Comparative Transcriptome Analysis of Mature Leaves of Dimocarpus longan cv. ‘Sijimi’ Provides Insight into Its Continuous-Flowering Trait
Round 1
Reviewer 1 Report
Comments and Suggestions for AuthorsThe authors used leaves to analyze the transcriptome and compare the differences in CF and OF gene expression, providing evidence on the continuous flowering mechanism of Dimocarpus longan cv. 'Sijimi' 78. I read the paper line by line and found that the content of the introduction was limited. The design of experiment is good, and the results could support their conclusions. In particular, the problems and suggestions as below.
1. Introduction: The introduction of the paper was somewhat superficial, making it difficult to follow the main points. The writing could benefit from improvement to enhance clarity and coherence, allowing readers to better understand the objectives and background of the study. For example, the authors are describing the species, and change it to Arabidopsis (lines 40-41) without any connection.
2. Materials and methods: 2.1Were the mature leaves collected from the upper, middle, or lower third of the plant? (line 88) 2.2 Technical concerns regarding the expression analysis – the authors use comparative ΔΔCt method to calculate relative expression levels in Real-Time qPCR and mention that GAPDH gene was used as internal control. However, when checking the paper 33 (Luo et al. 2021), they used DlActin (β-actin) and DlEF-1a genes as reference genes for data normalization. Thus, this reviewer is concerned with the quality of the expression profiling experiments. Namely, the reviewer is unsure why only a single reference gene was used for obtaining the relative expression data. It is advised that at least two, but preferably three, reference genes are analyzed and averaged for the expression profiling for non-model plants. Can the authors please explain why only a single gene was used and why GAPDH was chosen if other manuscripts cited employ different reference genes?
3. Some details need to be carefully checked, such as a better description of the legends, adjust table 1 in the text, scientific names in italics in figure 1. Describe the statistical analysis in the legend to Figure 5.
Author Response
Comments 1: Introduction: The introduction of the paper was somewhat superficial, making it difficult to follow the main points. The writing could benefit from improvement to enhance clarity and coherence, allowing readers to better understand the objectives and background of the study. For example, the authors are describing the species, and change it to Arabidopsis (lines 40-41) without any connection.
Response 1: We removed “Longan flowers also have medicinal potential, as longan flower extracts exhibit antioxidative and anti-cancer properties.” and “Flowering in Arabidopsis is regulated by 5 genetic pathways: vernalization, photoperiod, gibberellin, autonomous and age pathway.” in the first and second paragraph of the introduction. And merged the first and second paragraphs into one paragraph.
The first paragraph mainly introduces the distribution of longan and points out the continuous flowering phenotype of Dimocarpus longan cv. ‘Sijimi’ (SJ). Then we summarized the research progress on continuous flowering of other plants (second paragraph) and longan (third paragraph). The last paragraph elucidated the reasons and significance of using longan leaves as experimental materials to study the continuous flowering of Dimocarpus longan cv. ‘Sijimi’.
Is this writing approach feasible? If not, would you give us more detailed suggestions?
Comments 2: Materials and methods: 2.1Were the mature leaves collected from the upper, middle, or lower third of the plant? (line 88) 2.2 Technical concerns regarding the expression analysis – the authors use comparative ΔΔCt method to calculate relative expression levels in Real-Time qPCR and mention that GAPDH gene was used as internal control. However, when checking the paper 33 (Luo et al. 2021), they used DlActin (β-actin) and DlEF-1a genes as reference genes for data normalization. Thus, this reviewer is concerned with the quality of the expression profiling experiments. Namely, the reviewer is unsure why only a single reference gene was used for obtaining the relative expression data. It is advised that at least two, but preferably three, reference genes are analyzed and averaged for the expression profiling for non-model plants. Can the authors please explain why only a single gene was used and why GAPDH was chosen if other manuscripts cited employ different reference genes?
Response 2: We are sorry for the careless wrong writing. We have tried multiple primers for the qRT-PCR, such as DlActin-F: ATTGTTGAGCAGCTTGTCCG, DlActin-R: GGAACACAACTTTGGCGAGT (in Xue, X., Zhou X., Jue, D. (2020). Clonging and Expression Analysis of WRKY52 Gene in Dimocarpus longan. Chinese Journal of Tropical Crops, 41(4): 730-736); DlActin-F: TGAGGGATGCTAAGATGG, DlActin-R: ATGAGTTGCCTGATGGAC (in Xie, D. (2010). Molecular cloning of one chitinase gene from longan (Dimocarpus longan Lour.) flower buds and construction of plant expression vector. Fuzhou, Fujian Agriculture and Forestry University); and GAPDH-F: AACGTTGCCTGATTTT, GAPDH-R: GTACTTTCTTTCATACT (in Wang, J., Chen, J., Huang, S., Han, D., Li, J., Guo, D. (2022). Investigating the Mechanism of Unilateral Cross Incompatibility in Longan (Dimocarpus longan Lour.) Cultivars (Yiduo × Shixia). Front Plant Sci. 12:821147.) We found these are not stable enough for qRT-PCR in our experiment. Finally, we found DlActin-F: TGCTATCCTTCGGTTGGACC, DlActin-R: CGGACGATTTCCCGTTCAG from Luo et al. (2021) had the best stability for qRT-PCR.
Comments 3: Some details need to be carefully checked, such as a better description of the legends, adjust table 1 in the text, scientific names in italics in figure 1. Describe the statistical analysis in the legend to Figure 5.
Response 3: They have been revised.
Reviewer 2 Report
Comments and Suggestions for AuthorsThe author of this article provides extensive transcriptome data in an attempt to explore the potential flowering mechanisms in different longan cultivars with varying flowering habits. Although metadata is included, the discussion falls slightly short in linking the bioinformatics results with the actual physiological mechanisms of flowering. This aspect is somewhat regrettable.
Some gaps and areas still require further elaboration within the content. The following points are highlighted for the author's consideration and revision:
1. In Abstract, Lines 20-22: There is a formatting issue; some words are incorrectly capitalized and should not be. Please ensure proper capitalization according to standard conventions. Line 26: Please clarify the abbreviations "TF" and "GA." It is essential to define these terms at their first mention for clarity, as readers may not be familiar with them.
2. Regarding the introduction, the physiological regulation potentially inducing longan flowering should be explained. While the authors have referenced previous research regarding transcriptome findings related to the flowering mechanism of longan, the connection between these transcriptome results and the flowering physiology is not clearly stated. The hypothesis at the end of the introduction is also unclear. The authors should specify the focus areas for clarifying the molecular-level differences responsible for continuous flowering in longan, which is essential for achieving the stated objective of providing more evidence for revealing the regulatory mechanism of Dimocarpus longan cv. ‘Sijimi’ continuous flowering.
3. The description of the mature leaves used for analysis is insufficient. The age of the leaves, the specific part of the plant they were collected from, the number of leaves sampled, and the sampling method should all be clearly detailed.
4. The plant material codes (CL, SJ, SX) appearing in the figures need to be explained in the figure legends, such as in Fig. 3. This clarification is essential for the reader to understand the context of the figures.
These revisions should help to clarify the manuscript and strengthen the overall analysis.
Author Response
Comments 1: In Abstract, Lines 20-22: There is a formatting issue; some words are incorrectly capitalized and should not be. Please ensure proper capitalization according to standard conventions. Line 26: Please clarify the abbreviations "TF" and "GA." It is essential to define these terms at their first mention for clarity, as readers may not be familiar with them.
Response 1: In line 20-22, Metabolic pathways, Plant-pathogen interaction, Biosynthesis of secondary metabolites, Plant hormone signal transduction, Amimo sugar and nucleotide sugar metabolism, Starch and sucrose metabolism represented different metabolic pathways, so we capitalized the the first letter.
Comments 2: Regarding the introduction, the physiological regulation potentially inducing longan flowering should be explained. While the authors have referenced previous research regarding transcriptome findings related to the flowering mechanism of longan, the connection between these transcriptome results and the flowering physiology is not clearly stated. The hypothesis at the end of the introduction is also unclear. The authors should specify the focus areas for clarifying the molecular-level differences responsible for continuous flowering in longan, which is essential for achieving the stated objective of providing more evidence for revealing the regulatory mechanism of Dimocarpus longan cv. ‘Sijimi’ continuous flowering.
Response 2: The research on continuous flowering of longan mainly focuses on the molecular mechanism of floral induction. There is little information about its flowering physiology.
The introduction focuses closely on the study of continuous flowering. The first paragraph mainly introduces the distribution of longan and points out the continuous flowering phenotype of Dimocarpus longan cv. ‘Sijimi’ (SJ). Then we summarized the research progress on continuous flowering of other plants (second paragraph) and longan (third paragraph). The last paragraph elucidated the reasons and significance of using longan leaves as experimental materials to study the continuous flowering of Dimocarpus longan cv. ‘Sijimi’.
Comments 3: The description of the mature leaves used for analysis is insufficient. The age of the leaves, the specific part of the plant they were collected from, the number of leaves sampled, and the sampling method should all be clearly detailed.
Response 3: The detailed information was added in line 87-90.
Comments 4: The plant material codes (CL, SJ, SX) appearing in the figures need to be explained in the figure legends, such as in Fig. 3. This clarification is essential for the reader to understand the context of the figures.
Response 4: The detailed information has been added in the legends of Fig. 2, Fig. 3 and Fig. 5.
Reviewer 3 Report
Comments and Suggestions for AuthorsThe manuscript entitled "Comparative transcriptome analysis of Dimocarpus longan cv. ‘Sijimi’mature leaves provides insight into its continuous flowering trait" is a manuscript that I found interesting, it is clear, the sections are well described; however, I consider in general that with so much information presented in the results, I expected to find a broader discussion section, I think that they should increase the discussions a little more. The conclusions are well supported by the results.
In my opinion, this manuscript is suitable to be published in this Journal and I consider that it will be interesting for readers.
Author Response
Comments 1: The manuscript entitled "Comparative transcriptome analysis of Dimocarpus longan cv. ‘Sijimi’mature leaves provides insight into its continuous flowering trait" is a manuscript that I found interesting, it is clear, the sections are well described; however, I consider in general that with so much information presented in the results, I expected to find a broader discussion section, I think that they should increase the discussions a little more. The conclusions are well supported by the results.
Response 1: We added the transcription factors in floral regulation.
Round 2
Reviewer 1 Report
Comments and Suggestions for AuthorsThe edits the authors made have improved the manuscript.
Please, make sure to upload high quality image files of all of the figures for publication. In figure 3b, for example, in their current form, it is difficult or impossible to read the smaller text.
