J.; Sturtz, K.; Walker, C.; Woods, R. Environmental risk assessment of the DvSSJ1 dsRNA and the IPD072Aa protein to non-target organisms. GM Crops Food 2021, 12, 459–478. [Google Scholar] [CrossRef]
- Noland, J.E. Risk Parameters and Assessment of Dietary dsRNA Exposure in Folsomia candida; University of Kentucky: Lexington, KY, USA, 2017. [Google Scholar]
- Romeis, J.; Bartsch, D.; Bigler, F.; Candolfi, M.P.; Gielkens, M.M.C.; Hartley, S.E.; Hellmich, R.L.; Huesing, J.E.; Jepson, P.C.; Layton, R.; et al. Assessment of risk of insect-resistant transgenic crops to nontarget arthropods. Nat. Biotechnol. 2008, 26, 203–208. [Google Scholar] [CrossRef] [PubMed]
- Andow, D.A.; Zwahlen, C. Assessing environmental risks of transgenic plants. Ecol. Lett. 2006, 9, 196–214. [Google Scholar] [CrossRef]
- Chen, J.; Wang, H.; Yang, X.; Chen, G.; Du, L.; Chen, H.; Li, Y.; Peng, Y.; Han, L. Consumption of miRNA-Mediated Insect-Resistant Transgenic Rice Pollen does not Harm Apis mellifera Adults. J. Agric. Food Chem. 2021, 69, 4234–4242. [Google Scholar] [CrossRef] [PubMed]
- EPA, US. RNAi Technology as a Pesticide: Problem Formulation for Human Health and Ecological Risk Assessment; US EPA: Washington, DC, USA, 2014. [Google Scholar]
- Romeis, J.; Hellmich, R.L.; Candolfi, M.P.; Carstens, K.; De Schrijver, A.; Gatehouse, A.M.; Herman, R.A.; Huesing, J.E.; McLean, M.A.; Raybould, A.; et al. Recommendations for the design of laboratory studies on non-target arthropods for risk assessment of genetically engineered plants. Transgenic Res. 2011, 20, 1–22. [Google Scholar] [CrossRef]
- He, K.; Xiao, H.; Sun, Y.; Ding, S.; Situ, G.; Li, F. Transgenic microRNA-14 rice shows high resistance to rice stem borer. Plant Biotechnol. J. 2019, 17, 461–471. [Google Scholar] [CrossRef] [PubMed]
- Neumeier, J.; Meister, G. siRNA Specificity: RNAi Mechanisms and Strategies to Reduce Off-Target Effects. Front. Plant Sci. 2020, 11, 526455. [Google Scholar] [CrossRef]
- Zotti, M.J.; Smagghe, G. RNAi Technology for Insect Management and Protection of Beneficial Insects from Diseases: Lessons, Challenges and Risk Assessments. Neotrop. Entomol. 2015, 44, 197–213. [Google Scholar] [CrossRef] [PubMed]
- Wen, N.; Chen, J.; Chen, G.; Du, L.; Chen, H.; Li, Y.; Peng, Y.; Yang, X.; Han, L. The overexpression of insect endogenous microRNA in transgenic rice inhibits the pupation of Chilo suppressalis and Cnaphalocrocis medinalis. Pest Manag. Sci. 2021, 77, 3990–3999. [Google Scholar] [CrossRef]
- Xu, P.; Vernooy, S.Y.; Guo, M.; Hay, B.A. The Drosophila microRNA Mir-14 suppresses cell death and is required for normal fat metabolism. Curr. Biol. 2003, 13, 790–795. [Google Scholar] [CrossRef] [PubMed]
- Liu, Z.; Ling, L.; Xu, J.; Zeng, B.; Huang, Y.; Shang, P.; Tan, A. MicroRNA-14 regulates larval development time in Bombyx mori. Insect Biochem. Mol. 2018, 93, 57–65. [Google Scholar] [CrossRef]
- Liu, F.; Peng, W.; Li, Z.; Li, W.; Li, L.; Pan, J.; Zhang, S.; Miao, Y.; Chen, S.; Su, S. Next-generation small RNA sequencing for microRNAs profiling in Apis mellifera: Comparison between nurses and foragers. Insect Mol. Biol. 2012, 21, 297–303. [Google Scholar] [CrossRef] [PubMed]
- Kaur, R.; Choudhury, A.; Chauhan, S.; Ghosh, A.; Tiwari, R.; Rajam, M.V. RNA interference and crop protection against biotic stresses. Physiol. Mol. Biol. Plants 2021, 27, 2357–2377. [Google Scholar] [CrossRef]
- Varghese, J.; Cohen, S.M. microRNA miR-14 acts to modulate a positive autoregulatory loop controlling steroid hormone signaling in Drosophila. Genes Dev. 2007, 21, 2277–2282. [Google Scholar] [CrossRef] [PubMed]
- Jiang, Z.; Zhou, L.; Wang, B.; Wang, D.; Wu, F.; Yin, J.; Song, X. Toxicological and biochemical analyses demonstrate no toxic effect of Bt maize on the Folsomia candida. PLoS ONE 2020, 15, e0232747. [Google Scholar] [CrossRef] [PubMed]
- Candolfi, M.P.; Brown, K.; Grimm, C.; Reber, B.; Schmidli, H. A faunistic approach to assess potential side-effects of genetically modified Bt-Corn on non-target arthropods under field conditions. Biocontrol Sci. Technol. 2004, 14, 129–170. [Google Scholar] [CrossRef]
- Bakonyi, G.; Dolezsai, A.; Matrai, N.; Szekacs, A. Effects of Consumption of Bt-maize (MON 810) on the Collembolan Folsomia candida, over Multiple Generations: A Laboratory Study. Insects 2011, 2, 243–252. [Google Scholar] [CrossRef] [PubMed]
- Agrawal, A.; Rajamani, V.; Reddy, V.S.; Mukherjee, S.K.; Bhatnagar, R.K. Transgenic plants over-expressing insect-specific microRNA acquire insecticidal activity against Helicoverpa armigera: An alternative to Bt-toxin technology. Transgenic Res. 2015, 24, 791–801. [Google Scholar] [CrossRef] [PubMed]
- Lundgren, J.G.; Duan, J.J. RNAi-Based Insecticidal Crops: Potential Effects on Nontarget Species. BioScience 2013, 63, 657–665. [Google Scholar] [CrossRef]
- Darlington, M.; Reinders, J.D.; Sethi, A.; Lu, A.L.; Ramaseshadri, P.; Fischer, J.R.; Boeckman, C.J.; Petrick, J.S.; Roper, J.M.; Narva, K.E.; et al. RNAi for Western Corn Rootworm Management: Lessons Learned, Challenges, and Future Directions. Insects 2022, 13, 57. [Google Scholar] [CrossRef]
- Yan, S.; Ren, B.; Zeng, B.; Shen, J. Improving RNAi efficiency for pest control in crop species. BioTechniques 2020, 68, 283–290. [Google Scholar] [CrossRef]
- Flynt, A.S. Insecticidal RNA interference, thinking beyond long dsRNA. Pest Manag. Sci. 2021, 77, 2179–2187. [Google Scholar] [CrossRef]
- Parsons, K.H.; Mondal, M.H.; McCormick, C.L.; Flynt, A.S. Guanidinium-Functionalized Interpolyelectrolyte Complexes Enabling RNAi in Resistant Insect Pests. Biomacromolecules 2018, 19, 1111–1117. [Google Scholar] [CrossRef]
- Enright, A.J.; John, B.; Gaul, U.; Tuschl, T.; Sander, C.; Marks, D.S. MicroRNA targets in Drosophila. Genome Biol. 2003, 5, R1. [Google Scholar] [CrossRef] [PubMed]
- Kruger, J.; Rehmsmeier, M. RNAhybrid: microRNA target prediction easy, fast and flexible. Nucleic Acids Res. 2006, 34, W451–W454. [Google Scholar] [CrossRef]
- de Boer, M.E.; de Boer, T.E.; Marien, J.; Timmermans, M.J.; Nota, B.; van Straalen, N.M.; Ellers, J.; Roelofs, D. Reference genes for QRT-PCR tested under various stress conditions in Folsomia candida and Orchesella cincta (Insecta, Collembola). BMC Mol. Biol. 2009, 10, 54. [Google Scholar] [CrossRef]
Name | Sequence | Note |
---|---|---|
Bulge-Loop Csu-novel-260 stem-loop primer | GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACGCCG | Reverse transcript |
Bulge-Loop Csu-miR-14 stem-loop primer | GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACATAGGA | Reverse transcript |
Csu-novel-260-F | TTGGATGACTGGCCCATGT | qPCR |
Csu-miR-14-F | GCGCGTCAGTCTTTTTCTCTC | qPCR |
Csu-miRNA-universal | AGTGCAGGGTCCGAGGTATT | qPCR |
FcSDHA-F | ACACTTTCCAGCAATGCAGGAG | qPCR |
FcSDHA-R | TTTTCAGCCTCAAATCGGCA | qPCR |
FcDib-F | TTCCGGAAGGCACGAATATC | qPCR |
FcDib-R | GACTGACGAAGGGATGGATTT | qPCR |
FcEcR-F | TGCGACAATCATCCATATACCC | qPCR |
FcEcR-R | TCCACCTTCATTGCACACATA | qPCR |
FcSpo-F | ATGCCAAGGAGTTGTCCTTATT | qPCR |
FcSpo-R | CCTCGGAGAAAGTTGTCCTAATC | qPCR |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhou, Q.; Han, L.; Li, Y.; Li, J.; Yang, X. Neutral Dietary Effects of Two MicroRNAs, Csu-Novel-260 and Csu-Mir-14, on the Non-Target Arthropod Folsomia candida. Plants 2023, 12, 1885. https://doi.org/10.3390/plants12091885
Zhou Q, Han L, Li Y, Li J, Yang X. Neutral Dietary Effects of Two MicroRNAs, Csu-Novel-260 and Csu-Mir-14, on the Non-Target Arthropod Folsomia candida. Plants. 2023; 12(9):1885. https://doi.org/10.3390/plants12091885
Chicago/Turabian StyleZhou, Qinli, Lanzhi Han, Yunhe Li, Jing Li, and Xiaowei Yang. 2023. "Neutral Dietary Effects of Two MicroRNAs, Csu-Novel-260 and Csu-Mir-14, on the Non-Target Arthropod Folsomia candida" Plants 12, no. 9: 1885. https://doi.org/10.3390/plants12091885