NAC Transcription Factors in Senescence: From Molecular Structure to Function in Crops
Abstract
:1. Introduction
2. NAC Transcription Factors in Senescence
2.1. Arabidopsis NAC Gene Expression during Senescence
2.2. Crop NAC Gene Expression during Senescence
3. NAC Proteins and Senescence Associated Interactions
3.1. The NAC Domain and DNA Binding
NAC | Synthetic DNA/Target Gene | Ref. |
---|---|---|
ANAC019 | 5′-AARTTACGTR-3′ | [84] |
ANAC019 * | 5′-TGCGTGGACATGCGTGGACATGCGTGGACATGCGTGGACATGCG-3′ (VSP1) ** | [85] |
ANAC019 | 5′-ACATGCGTGT(7n)GA-3′ (ERD1) | [89] |
ANAC055 | 5′-AARTTACGTR-3′ | [84] |
AtNAP | 5′-GTTACGTAT-3′ | [84] |
AtNAP | 5′-. . .CACGTAAGT…-3′*** (52 bp of SAG113) | [86] |
AtNAP | 5′-AGATGTGCGTGAAAGAGGCGCAACTATAAGAG-3′ (AAO3) | [87] |
ATAF1 | 5′-AAGTTACGTA-3′ | [84] |
ATAF1 | 5′-…TAAATTGCGTGCGT…-3′ (131 bp fragment of NCED113) | [88] |
ATAF1 | 5′-VDHVnnYRR(5-6n)YACGnMWSK-3′ and 5′-RRWnnCGTR(5-6n)DACGTMWHD-3′ | [64] |
ATAF1 | 5′-…GTTGCCTAACAATCTACGCATCT…-3′ (40 bp fragment of ORE1) | [64] |
ATAF1 | 5′-…GACCAGTAGTCCTTTTACGAAAGT…-3′ (40 bp fragment of GLK1) | [64] |
ATAF1 | 5′-…GACACTAATATAAACTACGTACC…-3′ (40 bp fragment of NCED3) | [64] |
ATAF1 | 5′-…AGATGCGTGGGAGGCTTGGGGAC…-3′ (40 bp fragment of ABCG40) | [64] |
ORS1 | 5′-RCGTR(4-5n)RYACGCAA-3′ | [60] |
JUB1 | 5′-TGCCGT7nACG-3′and 5′-TGCCGTNNNNNNNCCGC-3′ | [61] |
JUB1 | 5′-…GATGCCGTTAGAGACACG…-3′ (40 bp of DREB2A) | [61] |
NTL4 | 5′…TTATGTCGTACGAAA…3′ (AtrbohC) | [90] |
NTL4 | 5′-…TACGTGGCGTAATCC…-3′ (AtrbohE) | [90] |
3.2. The Transcription Regulatory Domain and Protein Interactions
4. Local Gene Regulatory Networks of Senescence Associated NAC Genes
4.1. ANAC019/ANAC055/RD26 GRN
4.2. AtNAP GRN
4.3. OsNAP GRN
4.4. ATAF1 GRN
4.5. ORS1
4.6. NTL4
4.7. JUB1
4.8. VNI2
4.9. NAC in GRNs
5. Crop NAC Genes with an Effect on Grain Yield and Quality
5.1. NAM-B1
5.2. TaNAC-S
5.3. OsNAP
5.4. GhNAP
5.5. HvSNAC1
5.6. PopNAC154
5.7. Crop NAC Genes for Breeding
6. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Feller, U.; Fisher, A. Nitrogen metabolism in senescing leaves. Crit. Rev. Plant Sci. 1994, 1, 241–273. [Google Scholar] [CrossRef]
- Thomas, H. Aging in the plant and animal kingdoms? The role of cell death. Rev. Clin. Gerontol. 1994, 4, 5–20. [Google Scholar] [CrossRef]
- Buchanan-Wollaston, V. The molelcular biology of leaf senescence. J. Exp. Biol. 1997, 48, 181–199. [Google Scholar]
- Buchanan-Wollaston, V.; Earl, S.; Harrison, E.; Mathas, E.; Navabpour, S.; Page, T.; Pink, D. The molecular analysis of leaf senescence—A genomics approach. Plant Biotechnol. J. 2003, 1, 3–22. [Google Scholar] [CrossRef] [PubMed]
- Hopkins, M.; Taylor, C.; Liu, Z.; Ma, F.; McNamara, L.; Wang, T.W.; Thompson, J.E. Regulation and execution of molecular disassembly and catabolism during senescence. New Phytol. 2007, 175, 201–214. [Google Scholar] [CrossRef] [PubMed]
- Lim, P.O.; Woo, H.R.; Nam, H.G. Molecular genetics of leaf senescence in Arabidopsis. Trends Plant Sci. 2003, 8, 272–278. [Google Scholar] [CrossRef]
- Guiboileau, A.; Sormani, R.; Meyer, C.; Masclaux-Daubresse, C. Senescence and death of plant organs: Nutrient recycling and developmental regulation. C. R. Biol. 2010, 333, 382–391. [Google Scholar] [CrossRef] [PubMed]
- Gregersen, P.L. Senescence and nutrient remobilization in crop plants. In The Molecular and Physiological Basis of Nutrient Use Efficiency in Crops; Hawkesford, M.J., Barraclough, P., Eds.; Wiley-Blackwell: Oxford, UK, 2011; pp. 83–102. [Google Scholar]
- Fisher, A. The complex regulation of senescence. Crit. Rev. Plant Sci. 2012, 31, 124–147. [Google Scholar] [CrossRef]
- Gregersen, P.L.; Culetic, A.; Boschian, L.; Krupinska, K. Plant senescence and crop productivity. Plant Mol. Biol. 2013, 82, 603–622. [Google Scholar] [CrossRef] [PubMed]
- Lim, P.O.; Kim, H.J.; Nam, H.G. Leaf senescence. Annu. Rev. Plant Biol. 2007, 58, 115–136. [Google Scholar] [CrossRef] [PubMed]
- Woo, H.R.; Kim, H.J.; Nam, H.G.; Lim, P.O. Plant leaf senescence and death—Regulation by multiple layers of control and implications for aging in general. J. Cell Sci. 2013, 126, 4823–4833. [Google Scholar] [CrossRef] [PubMed]
- Ghanem, M.E.; Albacete, A.; Martinez-Andujar, C.; Acosta, M.; Romero-Aranda, R.; Dodd, I.C.; Lutts, S.; Perez-Alfocea, F. Hormonal changes during salinity-induced leaf senescence in tomato (Solanum lycopersicum L.). J. Exp. Bot. 2008, 59, 3039–3050. [Google Scholar] [CrossRef] [PubMed]
- Gepstein, S.; Glick, B.R. Strategies to ameliorate abiotic stress-induced plant senescence. Plant Mol. Biol. 2013, 82, 623–633. [Google Scholar] [CrossRef] [PubMed]
- Khanna-Chopra, R. Leaf senescence and abiotic stresses share reactive oxygen species-mediated chloroplast degradation. Protoplasma 2012, 249, 469–481. [Google Scholar] [CrossRef] [PubMed]
- Lers, A. Evironmental regulation of senescence. In Senescence Processes in Plants; Gan, S., Ed.; Blackwell Publishing Ltd: Oxford, UK, 2007; pp. 108–144. [Google Scholar]
- Thomas, H.; Stoddart, J.L. Leaf senescence. Annu. Rev. Plant Physiol. 1980, 31, 83–111. [Google Scholar] [CrossRef]
- Jibran, R.; Hunter, A.; Dijkwel, P. Hormonal regulation of leaf senescence through integration of developmental and stress signals. Plant Mol. Biol. 2013, 82, 547–561. [Google Scholar] [CrossRef] [PubMed]
- Gosti, F.; Beaudoin, N.; Serizet, C.; Webb, A.A.; Vartanian, N.; Giraudat, J. ABI1 protein phosphatase 2C is a negative regulator of abscisic acid signaling. Plant Cell 1999, 11, 1897–1910. [Google Scholar] [CrossRef] [PubMed]
- Even-Chen, Z.; Itai, C. The role of abscisic acid in senescence of detached tobacco leaves. Physiol. Plant 2015, 34, 97–100. [Google Scholar] [CrossRef]
- Gepstein, S.; Thimann, K.V. Changes in the abscisic acid content of oat leaves during senescence. Proc. Natl. Acad. Sci. USA 1980, 77, 2050–2053. [Google Scholar] [CrossRef] [PubMed]
- Philosoph-Hadas, S.; Hadas, E.; Aharoni, N. Characterization and use in ELISA of new monoclonal antibody for quantitation of abscisic acid in senescing rice leaves. Plant Growth Regul. 1993, 12, 71–78. [Google Scholar] [CrossRef]
- He, P.; Osaki, M.; Takebe, M.; Shinano, T.; Wasaki, J. Endogenous hormones and expression of senescence-related genes in different senescent types of maize. J. Exp. Bot. 2005, 56, 1117–1128. [Google Scholar] [CrossRef] [PubMed]
- Zhao, H.; Qiu, K.; Ren, G.; Zhu, Y.; Kuai, B. A pleiotropic phenotype is associated with altered endogenous hormone balance in the developmentally stunted mutant (dsm1). J. Plant. Biol. 2010, 53, 79–87. [Google Scholar] [CrossRef]
- Buchanan-Wollaston, V.; Page, T.; Harrison, E.; Breeze, E.; Lim, P.O.; Nam, H.G.; Lin, J.F.; Wu, S.H.; Swidzinski, J.; Ishizaki, K.; et al. Comparative transcriptome analysis reveals significant differences in gene expression and signalling pathways between developmental and dark/starvation-induced senescence in Arabidopsis. Plant J. 2005, 42, 567–585. [Google Scholar] [CrossRef] [PubMed]
- Allu, A.D.; Soja, A.M.; Wu, A.; Szymanski, J.; Balazadeh, S. Salt stress and senescence: Identification of cross-talk regulatory components. J. Exp. Bot. 2014, 65, 3993–4008. [Google Scholar] [CrossRef] [PubMed]
- Breeze, E.; Harrison, E.; McHattie, S.; Hughes, L.; Hickman, R.; Hill, C.; Kiddle, S.; Kim, Y.S.; Penfold, C.A.; Jenkins, D.; et al. High-resolution temporal profiling of transcripts during Arabidopsis leaf senescence reveals a distinct chronology of processes and regulation. Plant Cell 2011, 23, 873–894. [Google Scholar] [CrossRef] [PubMed]
- Liang, C.; Wang, Y.; Zhu, Y.; Tang, J.; Hu, B.; Liu, L.; Ou, S.; Wu, H.; Sun, X.; Chu, J.; Chu, C. OsNAP connects abscisic acid and leaf senescence by fine-tuning abscisic acid biosynthesis and directly targeting senescence-associated genes in rice. Proc. Natl. Acad. Sci. USA 2014, 111, 10013–10018. [Google Scholar] [CrossRef] [PubMed]
- Guo, Y.; Gan, S. Leaf senescence: Signals, execution, and regulation. Curr. Top. Dev. Biol. 2005, 71, 83–112. [Google Scholar] [PubMed]
- Kim, J.; Chang, C.; Tucker, M.L. To grow old: Regulatory role of ethylene and jasmonic acid in senescence. Plant Sci. 2015, 6, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Jing, H.C.; Schippers, J.H.; Hille, J.; Dijkwel, P.P. Ethylene-induced leaf senescence depends on age-related changes and OLD genes in Arabidopsis. J. Exp. Bot. 2005, 56, 2915–2923. [Google Scholar] [CrossRef] [PubMed]
- Grbić, V.; Bleecker, A.B. Ethylene regualtes the timing of leaf senescence in Arabidopsis. Plant J. 1995, 8, 595–602. [Google Scholar] [CrossRef]
- Oh, S.A.; Park, J.H.; Lee, G.I.; Paek, K.H.; Park, S.K.; Nam, H.G. Identification of three genetic loci controlling leaf senescence in Arabidopsis thaliana. Plant J. 1997, 12, 527–535. [Google Scholar] [CrossRef] [PubMed]
- Jing, H.C.; Sturre, M.J.; Hille, J.; Dijkwel, P.P. Arabidopsis onset of leaf death mutants identify a regulatory pathway controlling leaf senescence. Plant J. 2002, 32, 51–63. [Google Scholar] [CrossRef] [PubMed]
- Schippers, J.H.M.; Jing, H.-C.; Hille, J.; Dijkwel, P.P. Developmental and hormonal control of leaf senescence. In Senescence Processes in Plants; Gan, S., Ed.; Blackwell Publishing Ltd: Oxford, UK, 2007; pp. 145–170. [Google Scholar]
- Noodén, L.D.; Singh, S.; Letham, D.S. Correlation of xylem sap cytokinin levels with monocarpic senescence in soybean. Plant Physiol. 1990, 93, 33–39. [Google Scholar] [CrossRef] [PubMed]
- Gan, S.; Amasino, R.M. Making Sense of Senescence (Molecular Genetic Regulation and Manipulation of Leaf Senescence). Plant Physiol. 1997, 113, 313–319. [Google Scholar] [PubMed]
- Ori, N.; Juarez, M.T.; Jackson, D.; Yamaguchi, J.; Banowetz, G.M.; Hake, S. Leaf senescence is delayed in tobacco plants expressing the maize homeobox gene knotted1 under the control of a senescence-activated promoter. Plant Cell 1999, 11, 1073–1080. [Google Scholar] [CrossRef] [PubMed]
- Masferrer, A.; Arro, M.; Manzano, D.; Schaller, H.; Fernandez-Busquets, X.; Moncalean, P.; Fernandez, B.; Cunillera, N.; Boronat, A.; Ferrer, A. Overexpression of Arabidopsis thaliana farnesyl diphosphate synthase (FPS1S) in transgenic Arabidopsis induces a cell death/senescence-like response and reduced cytokinin levels. Plant J. 2002, 30, 123–132. [Google Scholar] [CrossRef] [PubMed]
- Guo, Y.; Cai, Z.; Gan, S. Transcriptome of Arabidopsis leaf senescence. Plant Cell Environ. 2004, 276, 521–549. [Google Scholar] [CrossRef]
- Lin, J.F.; Wu, S.H. Molecular events in senescing Arabidopsis leaves. Plant J. 2004, 39, 612–628. [Google Scholar] [CrossRef] [PubMed]
- Van der Graaff, E.; Schwacke, R.; Schneider, A.; Desimone, M.; Flugge, U.I.; Kunze, R. Transcription analysis of arabidopsis membrane transporters and hormone pathways during developmental and induced leaf senescence. Plant Physiol. 2006, 141, 776–792. [Google Scholar] [CrossRef] [PubMed]
- Balazadeh, S.; Riano-Pachon, D.M.; Mueller-Roeber, B. Transcription factors regulating leaf senescence in Arabidopsis thaliana. Plant Biol. Stuttg. 2008, 10, S63–S75. [Google Scholar] [CrossRef] [PubMed]
- Gregersen, P.L.; Holm, P.B. Transcriptome analysis of senescence in the flag leaf of wheat (Triticum aestivum L.). Plant Biotechnol. J. 2007, 5, 192–206. [Google Scholar] [CrossRef] [PubMed]
- Christiansen, M.W.; Gregersen, P.L. Members of the barley NAC transcription factor gene family show differential co-regulation with senescence-associated genes during senescence of flag leaves. J. Exp. Bot. 2014, 65, 4009–4022. [Google Scholar] [CrossRef] [PubMed]
- Thomas, H.; Smart, C.M. Crops that stay green. Ann. Appl. Biol. 1993, 123, 193–219. [Google Scholar] [CrossRef]
- Thomas, H.; Howarth, C.J. Five ways to stay green. J. Exp. Bot. 2000, 51, 329–337. [Google Scholar] [CrossRef] [PubMed]
- Jukanti, A.K.; Heidlebaugh, N.M.; Parrott, D.L.; Fischer, I.A.; McInnerney, K.; Fischer, A.M. Comparative transcriptome profiling of near-isogenic barley (Hordeum vulgare) lines differing in the allelic state of a major grain protein content locus identifies genes with possible roles in leaf senescence and nitrogen reallocation. New Phytol. 2008, 177, 333–349. [Google Scholar] [CrossRef] [PubMed]
- Parrott, D.L.; Martin, J.M.; Fischer, A.M. Analysis of barley (Hordeum vulgare) leaf senescence and protease gene expression: A family C1A cysteine protease is specifically induced under conditions characterized by high carbohydrate, but low to moderate nitrogen levels. New Phytol. 2010, 187, 313–331. [Google Scholar] [CrossRef] [PubMed]
- Christiansen, M.W.; Holm, P.B.; Gregersen, P.L. Characterization of barley (Hordeum vulgare L.) NAC transcription factors suggests conserved functions compared to both monocots and dicots. BMC Res. Notes 2011, 4, 302. [Google Scholar] [CrossRef] [PubMed]
- Hollmann, J.; Gregersen, P.L.; Krupinska, K. Identification of predominant genes involved in regulation and execution of senescence-associated nitrogen remobilization in flag leaves of field grown barley. J. Exp. Bot. 2014, 65, 3963–3973. [Google Scholar] [CrossRef] [PubMed]
- Shah, S.T.; Pang, C.; Fan, S.; Song, M.; Arain, S.; Yu, S. Isolation and expression profiling of GhNAC transcription factor genes in cotton (Gossypium hirsutum L.) during leaf senescence and in response to stresses. Gene 2013, 531, 220–234. [Google Scholar] [CrossRef] [PubMed]
- Lin, M.; Pang, C.; Fan, S.; Song, M.; Wei, H.; Yu, S. Global analysis of the Gossypium hirsutum L. Transcriptome during leaf senescence by RNA-Seq. BMC Plant Biol. 2015, 15, 43. [Google Scholar] [CrossRef] [PubMed]
- Quirino, B.F.; Noh, Y.S.; Himelblau, E.; Amasino, R.M. Molecular aspects of leaf senescence. Trends Plant Sci. 2000, 5, 278–282. [Google Scholar] [CrossRef]
- Olsen, A.N.; Ernst, H.A.; Leggio, L.L.; Skriver, K. NAC transcription factors: Structurally distinct, functionally diverse. Trends Plant Sci. 2005, 10, 79–87. [Google Scholar] [CrossRef] [PubMed]
- Puranik, S.; Sahu, P.P.; Srivastava, P.S.; Prasad, M. NAC proteins: Regulation and role in stress tolerance. Trends Plant Sci. 2012, 17, 369–381. [Google Scholar] [CrossRef] [PubMed]
- Nakashima, K.; Takasaki, H.; Mizoi, J.; Shinozaki, K.; Yamaguchi-Shinozaki, K. NAC transcription factors in plant abiotic stress responses. Biochim. Biophys. Acta 2012, 1819, 97–103. [Google Scholar] [CrossRef] [PubMed]
- Guo, Y.; Gan, S. AtNAP, a NAC family transcription factor, has an important role in leaf senescence. Plant J. 2006, 46, 601–612. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.H.; Woo, H.R.; Kim, J.; Lim, P.O.; Lee, I.C.; Choi, S.H.; Hwang, D.; Nam, H.G. Trifurcate feed-forward regulation of age-dependent cell death involving miR164 in Arabidopsis. Science 2009, 323, 1053–1057. [Google Scholar] [CrossRef] [PubMed]
- Balazadeh, S.; Kwasniewski, M.; Caldana, C.; Mehrnia, M.; Zanor, M.I.; Mueller-Roeber, B.; Xue, G.P. ORS1, an H(2)O(2)-responsive NAC transcription factor, controls senescence in Arabidopsis thaliana. Mol. Plant 2011, 4, 346–360. [Google Scholar] [CrossRef] [PubMed]
- Wu, A.; Allu, A.D.; Garapati, P.; Siddiqui, H.; Dortay, H.; Munne-Bosch, S.; Asensi-Fabado, M.A.; Zanor, M.I.; Antonio, C.; Tohge, T.; et al. JUNGBRUNNEN1, a reactive oxygen species-responsive NAC transcription factor, regulates longevity in Arabidopsis. Plant Cell 2012, 24, 482–506. [Google Scholar] [CrossRef] [PubMed]
- Yang, S.D.; Seo, P.J.; Yoon, H.K.; Park, C.M. The Arabidopsis NAC transcription factor VNI2 integrates abscisic acid signals into leaf senescence via the COR/RD genes. Plant Cell 2011, 23, 2155–2168. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.S.; Sakuraba, Y.; Han, S.H.; Yoo, S.C.; Paek, N.C. Mutation of the Arabidopsis NAC016 transcription factor delays leaf senescence. Plant Cell Physiol. 2013, 54, 1660–1672. [Google Scholar] [CrossRef] [PubMed]
- Garapati, P.; Xue, G.P.; Munne-Bosch, S.; Balazadeh, S. Transcription Factor ATAF1 in Arabidopsis Promotes Senescence by Direct Regulation of Key Chloroplast Maintenance and Senescence Transcriptional Cascades. Plant Physiol. 2015, in press. [Google Scholar] [CrossRef] [PubMed]
- Balazadeh, S.; Siddiqui, H.; Allu, A.D.; Matallana-Ramirez, L.P.; Caldana, C.; Mehrnia, M.; Zanor, M.I.; Kohler, B.; Mueller-Roeber, B. A gene regulatory network controlled by the NAC transcription factor ANAC092/AtNAC2/ORE1 during salt-promoted senescence. Plant J. 2010, 62, 250–264. [Google Scholar] [CrossRef] [PubMed]
- Hickman, R.; Hill, C.; Penfold, C.A.; Breeze, E.; Bowden, L.; Moore, J.D.; Zhang, P.; Jackson, A.; Cooke, E.; Bewicke-Copley, F.; et al. A local regulatory network around three NAC transcription factors in stress responses and senescence in Arabidopsis leaves. Plant J. 2013, 75, 26–39. [Google Scholar] [CrossRef] [PubMed]
- Uauy, C.; Distelfeld, A.; Fahima, T.; Blechl, A.; Dubcovsky, J. A NAC Gene regulating senescence improves grain protein, zinc, and iron content in wheat. Science 2006, 314, 1298–1301. [Google Scholar] [CrossRef] [PubMed]
- Rauf, M.; Arif, M.; Dortay, H.; Matallana-Ramirez, L.P.; Waters, M.T.; Gil, N.H.; Lim, P.O.; Mueller-Roeber, B.; Balazadeh, S. ORE1 balances leaf senescence against maintenance by antagonizing G2-like-mediated transcription. EMBO Rep. 2013, 14, 382–388. [Google Scholar] [CrossRef] [PubMed]
- Olsen, A.N.; Ernst, H.A.; Leggio, L.L.; Skriver, K. DNA-binding specificity and molecular functions of NAC transcription factros. Plant Sci. 2005, 169, 785–797. [Google Scholar] [CrossRef]
- Truman, W.; Glazebrook, J. Co-expression analysis identifies putative targets for CBP60g and SARD1 regulation. BMC Plant Biol. 2012, 12, 216. [Google Scholar] [CrossRef] [PubMed]
- Larkin, M.A.; Blackshields, G.; Brown, N.P.; Chenna, R.; McGettigan, P.A.; McWilliam, H.; Valentin, F.; Wallace, I.M.; Wilm, A.; Lopez, R.; et al. Clustal W and Clustal X version 2.0. Bioinformatics 2007, 23, 2947–2948. [Google Scholar] [CrossRef] [PubMed]
- Paradis, E.; Claude, J.; Strimmer, K. APE: Analyses of Phylogenetics and Evolution in R language. Bioinformatics 2004, 20, 289–290. [Google Scholar] [CrossRef] [PubMed]
- Shen, H.; Yin, Y.B.; Chen, F.; Xu, Y.; Dixon, R.A. A bioinformatic analysis of NAC genes for plant cell wall development in relation to lignocellulosic bioenergy production. Bioenergy Res. 2009, 2, 217–232. [Google Scholar] [CrossRef]
- Zhao, C.; Avci, U.; Grant, E.H.; Haigler, C.H.; Beers, E.P. XND1, a member of the NAC domain family in Arabidopsis thaliana, negatively regulates lignocellulose synthesis and programmed cell death in xylem. Plant J. 2008, 53, 425–436. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.; Zhou, Y.; Zhou, G.; Ye, R.; Zhao, L.; Li, X.; Lin, Y. Identification of early senescence-associated genes in rice flag leaves. Plant Mol. Biol. 2008, 67, 37–55. [Google Scholar] [CrossRef] [PubMed]
- Xu, X.; Bai, H.; Liu, C.; Chen, E.; Chen, Q.; Zhuang, J.; Shen, B. Genome-wide analysis of microRNAs and their target genes related to leaf senescence of rice. PLoS ONE 2014, 9, e114313. [Google Scholar] [CrossRef] [PubMed]
- Meng, C.; Caiping, C.; Tianzhen, Z.; Wangzhen, G. Characterization of six novel NAC genes and their responses to abiotic stresses in Gossypium hirsutum l. Plant Sci. 2009, 176, 352–359. [Google Scholar] [CrossRef]
- Huang, G.-Q.; Li, W.; Zhou, W.; Zhang, J.-M.; Li, D.-D.; Gong, S.-Y.; Li, X.-B. Seven cotton genes encoding putative NAC domain proteins are preferentially expressed in roots and in respoonse to abiotic stress during root development. Plant Growth Regul. 2013, 71, 101–112. [Google Scholar] [CrossRef]
- Jensen, M.K.; Kjaersgaard, T.; Nielsen, M.M.; Galberg, P.; Petersen, K.; O’Shea, C.; Skriver, K. The Arabidopsis thaliana NAC transcription factor family: Structure-function relationships and determinants of ANAC019 stress signalling. Biochem. J. 2010, 426, 183–196. [Google Scholar] [CrossRef] [PubMed]
- Jensen, M.K.; Kjaersgaard, T.; Petersen, K.; Skriver, K. NAC genes: Time-specific regulators of hormonal signaling in Arabidopsis. Plant Signal. Behav. 2010, 5, 907–910. [Google Scholar] [CrossRef] [PubMed]
- Ernst, H.A.; Olsen, A.N.; Larsen, S.; Lo, L.L. Structure of the conserved domain of ANAC, a member of the NAC family of transcription factors. EMBO Rep. 2004, 5, 297–303. [Google Scholar] [CrossRef] [PubMed]
- Welner, D.H.; Lindemose, S.; Grossmann, J.G.; Mollegaard, N.E.; Olsen, A.N.; Helgstrand, C.; Skriver, K.; Lo, L.L. DNA binding by the plant-specific NAC transcription factors in crystal and solution: A firm link to WRKY and GCM transcription factors. Biochem. J. 2012, 444, 395–404. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Q.; Zou, J.; Zhu, M.; Liu, Z.; Feng, P.; Fan, G.; Wang, W.; Liao, H. In silico analysis on structure and DNA binding mode of AtNAC1, a NAC transcription factor from Arabidopsis thaliana. J. Mol. Model. 2014, 20, 2117. [Google Scholar] [CrossRef] [PubMed]
- Lindemose, S.; Jensen, M.K.; de Velde, J.V.; O’Shea, C.; Heyndrickx, K.S.; Workman, C.T.; Vandepoele, K.; Skriver, K.; Masi, F.D. A DNA-binding-site landscape and regulatory network analysis for NAC transcription factors in Arabidopsis thaliana. Nucleic Acids Res. 2014, 42, 7681–7693. [Google Scholar] [CrossRef] [PubMed]
- Bu, Q.; Jiang, H.; Li, C.B.; Zhai, Q.; Zhang, J.; Wu, X.; Sun, J.; Xie, Q.; Li, C. Role of the Arabidopsis thaliana NAC transcription factors ANAC019 and ANAC055 in regulating jasmonic acid-signaled defense responses. Cell Res. 2008, 18, 756–767. [Google Scholar] [CrossRef] [PubMed]
- Zhang, K.; Gan, S.S. An abscisic acid-AtNAP transcription factor-SAG113 protein phosphatase 2C regulatory chain for controlling dehydration in senescing Arabidopsis leaves. Plant Physiol. 2012, 158, 961–969. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.; Worley, E.; Udvardi, M. A NAP-AAO3 Regulatory Module Promotes Chlorophyll Degradation via ABA Biosynthesis in Arabidopsis Leaves. Plant Cell 2014, 26, 4862–4874. [Google Scholar] [CrossRef] [PubMed]
- Jensen, M.K.; Lindemose, S.; de Masi, F.; Reimer, J.J.; Nielsen, M.; Perera, V.; Workman, C.T.; Turck, F.; Grant, M.R.; Mundy, J.; et al. ATAF1 transcription factor directly regulates abscisic acid biosynthetic gene NCED3 in Arabidopsis thaliana. FEBS Open Bio. 2013, 3, 321–327. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tran, L.S.; Nakashima, K.; Sakuma, Y.; Simpson, S.D.; Fujita, Y.; Maruyama, K.; Fujita, M.; Seki, M.; Shinozaki, K.; Yamaguchi-Shinozaki, K. Isolation and functional analysis of Arabidopsis stress-inducible NAC transcription factors that bind to a drought-responsive cis-element in the early responsive to dehydration stress 1 promoter. Plant Cell 2004, 16, 2481–2498. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.; Seo, P.J.; Lee, H.J.; Park, C.M. A NAC transcription factor NTL4 promotes reactive oxygen species production during drought-induced leaf senescence in Arabidopsis. Plant J. 2012, 70, 831–844. [Google Scholar] [CrossRef] [PubMed]
- Jaspers, P.; Blomster, T.; Brosche, M.; Salojarvi, J.; Ahlfors, R.; Vainonen, J.P.; Reddy, R.A.; Immink, R.; Angenent, G.; Turck, F.; et al. Unequally redundant RCD1 and SRO1 mediate stress and developmental responses and interact with transcription factors. Plant J. 2009, 60, 268–279. [Google Scholar] [CrossRef] [PubMed]
- O’Shea, C.; Kryger, M.; Stender, E.G.; Kragelund, B.B.; Willemoes, M.; Skriver, K. Protein intrinsic disorder in Arabidopsis NAC transcription factors: transcriptional activation by ANAC013 and ANAC046 and their interactions with RCD1. Biochem J 2015, 465, 281–294. [Google Scholar] [CrossRef] [PubMed]
- Van der Lee, R.; Buljan, M.; Lang, B.; Weatheritt, R.J.; Daughdrill, G.W.; Dunker, A.K.; Gough, J.; Fuxreiter, M.; Gsponer, J.; Jones, D.T.; et al. Classification of Intrinsically Disordered Regions and Proteins. Chem. Rev. 2014, 114, 6589–6631. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dyson, H.J.; Wright, P.E. Coupling of folding and binding for unstructured proteins. Curr. Opin. Struct. Biol. 2002, 12, 54–60. [Google Scholar] [CrossRef]
- Kjaersgaard, T.; Jensen, M.K.; Christiansen, M.W.; Gregersen, P.; Kragelund, B.B.; Skriver, K. Senescence-associated barley NAC (NAM, ATAF1,2, CUC) transcription factor interacts with radical-induced cell death 1 through a disordered regulatory domain. J. Biol. Chem. 2011, 286, 35418–35429. [Google Scholar] [CrossRef] [PubMed]
- Vacic, V.; Oldfield, C.J.; Mohan, A.; Radivojac, P.; Cortese, M.S.; Uversky, V.N.; Dunker, A.K. Characterization of molecular recognition features, MoRFs, and their binding partners. J. Proteome Res. 2007, 6, 2351–2366. [Google Scholar] [CrossRef] [PubMed]
- Teotia, S.; Lamb, R.S. The paralogous genes RADICAL-INDUCED CELL DEATH1 and SIMILAR TO RCD ONE1 have partially redundant functions during Arabidopsis development. Plant Physiol. 2009, 151, 180–198. [Google Scholar] [CrossRef] [PubMed]
- Overmyer, K.; Tuominen, H.; Kettunen, R.; Betz, C.; Langebartels, C.; Sandermann, H., Jr.; Kangasjarvi, J. Ozone-sensitive arabidopsis rcd1 mutant reveals opposite roles for ethylene and jasmonate signaling pathways in regulating superoxide-dependent cell death. Plant Cell 2000, 12, 1849–1862. [Google Scholar] [CrossRef] [PubMed]
- Vainonen, J.P.; Jaspers, P.; Wrzaczek, M.; Lamminmaki, A.; Reddy, R.A.; Vaahtera, L.; Brosche, M.; Kangasjarvi, J. RCD1-DREB2A interaction in leaf senescence and stress responses in Arabidopsis thaliana. Biochem. J. 2012, 442, 573–581. [Google Scholar] [CrossRef] [PubMed]
- Kragelund, B.B.; Jensen, M.K.; Skriver, K. Order by disorder in plant signaling. Trends Plant Sci. 2012, 17, 625–632. [Google Scholar] [CrossRef] [PubMed]
- Ward, J.J.; McGuffin, L.J.; Bryson, K.; Buxton, B.F.; Jones, D.T. The DISOPRED server for the prediction of protein disorder. Bioinformatics 2004, 20, 2138–2139. [Google Scholar] [CrossRef] [PubMed]
- Li, T.; Jia, K.P.; Lian, H.L.; Yang, X.; Li, L.; Yang, H.Q. Jasmonic acid enhancement of anthocyanin accumulation is dependent on phytochrome A signaling pathway under far-red light in Arabidopsis. Biochem. Biophys. Res. Commun. 2014, 454, 78–83. [Google Scholar] [CrossRef] [PubMed]
- Qi, T.; Song, S.; Ren, Q.; Wu, D.; Huang, H.; Chen, Y.; Fan, M.; Peng, W.; Ren, C.; Xie, D. The Jasmonate-ZIM-domain proteins interact with the WD-Repeat/bHLH/MYB complexes to regulate Jasmonate-mediated anthocyanin accumulation and trichome initiation in Arabidopsis thaliana. Plant Cell 2011, 23, 1795–1814. [Google Scholar] [CrossRef] [PubMed]
- Zheng, X.Y.; Spivey, N.W.; Zeng, W.; Liu, P.P.; Fu, Z.Q.; Klessig, D.F.; He, S.Y.; Dong, X. Coronatine promotes Pseudomonas syringae virulence in plants by activating a signaling cascade that inhibits salicylic acid accumulation. Cell Host Microbe 2012, 11, 587–596. [Google Scholar] [CrossRef] [PubMed]
- Fan, W.; Dong, X. In vivo interaction between NPR1 and transcription factor TGA2 leads to salicylic acid-mediated gene activation in Arabidopsis. Plant Cell 2002, 14, 1377–1389. [Google Scholar] [CrossRef] [PubMed]
- He, Z.H.; Cheeseman, I.; He, D.; Kohorn, B.D. A cluster of five cell wall-associated receptor kinase genes, Wak1-5, are expressed in specific organs of Arabidopsis. Plant Mol. Biol. 1999, 39, 1189–1196. [Google Scholar] [CrossRef] [PubMed]
- Feys, B.J.; Moisan, L.J.; Newman, M.A.; Parker, J.E. Direct interaction between the Arabidopsis disease resistance signaling proteins, EDS1 and PAD4. EMBO J. 2001, 20, 5400–5411. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.J.; Hong, S.H.; Kim, Y.W.; Lee, I.H.; Jun, J.H.; Phee, B.K.; Rupak, T.; Jeong, H.; Lee, Y.; Hong, B.S.; et al. Gene regulatory cascade of senescence-associated NAC transcription factors activated by ETHYLENE-INSENSITIVE2-mediated leaf senescence signalling in Arabidopsis. J. Exp. Bot. 2014, 65, 4023–4036. [Google Scholar] [CrossRef] [PubMed]
- Chao, Q.; Rothenberg, M.; Solano, R.; Roman, G.; Terzaghi, W.; Ecker, J.R. Activation of the ethylene gas response pathway in Arabidopsis by the nuclear protein ETHYLENE-INSENSITIVE3 and related proteins. Cell 1997, 89, 1133–1144. [Google Scholar] [CrossRef]
- Chang, K.N.; Zhong, S.; Weirauch, M.T.; Hon, G.; Pelizzola, M.; Li, H.; Huang, S.S.; Schmitz, R.J.; Urich, M.A.; Kuo, D.; et al. Temporal transcriptional response to ethylene gas drives growth hormone cross-regulation in Arabidopsis. Elife 2013, 2, e00675. [Google Scholar] [CrossRef] [PubMed]
- Sharabi-Schwager, M.; Lers, A.; Samach, A.; Guy, C.L.; Porat, R. Overexpression of the CBF2 transcriptional activator in Arabidopsis delays leaf senescence and extends plant longevity. J. Exp. Bot. 2010, 61, 261–273. [Google Scholar] [CrossRef] [PubMed]
- Zhang, K.; Xia, X.; Zhang, Y.; Gan, S.S. An ABA-regulated and Golgi-localized protein phosphatase controls water loss during leaf senescence in Arabidopsis. Plant J. 2012, 69, 667–678. [Google Scholar] [CrossRef] [PubMed]
- Alonso, J.M.; Hirayama, T.; Roman, G.; Nourizadeh, S.; Ecker, J.R. EIN2, a bifunctional transducer of ethylene and stress responses in Arabidopsis. Science 1999, 284, 2148–2152. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Huang, W.; Liu, L.; Chen, T.; Zhou, F.; Lin, Y. Identification and functional characterization of a rice NAC gene involved in the regulation of leaf senescence. BMC Plant Biol. 2013, 13, 132. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Wang, Y.; Lv, B.; Li, J.; Luo, L.; Lu, S.; Zhang, X.; Ma, H.; Ming, F. The NAC family transcription factor OsNAP confers abiotic stress response through the ABA pathway. Plant Cell Physiol. 2014, 55, 604–619. [Google Scholar] [CrossRef] [PubMed]
- Distelfeld, A.; Pearce, S.P.; Avni, R.; Scherer, B.; Uauy, C.; Piston, F.; Slade, A.; Zhao, R.; Dubcovsky, J. Divergent functions of orthologous NAC transcription factors in wheat and rice. Plant Mol. Biol. 2012, 78, 515–524. [Google Scholar] [CrossRef] [PubMed]
- Wu, Y.; Deng, Z.; Lai, J.; Zhang, Y.; Yang, C.; Yin, B.; Zhao, Q.; Zhang, L.; Li, Y.; Yang, C.; et al. Dual function of Arabidopsis ATAF1 in abiotic and biotic stress responses. Cell Res. 2009, 19, 1279–1290. [Google Scholar] [CrossRef] [PubMed]
- Balazadeh, S.; Wu, A.; Mueller-Roeber, B. Salt-triggered expression of the ANAC092-dependent senescence regulon in Arabidopsis thaliana. Plant Signal. Behav. 2010, 5, 733–735. [Google Scholar] [CrossRef] [PubMed]
- Waters, M.T.; Moylan, E.C.; Langdale, J.A. GLK transcription factors regulate chloroplast development in a cell-autonomous manner. Plant J. 2008, 56, 432–444. [Google Scholar] [CrossRef] [PubMed]
- Waters, M.T.; Wang, P.; Korkaric, M.; Capper, R.G.; Saunders, N.J.; Langdale, J.A. GLK transcription factors coordinate expression of the photosynthetic apparatus in Arabidopsis. Plant Cell 2009, 21, 1109–1128. [Google Scholar] [CrossRef] [PubMed]
- Kleinow, T.; Himbert, S.; Krenz, H.; Jeske, H.; Koncz, C. NAC domain transcription factor ATAF1 interacts with SNF1-related kinases and silencing of its subfamily causes severe developmental defects in Arabidopsis. Plant Sci. 2009, 177, 360–370. [Google Scholar] [CrossRef]
- Jossier, M.; Bouly, J.P.; Meimoun, P.; Arjmand, A.; Lessard, P.; Hawley, S.; Grahame, H.D.; Thomas, M. SnRK1 (SNF1-related kinase 1) has a central role in sugar and ABA signalling in Arabidopsis thaliana. Plant J. 2009, 59, 316–328. [Google Scholar] [CrossRef] [PubMed]
- Jensen, M.K.; Skriver, K. NAC transcription factor gene regulatory and protein-protein interaction networks in plant stress responses and senescence. IUBMB Life 2014, 66, 156–166. [Google Scholar] [CrossRef] [PubMed]
- Liu, Q.; Kasuga, M.; Sakuma, Y.; Abe, H.; Miura, S.; Yamaguchi-Shinozaki, K.; Shinozaki, K. Two transcription factors, DREB1 and DREB2, with an EREBP/AP2 DNA binding domain separate two cellular signal transduction pathways in drought- and low-temperature-responsive gene expression, respectively, in Arabidopsis. Plant Cell 1998, 10, 1391–1406. [Google Scholar] [CrossRef] [PubMed]
- Schramm, F.; Larkindale, J.; Kiehlmann, E.; Ganguli, A.; Englich, G.; von Koskull-Doring, P.; Vierling, E. A cascade of transcription factor DREB2A and heat stress transcription factor HsfA3 regulates the heat stress response of Arabidopsis. Plant J. 2008, 53, 264–274. [Google Scholar] [CrossRef] [PubMed]
- Nishizawa-Yokoi, A.; Nosaka, R.; Hayashi, H.; Tainaka, H.; Maruta, T.; Tamoi, M.; Ikeda, M.; Ohme-Takagi, M.; Yoshimura, K.; Yabuta, Y.; et al. HsfA1d and HsfA1e involved in the transcriptional regulation of HsfA2 function as key regulators for the Hsf signaling network in response to environmental stress. Plant Cell Physiol. 2011, 52, 933–945. [Google Scholar] [CrossRef] [PubMed]
- Yamaguchi, M.; Ohtani, M.; Mitsuda, N.; Kubo, M.; Ohme-Takagi, M.; Fukuda, H.; Demura, T. VND-INTERACTING2, a NAC domain transcription factor, negatively regulates xylem vessel formation in Arabidopsis. Plant Cell 2010, 22, 1249–1263. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.; Lee, H.J.; Huh, S.U.; Paek, K.H.; Ha, J.H.; Park, C.M. The Arabidopsis NAC transcription factor NTL4 participates in a positive feedback loop that induces programmed cell death under heat stress conditions. Plant Sci. 2014, 227, 76–83. [Google Scholar] [CrossRef] [PubMed]
- Shigeoka, S.; Ishikawa, T.; Tamoi, M.; Miyagawa, Y.; Takeda, T.; Yabuta, Y.; Yoshimura, K. Regulation and function of ascorbate peroxidase isoenzymes. J. Exp. Bot. 2002, 53, 1305–1319. [Google Scholar] [CrossRef] [PubMed]
- Nishizawa, A.; Yabuta, Y.; Yoshida, E.; Maruta, T.; Yoshimura, K.; Shigeoka, S. Arabidopsis heat shock transcription factor A2 as a key regulator in response to several types of environmental stress. Plant J. 2006, 48, 535–547. [Google Scholar] [CrossRef] [PubMed]
- Schramm, F.; Ganguli, A.; Kiehlmann, E.; Englich, G.; Walch, D.; von Koskull-Doring, P. The heat stress transcription factor HsfA2 serves as a regulatory amplifier of a subset of genes in the heat stress response in Arabidopsis. Plant Mol. Biol. 2006, 60, 759–772. [Google Scholar] [CrossRef] [PubMed]
- Yoshida, T.; Sakuma, Y.; Todaka, D.; Maruyama, K.; Qin, F.; Mizoi, J.; Kidokoro, S.; Fujita, Y.; Shinozaki, K.; Yamaguchi-Shinozaki, K. Functional analysis of an Arabidopsis heat-shock transcription factor HsfA3 in the transcriptional cascade downstream of the DREB2A stress-regulatory system. Biochem. Biophys. Res. Commun. 2008, 368, 515–521. [Google Scholar] [CrossRef] [PubMed]
- Muller, J.; Boller, T.; Wiemken, A. Trehalose and trehalase in plants: Recent developments. Plant Sci. 1995, 112, 1–9. [Google Scholar] [CrossRef]
- Verbruggen, N.; Hermans, C. Proline accumulation in plants: A review. Amino Acids 2008, 35, 753–759. [Google Scholar] [CrossRef] [PubMed]
- Lawes, D.A.; Treharne, K.J. Variation in photosynthetic activity in cereals and its implications in a plant breeding program. I. Variation in seedling leaves and falg leaves. Euphytica 1971, 120, 86–92. [Google Scholar] [CrossRef]
- Gregersen, P.L.; Holm, P.B.; Krupinska, K. Leaf senescence and nutrient remobilisation in barley and wheat. Plant Bio. Stuttg. 2008, 10, S37–S49. [Google Scholar] [CrossRef] [PubMed]
- Gong, Y.; Zhang, J.; Gao, J.; Lu, L.; Wang, J. Slow export of photoassimilate from stay-green leaves during late grain’filling stage in hybrid winther wheat (Triticum aestuvum L.). J. Agro Crop Sci. 2005, 191, 292–299. [Google Scholar] [CrossRef]
- See, D.; Kanazin, V.; Kephart, K.; Blake, T. Mapping genes controlling variation in barley grain protein concentration. Crop Sci. 2002, 42, 680–685. [Google Scholar] [CrossRef]
- Kade, M.; Barneix, A.J.; Olmos, S.; Dubcovsky, J. Nitrogen uptake and remobilization in tetraploid Langdon durum wheat and a recombinant substitution line with the high grain protein gene Gpc-B1. Plant Breed. 2005, 124, 343–349. [Google Scholar] [CrossRef]
- Uauy, C.; Brevis, J.C.; Dubcovsky, J. The high grain protein content gene Gpc-B1 accelerates senescence and has pleiotropic effects on protein content in wheat. J. Exp. Bot. 2006, 57, 2785–2794. [Google Scholar] [CrossRef] [PubMed]
- Hagenblad, J.; Asplund, L.; Balfourier, F.; Ravel, C.; Leino, M.W. Strong presence of the high grain protein content allele of NAM-B1 in Fennoscandian wheat. Theor. Appl. Genet. 2012, 125, 1677–1686. [Google Scholar] [CrossRef] [PubMed]
- Cantu, D.; Pearce, S.P.; Distelfeld, A.; Christiansen, M.W.; Uauy, C.; Akhunov, E.; Fahima, T.; Dubcovsky, J. Effect of the down-regulation of the high Grain Protein Content (GPC) genes on the wheat transcriptome during monocarpic senescence. BMC Genomics 2011, 12, 492. [Google Scholar] [CrossRef] [PubMed]
- Avni, R.; Zhao, R.; Pearce, S.; Jun, Y.; Uauy, C.; Tabbita, F.; Fahima, T.; Slade, A.; Dubcovsky, J.; Distelfeld, A. Functional characterization of GPC-1 genes in hexaploid wheat. Planta 2014, 239, 313–324. [Google Scholar] [CrossRef] [PubMed]
- Pearce, S.; Tabbita, F.; Cantu, D.; Buffalo, V.; Avni, R.; Vazquez-Gross, H.; Zhao, R.; Conley, C.J.; Distelfeld, A.; Dubcovksy, J. Regulation of Zn and Fe transporters by the GPC1 gene during early wheat monocarpic senescence. BMC Plant Biol. 2014, 14, 368. [Google Scholar] [CrossRef] [PubMed]
- Mickelson, S.; See, D.; Meyer, F.D.; Garner, J.P.; Foster, C.R.; Blake, T.K.; Fischer, A.M. Mapping of QTL associated with nitrogen storage and remobilization in barley (Hordeum vulgare L.) leaves. J. Exp. Bot. 2003, 54, 801–812. [Google Scholar] [CrossRef] [PubMed]
- Yang, L.; Mickelson, S.; See, D.; Blake, T.K.; Fischer, A.M. Genetic analysis of the function of major leaf proteases in barley (Hordeum vulgare L.) nitrogen remobilization. J. Exp. Bot. 2004, 55, 2607–2616. [Google Scholar] [CrossRef] [PubMed]
- Distelfeld, A.; Korol, A.B.; Dubcovsky, J.; Uauy, C.; Blake, T.; Fahima, T. Colinearity between the barley grain protein content (GPC) QTL on chromosome arm 6HS and the wheat Gpc-B1 region. Mol. Breed. 2008, 22, 25–38. [Google Scholar] [CrossRef]
- Jamar, C.; Loffet, F.; Frettinger, P.; Ramsay, L.; Fauconnier, M.L.; Du, J.P. NAM-1gene polymorphism and grain protein content in Hordeum. J. Plant Physiol. 2010, 167, 497–501. [Google Scholar] [CrossRef] [PubMed]
- Cai, S.; Yu, G.; Chen, X.; Huang, Y.; Jiang, X.; Zhang, G.; Jin, X. Grain protein content variation and its association analysis in barley. BMC Plant Biol. 2013, 13, 35. [Google Scholar] [CrossRef] [PubMed]
- Heidlebaugh, N.M.; Trethewey, B.R.; Jukanti, A.K.; Parrott, D.L.; Martin, J.M.; Fischer, A.M. Effects of a barley (Hordeum vulgare) chromosome 6 grain protein content locus on whole-plant nitrogen reallocation under two different fertilisation regiimes. Funct. Plant Biol. 2008, 35, 619–632. [Google Scholar] [CrossRef]
- Jukanti, A.K.; Fischer, A.M. A high-grain protein content locus on barley (Hordeum vulgare) chromosome 6 is associated with increased flag leaf proteolysis and nitrogen remobilization. Phys. Plant 2008, 132, 426–439. [Google Scholar] [CrossRef] [PubMed]
- Distelfeld, A.; Avni, R.; Fischer, A.M. Senescence, nutrient remobilization, and yield in wheat and barley. J. Exp. Bot. 2014, 65, 3783–3798. [Google Scholar] [CrossRef] [PubMed]
- Lacerenza, J.A.; Parrott, D.L.; Fischer, A.M. A major grain protein content locus on barley (Hordeum vulgare L.) chromosome 6 influences flowering time and sequential leaf senescence. J. Exp. Bot. 2010, 61, 3137–3149. [Google Scholar] [CrossRef] [PubMed]
- Parrott, D.L.; Downs, E.P.; Fischer, A.M. Control of barley (Hordeum vulgare L.) development and senescence by the interaction between a chromosome six grain protein content locus, day length, and vernalization. J. Exp. Bot. 2012, 63, 1329–1339. [Google Scholar] [CrossRef] [PubMed]
- Streitner, C.; Danisman, S.; Wehrle, F.; Schoning, J.C.; Alfano, J.R.; Staiger, D. The small glycine-rich RNA binding protein AtGRP7 promotes floral transition in Arabidopsis thaliana. Plant J. 2008, 56, 239–250. [Google Scholar] [CrossRef] [PubMed]
- Zhao, D.; Derkx, A.P.; Liu, D.C.; Buchner, P.; Hawkesford, M.J. Overexpression of a NAC transcription factor delays leaf senescence and increases grain nitrogen concentration in wheat. Plant Biol. Stuttg. 2015, in press. [Google Scholar] [CrossRef] [PubMed]
- Fan, K.; Bibi, N.; Gan, S.; Li, F.; Yuan, S.; Ni, M.; Wang, M.; Shen, H.; Wang, X. A novel NAP member GhNAP is involved in leaf senescence in Gossypium hirsutum. J. Exp. Bot. 2015, in press. [Google Scholar] [CrossRef] [PubMed]
- Dong, H.; Li, W.; Tang, W.; Li, Z.; Zhang, D.; Niu, Y. Yield, quality and leaf senescence of cotton grown at varying planting dates and plant densities in the Yellow River Valley of China. Field Crops Res. 2006, 98, 106–115. [Google Scholar] [CrossRef]
- Sun, L.; Zhang, H.; Li, D.; Huang, L.; Hong, Y.; Ding, X.S.; Nelson, R.S.; Zhou, X.; Song, F. Functions of rice NAC transcriptional factors, ONAC122 and ONAC131, in defense responses against Magnaporthe grisea. Plant Mol. Biol. 2013, 81, 41–56. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.J.; Perera, V.; Christiansen, M.W.; Holme, I.B.; Gregersen, P.L.; Grant, M.R.; Collinge, D.B.; Lyngkjaer, M.F. The barley HvNAC6 transcription factor affects ABA accumulation and promotes basal resistance against powdery mildew. Plant Mol. Biol. 2013, 83, 577–590. [Google Scholar] [CrossRef] [PubMed]
- Windram, O.; Madhou, P.; McHattie, S.; Hill, C.; Hickman, R.; Cooke, E.; Jenkins, D.J.; Penfold, C.A.; Baxter, L.; Breeze, E.; et al. Arabidopsis defense against Botrytis cinerea: Chronology and regulation deciphered by high-resolution temporal transcriptomic analysis. Plant Cell 2012, 24, 3530–3557. [Google Scholar] [CrossRef] [PubMed]
- Balazadeh, S.; Schildhauer, J.; Araujo, W.L.; Munne-Bosch, S.; Fernie, A.R.; Proost, S.; Humbeck, K.; Mueller-Roeber, B. Reversal of senescence by N resupply to N-starved Arabidopsis thaliana: Transcriptomic and metabolomic consequences. J. Exp. Bot. 2014, 65, 3975–3992. [Google Scholar] [CrossRef] [PubMed]
- McGrann, G.R.; Steed, A.; Burt, C.; Goddard, R.; Lachaux, C.; Bansal, A.; Corbitt, M.; Gorniak, K.; Nicholson, P.; Brown, J.K. Contribution of the drought tolerance-related stress-responsive NAC1 transcription factor to resistance of barley to Ramularia leaf spot. Mol. Plant Pathol. 2015, 16, 201–209. [Google Scholar] [CrossRef] [PubMed]
- Walters, D.R.; Havis, N.D.; Oxley, S.J. Ramularia collo-cygni: The biology of an emerging pathogen of barley. FEMS Microbiol. Lett. 2008, 279, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Hu, H.; Dai, M.; Yao, J.; Xiao, B.; Li, X.; Zhang, Q.; Xiong, L. Overexpressing a NAM, ATAF, and CUC (NAC) transcription factor enhances drought resistance and salt tolerance in rice. Proc. Natl. Acad. Sci. USA 2006, 103, 12987–12992. [Google Scholar] [CrossRef] [PubMed]
- You, J.; Zong, W.; Li, X.; Ning, J.; Hu, H.; Li, X.; Xiao, J.; Xiong, L. The SNAC1-targeted gene OsSRO1c modulates stomatal closure and oxidative stress tolerance by regulating hydrogen peroxide in rice. J. Exp. Bot. 2013, 64, 569–583. [Google Scholar] [CrossRef] [PubMed]
- Hu, R.; Qi, G.; Kong, Y.; Kong, D.; Gao, Q.; Zhou, G. Comprehensive analysis of NAC domain transcription factor gene family in Populus trichocarpa. BMC Plant Biol. 2010, 10, 145. [Google Scholar] [CrossRef] [PubMed]
- Zhong, R.; Lee, C.; Zhou, J.; McCarthy, R.L.; Ye, Z.H. A battery of transcription factors involved in the regulation of secondary cell wall biosynthesis in Arabidopsis. Plant Cell 2008, 20, 2763–2782. [Google Scholar] [CrossRef] [PubMed]
- Grant, E.H.; Fujino, T.; Beers, E.P.; Brunner, A.M. Characterization of NAC domain transcription factors implicated in control of vascular cell differentiation in Arabidopsis and Populus. Planta 2010, 232, 337–352. [Google Scholar] [CrossRef] [PubMed]
- Jervis, J.; Hildreth, S.B.; Sheng, X.; Beers, E.P.; Brunner, A.M.; Helm, R.F. A metabolomic assessment of NAC154 transcription factor overexpression in field grown poplar stem wood. Phytochemistry 2015, 115, 112–120. [Google Scholar] [CrossRef] [PubMed]
- Couturier, J.; Doidy, J.; Guinet, F.; Wipf, D.; Blaudez, D.; Chalot, M. Glutamine, arginine and the amino acid transporter Pt-CAT11 play important roles during senescence in poplar. Ann. Bot. 2010, 105, 1159–1169. [Google Scholar] [CrossRef] [PubMed]
© 2015 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Podzimska-Sroka, D.; O'Shea, C.; Gregersen, P.L.; Skriver, K. NAC Transcription Factors in Senescence: From Molecular Structure to Function in Crops. Plants 2015, 4, 412-448. https://doi.org/10.3390/plants4030412
Podzimska-Sroka D, O'Shea C, Gregersen PL, Skriver K. NAC Transcription Factors in Senescence: From Molecular Structure to Function in Crops. Plants. 2015; 4(3):412-448. https://doi.org/10.3390/plants4030412
Chicago/Turabian StylePodzimska-Sroka, Dagmara, Charlotte O'Shea, Per L. Gregersen, and Karen Skriver. 2015. "NAC Transcription Factors in Senescence: From Molecular Structure to Function in Crops" Plants 4, no. 3: 412-448. https://doi.org/10.3390/plants4030412