The Polyamine Signaling Pathway in Response to Waterlogging Stress of Paeonia lactiflora

Abstract

Herbaceous peony (Paeonia lactiflora Pall) is resistant to drought but not waterlogging. The main production areas of peony are prone to waterlogging, seriously affecting the growth and development of herbaceous peony. Polyamines have been observed to significantly enhance the ability of plants to defend and repair adverse damage and affect the synthesis and accumulation of the endogenous growth hormones indole-3-acetic acid (IAA) and abscisic acid (ABA). In this study, two herbaceous peony varieties (‘Lihong’, ‘Qihualushuang’) with different waterlogging tolerances were selected for artificial simulated waterlogging treatment to observe their morphological indexes and to determine their endogenous polyamine and hormone contents. Simultaneously, transcriptome sequencing and bioinformatics analysis were performed, focusing on screening differentially expressed genes in the polyamine metabolism pathway. The results showed that flood-tolerant varieties of herbaceous peony respond to waterlogging stress by continuously synthesizing spermidine (Spd) and spermine (Spm) through putrescine (Put) to counteract adversity. In the waterlogging-intolerant varieties, the expression of polyamine oxidase-related genes was annotated; their response to waterlogging stress was the simultaneous degradation of Spm and Spd to Put in the process of synthesis, and a decrease in the accumulation of Spm and Spd led to the early appearance of the symptoms of damage. In addition, polyamines influence key hormones that respond to plant adversity (IAA; ABA). The objective of this work was to initially analyze the mechanism of the polyamine signaling pathway in response to flooding in herbaceous peonies for further in-depth research on the mechanism of flooding tolerance in herbaceous peony, screen flood-tolerant varieties, and promote of their use.

1. Introduction

Herbaceous peony is a perennial herbaceous flower belonging to the Paeoniaceae family. Herbaceous peony is one of the most famous traditional flowers in China, with high ornamental value, and is often used as a traditional Chinese medicinal herb and in garden application [1]. In recent years, herbaceous peony cut flowers have become a hot spot of interest in the floriculture market [2]. Herbaceous peony prefers loose and airy soil, and is more resistant to drought than to waterlogging [3]. This is relevant as waterlogging is common in the rainy season in the main production areas of Chinese herbaceous peony. Waterlogging disasters occur in most areas of China, which are mainly manifested by concentrated rainfall, high rainfall intensity, and a wide range of flood-prone areas. Waterlogging stress is becoming increasingly severe under the conditions of global warming and the frequent occurrence of extreme weather, which has always been a concern for researchers and scholars [4]. The main production areas of Chinese herbaceous peony are prone to waterlogging during the rainy season and waterlogging for 6–10 h can easily cause root rot, and there is a large gap between flood-tolerant and non-flood-tolerant herbaceous peony varieties in the production of herbaceous peony in responding to flooding stress; flood-tolerant varieties tolerate stress for a relatively long time and are capable of accumulating more nutrients and generating more aerobic tissues in the roots during the stress period. Basic recovery after stress relief in floor-tolerant varieties was shown to be consistent with the pre-stress period, whereas the opposite was true for the flood-intolerant varieties [3]. Therefore, the study of flood-tolerant herbaceous peony varieties is presently of high priority. Waterlogging affects the normal respiration of the plant, and the plant suffers from adversity stress, which may result in a decrease in photosynthetic rate, chlorophyll content, membrane lipid peroxidation, and impeded hormone synthesis; therefore, the study of flood-tolerant herbaceous peony varieties is urgently needed.

Polyamines are a class of biologically active low-molecular-weight aliphatic nitrogenous bases involved in the metabolic processes of organisms, mainly composed of putrescine (Put), spermine (Spm), and spermidine (Spd), which play important roles in the growth and development of herbaceous peony [5]. Both endogenous and exogenous polyamines can positively affect plant growth and stress tolerance [6]. Under water stress, polyamines have polycationic properties, and can be used as signaling substances to participate in plant regulation, promote growth and development, delay senescence, and enhance stress tolerance [7]. Polyamine biosynthesis mainly involves the production of Put from ornithine via ornithine decarboxylase (ODC) or arginine via arginine decarboxylase (ADC), while the synthesis of Put with aminopropyl is provided by decarboxylated S-adenosylmethionine, which is then formed via the catalytic process of Spd synthetase (SPD), which is then transferred to Spd by Spm synthetase (SPM) to produce Spm [8]. Polyamine catabolism is achieved through the oxidation of diamine oxidase (DAO) and polyamine oxidase (PAO). The expression of genes encoding ADC in Arabidopsis thaliana increase under NaCl, dehydration, and abscisic acid treatment conditions, and genes encoding ADC were abundantly expressed in the reproductive organs. The type and expression of genes involved in polyamine synthesis vary under different stress conditions and during different periods of growth and development in different plants [9].

Water stress includes drought and waterlogging, and studies have shown that water stress can cause the external morphology of plants to show symptoms of damage, such as the yellowing of leaf margins and withering of leaves. Studies have shown that plants such as wheat and onions accumulate large amounts of polyamine-regulating substances to enhance resistance to waterlogging stress. In addition, exogenously applied polyamines can increase plant antioxidant enzyme activity and reduce damage caused by waterlogging stress.

Polyamines are considered second messengers of phytohormones, and a close relationship exists between them [10]. Maize lateral root differentiation and development, a physiological process typically regulated by phytohormones, depends on polyamine synthesis and metabolism. The growth-promoting effect of polyamines on inulin tuber explants is similar to that of growth hormones [10]. When induced by IAA, the contents of Spd and Spm in plants increase dramatically. In addition, IAA increases the polyamine content of cauliflower bean plugs [11]. In Arabidopsis thaliana, under drought conditions, the accumulation of Put regulates the expression of key genes in the ABA synthesis pathway.

Current research on herbaceous peony focuses on its medicinal use and cultivation, whereas stress studies mainly focus on temperature, light, drought, and salinity stress. Zhang (2016) [12] evaluated the resistance of herbaceous peony to high temperatures and reported that the native herbaceous peony germplasm of Zhejiang had a higher heat tolerance than other varieties. Hui (2009) [13] conducted drought resistance studies on four herbaceous peony varieties and reported that drought tolerance varied greatly among the different varieties. Our team has conducted physiological and morphological studies on waterlogging stress, and among the three main cultivars of herbaceous peony, ‘Qihualushang’ is less tolerant to waterlogging while ‘Lihong’ is more tolerant to waterlogging [3]. One study cloned the P. lactiflora dehydrin genes PlDHN2 and PIDHNI from the herbaceous peony ‘Dafugui’ variety, which have different sensitivities to different adversities [14]. Studies at the molecular level of flooding stress in herbaceous peonies have not yet been reported.

In this study, we selected two varieties with different waterlogging tolerance: the waterlogging-tolerant variety ‘Lihong’ and the waterlogging-intolerant variety ‘Qihualushang’ as test materials, and subjected them to artificial waterlogging stress at the end of the high-growth period of herbaceous peony, observing their morphological indexes, and determining their endogenous polyamines and hormones. Morphological indices were observed, and endogenous polyamine and hormone levels were measured. Simultaneously, transcriptome sequencing and bioinformatics analysis were performed, focusing on screening differentially expressed genes in the polyamine metabolism pathway. The aims of the study are as follows:

• A preliminary analysis of the polyamine signaling pathway of herbaceous peony in response to waterlogging was carried out, and five key genes of the polyamine signaling pathway were screened: OR552626, OR552627, OR552628, OR552629, and OR552630. Functional validation analyses were performed on the five screened genes at a later stage;
• This study provides a basis for further in-depth research on the mechanism of waterlogging tolerance in herbaceous peony, selection and breeding of excellent waterlogging-tolerant varieties, and promotion of herbaceous peony.

2. Materials and Methods

2.1. Experimental Materials

The experiment was conducted from September 2021 to October 2023 at the herbaceous peony Alba Resource Nursery and Horticulture Experiment Center, Horticulture Experiment Station, Shandong Agricultural University. The site had favorable climatic conditions with an average annual temperature of approximately 13 °C and rainfall of approximately 697 mm. The experimental site had sufficient light, fertile, loose soil, and well-drained slightly acidic, or neutral loam. Two varieties with different waterlogging tolerance were selected from the pre-screening period: the waterlogging-tolerant variety ‘Lihong’ (‘LH’), the waterlogging-intolerant variety ‘Qihualushuang’ (‘QH’) were selected as the experimental materials.

2.2. Experimental Treatment and Sampling

The experiment started with flooding in April 2022 after the completion of high growth (the end of nutrient growth and the flower opening stage), which was defined as the endpoint of stress when approximately 60% of the leaves showed symptoms of damage (when the leaf margins started to turn red or yellow). According to our team’s previous research, after waterlogging stress treatment, ‘Qihualushang’ started to show symptoms of leaf damage after 4 d, and reached the end of stress after 6 d, and ‘Lihong’ started to show symptoms of leaf damage after 12 d, and reached the end of stress after 14 d. ‘Lihong’ started to show symptoms after 12 d and reached the end point of stress after 14 d. The experimental materials were divided into a control group (CK) and a waterlogged group (W), with each treatment consisting of 30 pots. In the waterlogged group, the semi-flooding method was adopted for potted herbaceous peony. Garden soil was used as the cultivation substrate. The soil was loaded to a point 2–3 cm away from the surface of the pots, and potted peonies were set up in the pots (pot size: 41 cm in length, 33 cm in width, and 20 cm in height). The water surface of the set-up pots was kept at the height of over 1/2 of the pots. The water surface was covered with reeds on the surface of the pots to avoid the sunshine that would cause the moisture inside the pots to rise. To prevent the water temperature inside the pots from rising due to sunlight, the pots were covered with reed curtains, and the control was managed according to conventional planting. The control plants were planted according to conventional planting management. On d 0, 1 (24 h), 4, 6, 8, 10, 12, and 14 of waterlogging stress (the first flooding symptom of occurred ‘Qihualushang’ on the 4th day and ‘Lihong’ on the 12th day), the growth status of herbaceous peony was observed and recorded, and herbaceous peony leaves were collected simultaneously for physiological analysis. Herbaceous peony leaves were collected on d 0, 1 (24 h), 4, and 12 of waterlogging stress for transcriptome analysis.

2.3. Test Methods

2.3.1. Transcriptome Sequencing Analysis

(1)

Total RNA extraction from herbaceous peonies

Total RNA was extracted from the leaves of herbaceous peony by using a Flying Shark^TM Universal Plant RNA Kit (DNase I) (RNE35 from Beijing Noble Biotechnology Co., Ltd., Bejing, China), and the methods and steps were performed in strict accordance with the instructions of the kit. The total RNA concentration and RIN value of herbaceous peony leaves were determined using an Agilent Bioanalyzer 2100 system (Agilent Technologies Co. Ltd, Bejing, China) and the purity of the total RNA was determined using an ultra-micro violet photometer (Nano Drop^TM, Wilmington, NC, USA).

Electropherograms and detection peaks of the total RNA from the herbaceous peony leaf samples are shown in Figure 1. 28SrRNA and 18SrRNA bands were clear, the RNA concentrations of the samples were all >150 ng·μL⁻¹, the 28S/18S values were all ≥1.5, and the OD260/280 were all in the range of 2.11–2.19, which indicated that the total RNA of herbaceous peony samples were of good completeness and purity, and fulfilled the requirements for the establishment of libraries.

(2)

Construction and Sequencing of cDNA Libraries

Transcriptome sequencing was performed at Shenzhen Huada Gene Science and Technology Service Co. Qualified RNA was enriched in mRNA using oligo (dT) magnetic beads, and the cDNA library was enriched by PCR and sequenced using an Illumina HiSeq TM 2500 sequencer (Illumina, San Diego, CA, USA). For multiple samples, differentially expressed genes between different samples were detected according to demand, and the differentially expressed genes were subjected to in-depth cluster and functional enrichment analyses.

A total of 76.62 Gb of data was obtained from transcriptome sequencing, totaling 74,407 Unigenes, and the Q30 of each sample was ≥90%, which showed high assembly integrity and good sequencing quality.

The Unigene sequences were compared with KEGG, GO, NR, NT, SwissProt, Pfam, KOG, and other databases, and 55,285 annotated unigenes were obtained, accounting for 74.30% of the total unigenes.

(3)

Fluorescence quantitative PCR expression validation

The total RNA extracted from herbaceous peony was used as a template to synthesize the first strand of cDNA for transcriptome sequencing using the Evo M-MLV RT Mix Kit with gDNA Clean for qPCR Ver.2 (Hunan Accurate Biotechnology Co., Ltd., Changsha, China) by reverse transcription PCR (RT-PCR). The accuracy of the sequencing data were verified using fluorescence quantitative PCR, and five related genes were selected for fluorescence quantitative expression analysis. The sequences of specific genes and their qRT-PCR primers are shown in

Table 1. qRT-PCR primer sequences.

Gene Landing Number	Functional Notes	Primer (5′–3′)
Actin	Internal reference gene	F: TTATGCCCTTCCTCACGCTATC
		R: GAGCTGCTTTTGGAAGTCTCCA
OR552630	Spermidine synthase	F: GTTCAACATGCTTCTACGCCTACC
		R: CTCATCACATTCACAGCCACCTC
OR552629	Polyamine oxidase	F: GCCTTGCGATTTGATAATGTGTTC
		R: ACCTTCCAGCAGCCATATAGAC
OR552626	Hypothetical predicted protein	F: CGGACGGAAACGGATTCAAAG
		R: CCATGACATGACACCAATAAGAGG
OR552627	Transposon protein	F: TGGAGGTTGACATGGGTATCAC
		R: TTCAGATGTAGGCTCGGATGG
OR552628	Uncharacterized protein	F: TCTTGTGAAACTGGGACCTGATTG
		R: CAACCATACTTCCTACCGCATCTT

. The Paeonia lactiflora actin gene was used as the internal reference gene [15], and the primers were synthesized by Hunan Accurate Biotechnology Co., Ltd. Then, qRT-PCR was performed using an SYBR Green Premix Pro Taq HS qPCR Kit (Hunan Accurate Biotechnology Co., Ltd.). An SYBR Green Premix Pro Taq HS qPCR Kit (Hunan Accurate Biotechnology Co., Ltd.) was used for qRT-PCR analysis. The iCycleri05 Real-Time System was used for qRT-PCR, and a three-step fluorescence quantification procedure was adopted.

The reaction procedure was as follows: pre-denaturation at 94 °C for 30 s, 1 cycle; PCR reaction at 94 °C for 5 s, 58 °C for 15 s, 72 °C for 10 s, 45 cycles; melting curve at 65 °C for 5 s, and fluorescence signals were collected at every 0.5 °C increase from 65 to 95 °C. The relative expression of the target genes was calculated using the 2^−ΔΔCt comparative threshold cycling (Ct) method [16]. Three replicates were performed for each gene in each sample.

2.3.2. Determination of Endogenous Polyamine Content

The Spd, Put, and Spm contents were determined using a Waters 2487 high-performance liquid chromatography (HPLC) with a Novapak C18 column (250 × 4.6 mm, 5 µm; Sigma Aldrich, St. Louis, MO, USA) and a Solarbio standard(Beijing Solarbio Science & Technology Co., Ltd., Beijing, China), according to the method described by Liu et al. (2002) [17].

Standard sample treatment: 200 μL of each of Put, Spd, and Spm at 1 mmol·L⁻¹ was taken into a 10 mL plastic centrifuge tube with a lid. A total of 7 μL of benzoyl chloride followed by 1 mL of 2 mol·L⁻¹ NaOH solution were added to the Spm. Then, 7 μL of benzoyl chloride and 1 mL of 2 mol·L⁻¹ NaOH solution were added. After vortexing for 20 s, the reaction was carried out at 37 °C for 20 min; 2 mL of saturated NaCl was added. NaCl was added, mixed thoroughly, extracted with 2 mL of ether, and the sample was centrifuged at 15,000× g for 5 min. After centrifugation at 15,000× g for 5 min, 1 mL of the ether phase was dried under vacuum, dissolved in 200 μL of methanol, and passed through a 0.2 μL organic system. From the 0.2 μL organic filter membrane, 10 μL of the sample was taken. Spd, Put, and Spm standards were purchased from Sigma-Aldrich. (St. Louis, MO, USA)

Treatment of plant materials: Leaf or root samples (0.5 g) were added to 4 mL of a pre-cooled 5% water solution. A precooled 5% perchloric acid solution (4 mL) was ground in an ice bath. After centrifugation at 15,000× g for 30 min at 4 °C, 0.5 mL of the supernatant was added to a 10 mL plastic centrifuge tube with a lid. This procedure was repeated for standard samples. The mobile phase consisted of methanol, acetonitrile, and water in a ratio of 4:3:3, and the detection wavelength was 254 nm.

The mobile phase was methanol, acetonitrile, and water in a ratio of 4:3:3 at 254 nm with a flow rate of 1 mL·min⁻¹ and a column temperature of 30 °C.

2.3.3. Determination of Growth Hormone and Abscisic Acid Content

According to high-performance liquid chromatography [18], endogenous IAA and ABA were detected on a Water2487 HPLC system on a 250 mm × 4.6 mm, 5 µM NovapakC18 chromatography column, UV detector, 264 nm, 0.8 mL·min⁻¹, at 25 °C.

2.3.4. Data Processing and Analysis

Microsoft Excel 2019 software was used to process the data and create graphs, and IBM SPSS Statistics 27.0 software (SPSS Inc., Chicago, IL, USA) was used to test the significance of the differences (p < 0.05).

3. Results and Analysis

3.1. Morphological Changes of Herbaceous Peony under Waterlogging Stress

‘QH’ started to show yellowing or reddening of leaf margins on the 4th day of waterlogging stress, and the leaf changes were obvious on the 6th day. ‘LH’ started to show yellowing or reddening on the 6th day of waterlogging stress. ‘LH’ started to show yellowing or reddening on the 12th day of waterlogging stress, and leaf changes were obvious on the 14th day. Under waterlogging stress, the roots of the herbaceous peony will sprout more adventitious roots to ensure respiration, and both ‘LH’ and ‘QH’ produced more adventitious roots under waterlogging stress. The number of adventitious roots was higher in ‘LH’. Morphological changes in the two herbaceous peony test varieties under waterlogging stress are shown in Figure 2.

3.2. Transcriptome Sequencing Analysis

3.2.1. Functional Annotation and Classification of Unigenes

The annotation results of a few databases are shown in Figure 3.

(1)

Comparison of homologous functional genes between different species

The Unigene sequences were compared to the NR database to determine the species to which the homologous sequences belonged (Figure 3A). The number of comparisons with Vitis vinifera amounted to 5899, accounting for 11.22% of the total number of homologous genes, followed by Nyssa sinensis (5573), Vitis riparia (3671), Tetracentron sinense (2289), Camellia sinensis (1846), and other (33,289).

(2)

KOG functional classification

The Unigene sequences of the herbaceous peonies were annotated using the KOG database, as shown in Figure 3B. A total of 41,555 Unigenes were annotated into 25 KOG functional categories, among which general function prediction was the largest functional group, with 8804 annotations, followed by signal transduction mechanisms, post-translational modification, protein turnover, chaperones, translation, ribosomal structure, and biogenesis.

(3)

GO functional analysis

As shown in Figure 3C, all Unigene results in the NR database were annotated to the GO database and statistically annotated to 45 functional entries into three major categories: biological process, cellular composition, and molecular function. Among these, cellular anatomical entities annotated the most Unigenes, followed by cellular processes, binding, catalytic activity, and metabolic processes.

(4)

Functional analysis of KEGG pathways

As shown in Figure 3D, a total of 40,947 Unigene sequences were annotated in the KEGG database for 19 secondary metabolic pathways in five categories: cellular processes, environmental information processing, genetic information processing, metabolism, and organic systems, in which the annotations were in the order of global and overview maps, carbohydrate metabolism, translation, folding, sorting, and degradation.

3.2.2. Screening and Analysis of Differentially Expressed Genes

The screening of differentially expressed genes was carried out according to enrichment analysis with a Q-value ≤0.05, as shown in Figure 4. After one day of treatment, ‘LH’ had 5177 differentially expressed genes, of which the number up-regulated was 2310, and the number down-regulated was 2867; ‘QH’ had 9270 differential genes, of which 5028 were up-regulated, and 4242 were down-regulated. A total of 7387 differential genes were observed in ‘LH’ after 4 d of treatment, of which 3457 were up-regulated and 3930 were down-regulated. A total of 6692 differential genes were observed in ‘QH’, of which were up-regulated, and 3930 were down-regulated. After 12 d of treatment, ‘LH’ had 4341 differential genes, of which 1979 were up-regulated and 2362 were down-regulated.

3.2.3. GO Pathway Enrichment Analysis of Differentially Expressed Genes in Herbaceous Peony in Response to Waterlogging Stress

A total of 629 differentially expressed genes were annotated to 51 functions in ‘LH’ under waterlogging stress, among which the most differentially expressed genes were annotated in the integrative component of membrane, amounting to 151, followed by carbohydrate metabolic process, serine-type carboxypeptidase activity, abscisic acid-activated signaling pathway, and polyamine biosynthetic process. A total of 3202 differentially expressed genes were annotated to 101 functions in “QH”, of which the largest number of differentially expressed genes were annotated in the integral component of membrane, amounting to 776, followed by plasma membrane, extracellular region, abscisic acid-activated signaling pathway, and polyamine biosynthetic process (Figure 5).

3.2.4. KEGG Pathway Enrichment Analysis of Differentially Expressed Genes in Paeonia in Response to Waterlogging Stress

KEGG pathway enrichment analysis, a total of 629 differentially expressed genes were annotated to 114 pathways in ‘LH’ under waterlogging stress, and there were three significantly enriched pathways: namely, glutathione metabolism, nitrogen metabolism, arginine, and proline metabolism. ‘QH’ had 3202 differentially expressed genes annotated to 132 pathways under waterlogging stress, with 13 significantly enriched pathways, namely plant–pathogen interaction, MAPK signaling pathway—plant, arginine, and proline metabolism, and 3 differentially expressed genes annotated to 114 pathways, including signaling pathways, arginine and proline metabolism, zeatin biosynthesis, and carbon fixation in photosynthetic organisms (Figure 6).

3.2.5. Analysis of Key Differential Genes of the Polyamine Signaling Pathway in Herbaceous Peony

According to the analysis of the relevant metabolic pathways of herbaceous peony under waterlogging stress, a total of 49 differentially expressed genes were annotated to the polyamine synthesis metabolic pathway in ‘LH’ and ‘QH’ (see Appendix A), which were involved in the synthesis of rotenone by the Spm synthesis pathway and rotenone by the ornithine synthesis pathway. The expression of the key genes is shown in Figure 7 and Figure 8.

Expression Analysis of Key Differential Genes at Put Synthesis Stage and Quantitative Fluorescence Validation

Put as the first stage of polyamine synthesis, the differential genes were annotated to three enzymes, ornithine decarboxylase, arginine decarboxylase, and aminocarbonyl Put amidase, and the differential gene Unigene11573_All annotated to ornithine decarboxylase was gradually significant with the intensification of the waterlogging stress of ‘LH’. The expression was not seen on the 12th day, and the expression of ‘LH’ was significantly greater than that of ‘QH’ on the 4th day of waterlogging treatment. The differential gene Unigene17303_All for arginine decarboxylase was annotated only slightly differentially in the middle of waterlogging in ‘Lihong’, while that in ‘QH’ was only slightly up-regulated in the middle of waterlogging. A total of 21 differential genes were annotated to carbamoylputrescine amidase, and Unigene22574_All was down-regulated for expression in the middle of stress and up-regulated for expression in the late stage of stress in ‘LH’. On the 1st day of waterlogging stress, OR552628 was significantly down-regulated in ‘LH’ and up-regulated in ‘QH’, and OR552627 was down-regulated in ‘LH’ and was not seen to be expressed in ‘QH’ (e.g., Figure 7).

Expression Analysis of Key Differential Genes in the Synthesis Stage of Spd and Spm and Quantitative Fluorescence Verification

‘LH’ had 18 differential genes annotated to sapogenins synthase, with two differential genes up-regulated and nine differential genes down-regulated on the 1st day of waterlogging treatment; two differential genes were up-regulated and 10 differential genes down-regulated on the 4th day. Four differential genes were up-regulated, and two differential genes were down-regulated on the 12th day. The expression of these genes was analyzed and quantified using fluorescence. The differentially expressed genes CL615.Contig2_All, CL615.Contig6_All, and CL3232.Contig1_All were up-regulated for expression on the 1st and 4th days and down-regulated on the 12th day under waterlogging stress. A total of 19 differential genes were annotated to sarcosine synthase in ‘QH’, with 3 differential genes up-regulated and 12 differential genes down-regulated on the 1st day of waterlogging treatment, and 3 differential genes up-regulated and 9 differential genes down-regulated on the 4th day. Among them, is CL615.Contig4_All and Unigene23250_All were down-regulated for expression on the 4th day and up-regulated on the 4th day of waterlogging stress. CL615.Contig22_All was up-regulated on the 1st day and down-regulated on the 4th day. A total of eight uniquely expressed genes in the flood-tolerant variety ‘LH’, of which the more significant differences were CL615.Contig6_All, CL615.Contig8_All, and CL615.Contig23_All, OR552630, were down-regulated in ‘LH’ and up-regulated in ‘QH’. Three genes were annotated to SAM decarboxylase in ‘QH’, and all three genes were only up-regulated and expressed at the beginning of waterlogging stress in ‘QH’, while no expression was seen in ‘LH’ (Figure 7).

3.2.6. qRT-PCR Validation of Differentially Expressed Genes of the Polyamine Synthesis Pathway

To verify the accuracy of the transcriptome sequencing results, five genes related to the polyamine synthesis pathway under waterlogging stress were selected for qRT-PCR validation in this study, and the results were as follows: the expression of the genes related to Put synthesis, OR552626, OR552627, and OR552628, was higher in ‘LH’ than that in ‘QH’ in the middle stage of waterlogging stress and showed an increase followed by a decrease in ‘LH’. ‘LH’ was higher than that of ‘QH’ in the middle stage of waterlogging stress, and the expression of OR552626, OR552627, and OR552628 was higher than that of ‘QH’ in the middle stage of waterlogging stress, and the expression of OR552628 in ‘Lihong’ showed a trend of increasing and then decreasing and that of ‘QH’ showed a trend of increasing, which was consistent with the information of the transcriptome. The expression of OR552630 genes, which are related to Spd and Spm synthesis under waterlogging stress, was higher in ‘LH’ than that in ‘QH’ in the middle stage of waterlogging stress and showed a decreasing and then decreasing trend in ‘LH’, and an increasing trend in ‘QH’, which was consistent with the transcriptome information. The expression of the OR552631 gene in ‘LH’ was higher than that in ‘QH’ in the middle stage of waterlogging stress, and the expression of ‘LH’ showed a trend of decreasing, then increasing, and then decreasing. OR552631 showed an upward trend in ‘QH’. OR55262, a gene related to polyamine metabolism under waterlogging stress, showed an overall increasing and then decreasing trend in ‘LH’ and an increasing trend in ‘QH’. The overall gene trends were consistent with the transcriptome sequencing results, indicating that the transcriptome sequencing results were accurate and reliable (Figure 9).

3.2.7. Changes in Endogenous Polyamine Content of Herbaceous Peony Leaves under Waterlogging Stress

Polyamines play an important role in plant growth and development. As shown in Figure 10, the Spd and Spm contents of ‘QH’ leaves under waterlogging stress were higher and significantly higher than those of ‘LH’. On the 1st day of waterlogging treatment, ‘QH’ leaves produced less Put, and the content was much lower than that of ‘LH’. With the growth of waterlogging treatment time, on the 4th day ‘QH’ leaves had a higher Put content. With the increase of waterlogging treatment time, on the 4th day, the leaf blade of ‘QH’ had higher Put content. With the increase of waterlogging treatment time, on the 4th day, the Put content of ‘QH’ leaves was higher. When ‘LH’ and ‘QH’ showed damage symptoms, the Spd and Spm contents of leaves in the waterlogged group were lower than that of the control group. The Put content was higher than that of the control group.

Under waterlogging treatment, leaf Put content of ‘LH’ was 1.36% higher than that of CK on the 1st day and 124.97% higher than that of CK on the 12th day. The leaf Put content of ‘LH’ was 1.36% higher than that of CK on the 1st day and 124.97% higher than that of CK on the 12th day. In ‘QH’, leaf Put content was 43.83% lower than that of CK on the 1st day, and on the 12th day, leaf Put content was 221.00% higher than CK. Leaf Put content of ‘LH’ and ‘QH’ was reduced by 74.18% and 47.02% after 1 d of waterlogging treatment (Figure 10A).

The leaf Spd content of ‘LH’ was 16.00% lower than CK on the 1st day and 22.00% lower than CK on the 12th day under waterlogging treatment. In ‘QH’, leaf Spd content was 1.61% higher than CK on the 1st d, and on the 12th day, leaf Spd content was 9.91% lower than CK. The leaf Spd content of ‘LH’ increased by 245.23% after the 1st day of waterlogging treatment; the leaf Spd content of ‘QH’ decreased by 20.54% after the first day of waterlogging treatment (Figure 10B).

The leaf Spm content of ‘LH’ was 12.74% lower than CK on the 1st day and 54.94% lower than CK on the 12th day under waterlogging treatment. In ‘QH’, leaf Spm content was 16.23% lower than that of CK on the 1st day, and 75.70% lower than that of CK on the 12th day. In ‘LH’, leaf Spm content was 12.74% lower than that of CK on the 1st day, and 54.94% lower than that of CK on the 12th day. The leaf Spm content of ‘LH’ was reduced by 53.31% after one day of waterlogging treatment; the leaf Spm content of ‘QH’ was increased by 7.67% after 1 day of waterlogging treatment (Figure 10C).

Additionally, (Spd + Spm)/Put is often used as an important indicator of the strength of plant stress tolerance. After 1 d of waterlogging stress, the ‘LH’ (Spd + Spm)/Put was 0.1782 while that of ‘QH’ was 0.5337. For waterlogging treatment to the appearance of injury symptoms, the ‘LH’ (Spd + Spm)/Put value was 0.1659 while the ‘QH’ (Spd + Spm)/Put value was 0.1549.

3.2.8. Changes in Endogenous Hormone Content of Peony Leaves under Waterlogging Stress

The IAA content of leaves of ‘LH’ and ‘QH’ were similar. The IAA content of the leaf blades of ‘LH’ was 28.77% higher than that of CK on the 1st day of waterlogging treatment, and the IAA content of the leaf blades of ‘QH’ was 56.81% higher than that of CK. On the 12th day of waterlogging treatment, the leaf IAA content of ‘LH’ was 38.67% lower than that of CK. The leaf IAA content of ‘LH’ and ‘QH’ increased by 52.67% and 130.84%, respectively, after 1 d of waterlogging treatment (Figure 11A).

The main role of ABA in plants is to regulate stomata by regulating the size of defense cells, thus regulating the water potential of the plant. ABA is a key hormone in the water stress response. As shown in Figure 11B, ‘QH’ leaf ABA content was overall higher than ‘LH’. The leaf ABA content of ‘LH’ was 53.69% higher than that of CK on the 1st day under waterlogging treatment, and 47.38% lower than that of CK on the 12th day. Under the waterlogging treatment, leaf ABA content was 8.18% higher than that of CK on the 1st day. On the 4th day, leaf ABA content was 39.53% lower than that of CK in ‘LH’ and ‘QH’. In ‘LH’ and ‘QH’ after 1 d of waterlogging treatment, leaf ABA content increased by 41.64% and decreased by 13.94%, respectively.

4. Discussion

4.1. Effects of Waterlogging Stress on the Morphology of Herbaceous Peony

Waterlogging is a major problem facing plant production; plants subjected to waterlogging stress respond to the damage caused by waterlogging stress by changing their growth morphology. The main production areas of herbaceous peony are prone to waterlogging during the rainy season. Some studies have claimed that waterlogging of herbaceous peony roots for 6–10 h will cause root rot, and there is a big difference in the ability of different herbaceous peony varieties to tolerate flooding. Waterlogging stress creates an oxygen-deficient growth environment, which hinders the transportation of nutrients by the plant root system and results in the yellowing of leaves in the aboveground parts [19]. In this study, both ‘Lihong’ and ‘Qihualushang’ showed symptoms of yellowing or reddening of leaf margins under waterlogging stress, with the flood-tolerant variety ‘Lihong’ showing symptoms of damage later and the flood-intolerant variety ‘Qihualushang’ showing symptoms of damage earlier. High soil water content affects root respiration [20], and plants sprout more adventitious roots to maintain normal root respiration. By studying the number and length of adventitious roots in two different waterlogging-tolerant winter melons subjected to waterlogging stress, Mi, B.B. et al. [21] concluded that adventitious roots of the more waterlogging-tolerant winter melons appeared earlier, in greater numbers, and at longer lengths. The results of this study indicate that all herbaceous peony roots produced adventitious roots under waterlogging stress, with the flood-tolerant variety ‘Lihong’ producing more adventitious roots.

4.2. Analysis of Key Genes for Polyamine Signaling in Response to Waterlogging Stress in Herbaceous Peony

During normal plant growth, high soil water content causes waterlogging stress, hindering plant growth, development, and physiological metabolism. Studies have shown that polyamines can effectively alleviate plant injury caused by waterlogging stress. Under stress, the types and contents of polyamines and the activities of enzymes related to polyamine metabolism in plants are affected by stress duration and variety resistance [22], Put, Spd, and Spm are the three common types of polyamines [3]. Two pathways are observed for the synthesis of Put in plants: one is the direct formation of Put from ornithine through decarboxylation by ornithine decarboxylase (ODC), and the other is the formation of Spm from Spd through the catalytic formation of Spd by Spm acid decarboxylase (ADC) and the hydrolysis of herring Spm to N-aminomethyl Put (NCP), followed by the formation of Put. The expressions of ODC and ADC are regulated by different physiological conditions in different plants [23]. The ADC pathway is responsible for Put synthesis in the mature aboveground vascular tissues of tobacco, whereas the ODC pathway catalyzes its production in the underground tissues. In the current study, Put was synthesized by both pathways in ‘Lihong’ and ‘Qihualushang’ (Figure 12).

Spd and Spm are synthesized from Put, with an aminopropyl group provided by decarboxylated S-adenosylmethionine. S-adenosylmethionine synthetase (SAMS) and S-adenosylmethionine decarboxylase (SAMDC) are both rate-limiting enzymes in the synthesis of plant polyamines. In the polyamine synthesis pathway, S-adenosylmethionine synthetase catalyzes the biosynthesis of methionine with ATP to S-adenosine methionine (SAM), S-adenosine methionine is catalyzed by S-adenosine methionine decarboxylase (SAMDC) to produce decarboxylated SAM and Spd and Spm are synthesized from Put with the aminopropyl group provided by decarboxylated SAM, and this reaction is catalyzed by sialylamine synthetase and arginylamine synthetase [24]. Kong, L.F et al. (2013) [25] concluded that the SAMS1 gene is induced by drought stress by studying the drought resistance of awnless cryptomeria, and the three genes annotated to SAM decarboxylase were up-regulated on the 1st d of waterlogging stress in this study of ‘Qihualushuang’, which was consistent with the result that the content of endogenous Spd was slightly higher than that of the control group under waterlogging stress, suggesting that SAM decarboxylase is essential for the synthesis of Spd and Spm. In addition, SAM decarboxylase is a key rate-limiting enzyme for Spm synthesis, and the slight increase in Spm content and decrease in Spd content in ‘Qihualushuang’ on the 1st d of waterlogging stress is consistent with the expression of SAM decarboxylase genes. We hypothesized that ‘Qihualushuang’ would resist adversity by accelerating the conversion of Spd to Spm after waterlogging stress. Spd and Spm are more likely to bind non-covalently to phospholipids than Put, enhancing the stability of biomolecules under abiotic stress. After experiments on wheat, it was reported that increasing the levels of Spd and Spm significantly enhanced the intensity of ethanol dehydrogenase activity in the plant, while lactate dehydrogenase activity was inhibited, and the alcohol content was significantly increased. In contrast, lactate content was greatly reduced, which enhanced the plant’s flooding resistance through the change of multiple physiological and biochemical indexes.

Studies have suggested that the accumulation of free Put is a defensive response of plants to adapt to stress, whereas others have shown that elevated free Put content under stress conditions is an injurious response of plants and that the (Spd + Spm)/Put ratio can be used as an important index to measure the strength of plant stress tolerance. In the current study, when ‘Lihong’ and ‘Qihualushang’ were subjected to waterlogging stress to the point of injury symptoms, the flood-tolerant variety ‘Lihong’ had a higher (Spd + Spm)/Put ratio than the flood-intolerant variety ‘Qihualushang’, further confirming that this index can be used to screen herbaceous peony varieties for flood tolerance. This indicator can be used to screen flood-tolerant varieties of Paeonia lactiflora. The trends of PA changes in ‘Lihong’ and ‘Qihualushuang’ were the same as those in the control group, and the trends of polyamine changes showed significant differences from the control group with the intensification of stress. This is consistent with the results of a study on water stress in Cabernet Sauvignon seedlings [26].

The application of exogenous Spd under waterlogging stress accelerates the conversion of endogenous Put to Spd, improves polyamine metabolism, and significantly improves root function damaged by waterlogging stress; it also improves antioxidant enzyme activity and maintains the balance of the enzyme system, thus alleviating waterlogging stress [27]. The changes in the contents of Spd and Spm in herbaceous peony flood-tolerant varieties were more significant than those in non-flood-tolerant varieties in the current study. The increase in Put contents was more significant in the waterlogging-intolerant varieties, which is consistent with the results of water stress studies on wheat by Wang Shuangyueqi (2019) [27] and Du (2017), [28] suggesting that Spm and Spd might be involved in waterlogging stress tolerance improvement, and Put did not play an active role in adapting to waterlogging stress. The total amount of the three types of free PAs was significantly and positively correlated with Put content, indicating that Put plays a dominant role in PA synthesis under waterlogging stress in herbaceous peony. The transcriptome information analyzed 25 key enzyme genes for the synthesis of Spd and Spm, of which more genes were up-regulated in ‘Lihong’ and ‘Qihualushuang’ with the intensification of waterlogging stress; fewer genes were down-regulated. The differential gene for ornithine decarboxylase was up-regulated on both day 1 and day 4 of waterlogging treatment in ‘Lihong’, and the multiplicity of difference was lower on day 1 than on day 4; the gene was significantly up-regulated on day 4 of waterlogging treatment in ‘Qihualushuang’, which was consistent with changes in the content of its endogenous humins. The gene was significantly up-regulated on day 4 of the waterlogging treatment in ‘Qihualushuang’.

Polyamines and phytohormones are both trace organic molecules produced by the plant’s metabolism and play important roles in the regulation of growth, development, senescence, and stress tolerance; they are often considered to be the second messengers of phytohormones [8,11]. ABA is sensitive to water stress, and when the plant body is subjected to water stress, it responds rapidly to improve tolerance. Adversity can promote ABA re-synthesis or redistribution of pro-ABA to increase local concentrations of ABA to improve crop resistance. ABA and polyamines are small molecules involved in various physiological and stress responses, with a complex network of interactions evident during plant responses to abiotic stresses, especially stomatal closure [29]. Under most abiotic stress conditions, endogenous plant ABA is induced to activate downstream gene expression and other physiological responses [30]. Toumi et al. (2010) [31] showed that ABA enhances the accumulation of polyamines (Put, Spd, and Spm) in grapes and induces the polyamine oxidation pathway in grapes, which results in secondary protective effects such as stomatal closure. Alcázar et al. (2010) [32] reported that Put and ABA are integrated in a positive feedback loop in which they induce each other’s biosynthesis in response to abiotic stresses [32,33,34,35]. Polyamines regulate stomatal responses by inducing closure and reducing pore size, partly by interacting with ABA and NO [29,30]. After experiments with cold-stressed sweet corn seedlings, Fei, C.Y (2016) [36] reported that Spd is involved in the regulation of antioxidant systems, significantly reduces ABA content in maize seedlings, and enhances ABA signaling at the transcriptional level in response to cold stress [37,38,39]. By analyzing the changes in the expression of various genes in Arabidopsis wild-type, abscisic acid synthesis mutants, and signaling mutants under drought conditions, it was concluded that under drought conditions in Arabidopsis thaliana, [40,41] ABA may affect polyamine synthesis and metabolism at the transcriptional level [22]. The accumulation of Put regulates the expression of a key gene in the ABA synthesis pathway, NCED [42,43], and in adc1 and adc2 double mutants, the expression of NCED3 and ABA-regulated related genes is suppressed [44]. In this study, the Put content of both ‘Lihong’ and ‘Qihulushuang’ showed an increasing trend after 1 d of waterlogging stress, while at the same time, the ABA content showed a decreasing trend. This indicates that Put accumulation inhibits ABA synthesis, which is consistent with the results reported by Cuevas, J.C. et al. [44] The IAA content tends to increase and then decrease when plants are subjected to drought stress, which is consistent with the results of this study. Gui Renyi et al. [45] concluded by studying the effects of applying exogenous polyamines and inhibitors of polyamine synthesis on endogenous hormone content in adult flowers of Dianthus spp. seedlings, and reported that exogenous Put had little effect on endogenous IAA content, exogenous Spm and Spd content, but led to increased endogenous IAA content, and the polyamine biosynthesis inhibitor DFMO decreased endogenous IAA levels [45]. This study is corroborated by the positive correlation between IAA content and Spd and Spm trends of the two herbaceous peony cultivars in this study, respectively.

5. Conclusions

We studied the physiological changes in herbaceous peony with different waterlogging tolerances (‘Lihong’ and ‘Qihualushuang’) under waterlogging stress and performed transcriptome analysis, focusing on the analysis of the polyamine signaling pathway of herbaceous peony and screened for the key genes of the polyamine signaling pathway. The results showed that under waterlogging stress, waterlogging-tolerant varieties showed symptoms of damage later and produced more adventitious roots, and the endogenous polyamine content of Paeonia lactiflora changed under waterlogging stress, which corresponded to the up- and down-regulation of genes in its polyamine signalling pathway. Combined with the transcriptome information analysis, it can be seen that both test varieties synthesize Put via the Spd pathway and the ornithine pathway, and the related genes annotated to SAM decarboxylase will accelerate the conversion of Spd to Spm to resist adversity. The key enzyme genes for synthesizing suberin and Spm were annotated to 13 genes, and with the intensification of the waterlogging stress, more genes were up-regulated, and fewer genes were down-regulated. Flood-tolerant varieties of Paeonia lactiflora respond to waterlogging stress by continuously synthesizing Spd and Spm through Put to defend against adversity. The expression of polyamine oxidase-related genes was annotated in waterlogging-intolerant variety that responded to waterlogging stress by the simultaneous conversion of Spm and Spd to Put for degradation during synthesis; the decrease in the accumulation of Spm and Spd led to earlier onset of damage symptoms. The polyamine signaling pathway will affect the synthesis and accumulation of IAA and ABA, and the accumulation of Put in peonies inhibits the synthesis of ABA, and has no obvious effect on the content of endogenous IAA, while the accumulation of Spm and Spd can increase the content of endogenous IAA.

Further studies are needed to verify the function of flood-related genes to provide a reference basis for further research on the mechanism of flooding tolerance, screening of flood-tolerant varieties, and promotion of herbaceous peony.