Immunomodulatory Lectin-like Peptides for Fish Erythrocytes-Targeting as Potential Antiviral Drug Delivery Platforms
Abstract
:1. Introduction
2. Results
2.1. In Vitro Evaluation of Peptide Binding to Rainbow Trout RBCs
2.2. In Vitro Analysis of Gene Expression in Rainbow Trout RBCs after Peptide Treatment
2.3. In Vivo Evaluation of Peptide Binding to Rainbow Trout RBCs
3. Discussion
4. Materials and Methods
4.1. Peptide Synthesis and Characterization
4.2. Animals
4.3. RBCs Purification and In Vitro Treatment with the Peptides
4.4. Peripheral Blood Sampling after In Vivo Injection with the Peptides
4.5. RNA Isolation and Gene Expression by RT-qPCR
4.6. Flow Cytometer Assays
4.7. Fluorescent Microscopy
4.8. Confocal Microscopy
4.9. Software Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Somasundaram, C.; Takamatsu, H.; Andreoni, C.; Audonnet, J.C.; Fischer, L.; Lefevre, F.; Charley, B. Enhanced protective response and immuno-adjuvant effects of porcine gm-csf on DNA vaccination of pigs against aujeszky’s disease virus. Vet. Immunol. Immunopathol. 1999, 70, 277–287. [Google Scholar] [CrossRef] [Green Version]
- McKay, P.F.; Barouch, D.H.; Santra, S.; Sumida, S.M.; Jackson, S.S.; Gorgone, D.A.; Lifton, M.A.; Letvin, N.L. Recruitment of different subsets of antigen-presenting cells selectively modulates DNA vaccine-elicited cd4+ and cd8+ t lymphocyte responses. Eur. J. Immunol. 2004, 34, 1011–1020. [Google Scholar] [CrossRef]
- Tacken, P.J.; de Vries, I.J.; Torensma, R.; Figdor, C.G. Dendritic-cell immunotherapy: From ex vivo loading to in vivo targeting. Nat. Rev. Immunol. 2007, 7, 790–802. [Google Scholar] [CrossRef]
- Caminschi, I.; Lahoud, M.H.; Shortman, K. Enhancing immune responses by targeting antigen to dc. Eur. J. Immunol. 2009, 39, 931–938. [Google Scholar] [CrossRef]
- Brigger, I.; Dubernet, C.; Couvreur, P. Nanoparticles in cancer therapy and diagnosis. Adv. Drug Deliv. Rev. 2002, 54, 631–651. [Google Scholar] [CrossRef]
- Moghimi, S.M.; Hunter, A.C.; Murray, J.C. Long-circulating and target-specific nanoparticles: Theory to practice. Pharmacol. Rev. 2001, 53, 283–318. [Google Scholar] [PubMed]
- Gref, R.; Minamitake, Y.; Peracchia, M.T.; Trubetskoy, V.; Torchilin, V.; Langer, R. Biodegradable long-circulating polymeric nanospheres. Science 1994, 263, 1600–1603. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Muzykantov, V.R. Drug delivery by red blood cells: Vascular carriers designed by mother nature. Expert Opin. Drug Deliv. 2010, 7, 403–427. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Murray, A.M.; Pearson, I.F.; Fairbanks, L.D.; Chalmers, R.A.; Bain, M.D.; Bax, B.E. The mouse immune response to carrier erythrocyte entrapped antigens. Vaccine 2006, 24, 6129–6139. [Google Scholar] [CrossRef] [PubMed]
- D’Alessandro, A.; Zolla, L. Proteomic analysis of red blood cells and the potential for the clinic: What have we learned so far? Expert Rev. Proteom. 2017, 14, 243–252. [Google Scholar] [CrossRef]
- Rossi, L.; Serafini, S.; Cenerini, L.; Picardi, F.; Bigi, L.; Panzani, I.; Magnani, M. Erythrocyte-mediated delivery of dexamethasone in patients with chronic obstructive pulmonary disease. Biotechnol. Appl. Biochem. 2001, 33, 85–89. [Google Scholar] [CrossRef] [PubMed]
- Ktavtzoff, R.; Desbois, I.; Doinel, C.; Colombat, P.; Lamagnere, J.P.; Chassaigne, M.; Ropars, C. Immunological response to l-asparaginase loaded into red blood cells. Adv. Exp. Med. Biol. 1992, 326, 175–182. [Google Scholar]
- Dale, G.L.; Kuhl, W.; Beutler, E. Incorporation of glucocerebrosidase into gaucher’s disease monocytes in vitro. Proc. Natl. Acad. Sci. USA 1979, 76, 473–475. [Google Scholar] [CrossRef] [Green Version]
- Tonetti, M.; Astroff, B.; Satterfield, W.; De Flora, A.; Benatti, U.; DeLoach, J.R. Construction and characterization of adriamycin-loaded canine red blood cells as a potential slow delivery system. Biotechnol. Appl. Biochem. 1990, 12, 621–629. [Google Scholar] [PubMed]
- Moreno-Perez, D.A.; Garcia-Valiente, R.; Ibarrola, N.; Muro, A.; Patarroyo, M.A. The aotus nancymaae erythrocyte proteome and its importance for biomedical research. J. Proteom. 2017, 152, 131–137. [Google Scholar] [CrossRef]
- Gupta, R.K.; Siber, G.R. Adjuvants for human vaccines—Current status, problems and future prospects. Vaccine 1995, 13, 1263–1276. [Google Scholar] [CrossRef]
- Del Giudice, G.; Podda, A.; Rappuoli, R. What are the limits of adjuvanticity? Vaccine 2001, 20 (Suppl. 1), S38–S41. [Google Scholar] [CrossRef]
- Babiuk, S.; Baca-Estrada, M.; Babiuk, L.A.; Ewen, C.; Foldvari, M. Cutaneous vaccination: The skin as an immunologically active tissue and the challenge of antigen delivery. J. Control. Release Off. J. Control. Release Soc. 2000, 66, 199–214. [Google Scholar] [CrossRef]
- Cremel, M.; Guérin, N.; Horand, F.; Banz, A.; Godfrin, Y. Red blood cells as innovative antigen carrier to induce specific immune tolerance. Int. J. Pharm. 2013, 443, 39–49. [Google Scholar] [CrossRef] [PubMed]
- Grimm, A.J.; Kontos, S.; Diaceri, G.; Quaglia-Thermes, X.; Hubbell, J.A. Memory of tolerance and induction of regulatory t cells by erythrocyte-targeted antigens. Sci. Rep. 2015, 5, 15907. [Google Scholar] [CrossRef] [Green Version]
- Sun, X.; Han, X.; Xu, L.; Gao, M.; Xu, J.; Yang, R.; Liu, Z. Surface-engineering of red blood cells as artificial antigen presenting cells promising for cancer immunotherapy. Small 2017, 13, 1701864. [Google Scholar] [CrossRef]
- Anselmo, A.C.; Gupta, V.; Zern, B.J.; Pan, D.; Zakrewsky, M.; Muzykantov, V.; Mitragotri, S. Delivering nanoparticles to lungs while avoiding liver and spleen through adsorption on red blood cells. ACS Nano 2013, 7, 11129–11137. [Google Scholar] [CrossRef] [Green Version]
- Sahoo, K.; Koralege, R.S.H.; Flynn, N.; Koteeswaran, S.; Clark, P.; Hartson, S.; Liu, J.; Ramsey, J.D.; Pope, C.; Ranjan, A. Nanoparticle attachment to erythrocyte via the glycophorin a targeted ery1 ligand enhances binding without impacting cellular function. Pharm. Res. 2016, 33, 1191–1203. [Google Scholar] [CrossRef]
- Glomski, C.A.; Tamburlin, J.; Hard, R.; Chainani, M. The phylogenetic odyssey of the erythrocyte. Iv. The amphibians. Histol. Histopathol. 1997, 12, 147–170. [Google Scholar] [PubMed]
- Nombela, I.; Ortega-Villaizan, M.D.M. Nucleated red blood cells: Immune cell mediators of the antiviral response. PLoS Pathog. 2018, 14, e1006910. [Google Scholar] [CrossRef] [PubMed]
- Dahle, M.K.; Jorgensen, J.B. Antiviral defense in salmonids—mission made possible? Fish Shellfish Immunol. 2019, 87, 421–437. [Google Scholar] [CrossRef] [PubMed]
- Workenhe, S.T.; Kibenge, M.J.; Wright, G.M.; Wadowska, D.W.; Groman, D.B.; Kibenge, F.S. Infectious salmon anaemia virus replication and induction of alpha interferon in atlantic salmon erythrocytes. Virol. J. 2008, 5, 36. [Google Scholar] [CrossRef] [Green Version]
- Nombela, I.; Puente-Marin, S.; Chico, V.; Villena, A.J.; Carracedo, B.; Ciordia, S.; Mena, M.C.; Mercado, L.; Perez, L.; Coll, J.; et al. Identification of diverse defense mechanisms in rainbow trout red blood cells in response to halted replication of vhs virus. F1000Research 2017, 6, 1958. [Google Scholar] [CrossRef]
- Passantino, L.; Altamura, M.; Cianciotta, A.; Patruno, R.; Tafaro, A.; Jirillo, E.; Passantino, G.F. Fish immunology. I. Binding and engulfment of candida albicans by erythrocytes of rainbow trout (salmo gairdneri richardson). Immunopharmacol. Immunotoxicol. 2002, 24, 665–678. [Google Scholar] [CrossRef]
- Puente-Marin, S.; Thwaite, R.; Mercado, L.; Coll, J.; Roher, N.; Ortega-Villaizan, M.D.M. Fish red blood cells modulate immune genes in response to bacterial inclusion bodies made of tnfalpha and a g-vhsv fragment. Front. Immunol. 2019, 10, 1055. [Google Scholar] [CrossRef]
- Puente-Marin, S.; Nombela, I.; Chico, V.; Ciordia, S.; Mena, M.C.; Coll, J.; Mercado, L.; Ortega-Villaizan, M.D.M. Rainbow trout erythrocytes ex vivo transfection with a DNA vaccine encoding vhsv glycoprotein g induces an antiviral immune response. Front. Immunol. 2018, 9, 2477. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dahle, M.K.; Wessel, O.; Timmerhaus, G.; Nyman, I.B.; Jorgensen, S.M.; Rimstad, E.; Krasnov, A. Transcriptome analyses of atlantic salmon (salmo salar l.) erythrocytes infected with piscine orthoreovirus (prv). Fish Shellfish Immunol. 2015, 45, 780–790. [Google Scholar] [CrossRef] [PubMed]
- Nombela, I.; Requena-Platek, R.; Morales-Lange, B.; Chico, V.; Puente-Marin, S.; Ciordia, S.; Mena, M.C.; Coll, J.; Perez, L.; Mercado, L.; et al. Rainbow trout red blood cells exposed to viral hemorrhagic septicemia virus up-regulate antigen-processing mechanisms and MHC I&II, CD86, and CD83 antigen-presenting cell markers. Cells 2019, 8, 386. [Google Scholar]
- Puente-Marin, S.; Nombela, I.; Ciordia, S.; Mena, M.C.; Chico, V.; Coll, J.; Ortega-Villaizan, M.D.M. In silico functional networks identified in fish nucleated red blood cells by means of transcriptomic and proteomic profiling. Genes 2018, 9, 202. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Morera, D.; Roher, N.; Ribas, L.; Balasch, J.C.; Donate, C.; Callol, A.; Boltana, S.; Roberts, S.; Goetz, G.; Goetz, F.W.; et al. Rna-seq reveals an integrated immune response in nucleated erythrocytes. PLoS ONE 2011, 6, e26998. [Google Scholar] [CrossRef] [Green Version]
- Rodriguez, M.F.; Wiens, G.D.; Purcell, M.K.; Palti, Y. Characterization of toll-like receptor 3 gene in rainbow trout (oncorhynchus mykiss). Immunogenetics 2005, 57, 510–519. [Google Scholar] [CrossRef]
- Nombela, I.; Carrion, A.; Puente-Marin, S.; Chico, V.; Mercado, L.; Perez, L.; Coll, J.; Ortega-Villaizan, M.D.M. Infectious pancreatic necrosis virus triggers antiviral immune response in rainbow trout red blood cells, despite not being infective. F1000Research 2017, 6, 1968. [Google Scholar] [CrossRef]
- Chico, V.; Salvador-Mira, M.E.; Nombela, I.; Puente-Marin, S.; Ciordia, S.; Mena, M.C.; Perez, L.; Coll, J.; Guzman, F.; Encinar, J.A.; et al. Ifit5 participates in the antiviral mechanisms of rainbow trout red blood cells. Front. Immunol. 2019, 10, 613. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Puente-Marin, S.; Nombela, I.; Chico, V.; Ciordia, S.; Mena, M.C.; Perez, L.G.; Coll, J.; Ortega-Villaizan, M.D.M. Potential role of rainbow trout erythrocytes as mediators in the immune response induced by a DNA vaccine in fish. Vaccines 2019, 7, 60. [Google Scholar] [CrossRef] [Green Version]
- Hall, S.S.; Mitragotri, S.; Daugherty, P.S. Identification of peptide ligands facilitating nanoparticle attachment to erythrocytes. Biotechnol. Prog. 2007, 23, 749–754. [Google Scholar] [CrossRef] [PubMed]
- Brown, C.K.; Modzelewski, R.A.; Johnson, C.S.; Wong, M.K. A novel approach for the identification of unique tumor vasculature binding peptides using an e. Coli peptide display library. Ann. Surg. Oncol. 2000, 7, 743–749. [Google Scholar] [CrossRef] [PubMed]
- Trepel, M.; Arap, W.; Pasqualini, R. In vivo phage display and vascular heterogeneity: Implications for targeted medicine. Curr. Opin. Chem. Biol. 2002, 6, 399–404. [Google Scholar] [CrossRef]
- Curtidor, H.; Arévalo, G.; Vanegas, M.; Vizcaíno, C.; Patarroyo, M.A.; Forero, M.; Patarroyo, M.E. Characterization of plasmodium falciparum integral membrane protein pf25-imp and identification of its red blood cell binding sequences inhibiting merozoite invasion in vitro. Protein Sci. 2008, 17, 1494–1504. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, J.; Wu, H.; Hong, J.; Xu, X.; Yang, H.; Wu, B.; Wang, Y.; Zhu, J.; Lai, R.; Jiang, X.; et al. Odorranalectin is a small peptide lectin with potential for drug delivery and targeting. PLoS ONE 2008, 3, e2381. [Google Scholar] [CrossRef] [Green Version]
- Heerze, L.D.; Chong, P.C.; Armstrong, G.D. Investigation of the lectin-like binding domains in pertussis toxin using synthetic peptide sequences. Identification of a sialic acid binding site in the s2 subunit of the toxin. J. Biol. Chem. 1992, 267, 25810–25815. [Google Scholar] [CrossRef]
- Tyrrell, G.J.; Peppler, M.S.; Bonnah, R.A.; Clark, C.G.; Chong, P.; Armstrong, G.D. Lectinlike properties of pertussis toxin. Infect. Immunol. 1989, 57, 1854–1857. [Google Scholar] [CrossRef] [Green Version]
- Xu, X.-C.; Zhang, Z.-W.; Chen, Y.-E.; Yuan, M.; Yuan, S.; Bao, J.-K. Antiviral and antitumor activities of the lectin extracted from aspidistra elatior. Z. Nat. C 2015, 70, 7–13. [Google Scholar] [CrossRef]
- Wang, B.; Godillot, A.P.; Madaio, M.P.; Weiner, D.B.; Williams, W.V. Vaccination against pathogenic cells by DNA inoculation. Curr. Top. Microbiol. Immunol. 1998, 226, 21–35. [Google Scholar]
- Robinson, M.A.; Charlton, S.T.; Garnier, P.; Wang, X.T.; Davis, S.S.; Perkins, A.C.; Frier, M.; Duncan, R.; Savage, T.J.; Wyatt, D.A.; et al. Leapt: Lectin-directed enzyme-activated prodrug therapy. Proc. Natl. Acad. Sci. USA 2004, 101, 14527–14532. [Google Scholar] [CrossRef] [Green Version]
- Brown, G.D.; Gordon, S. Immune recognition. A new receptor for beta-glucans. Nature 2001, 413, 36–37. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.; Luo, Y.; Shibu, M.A.; Toth, I.; Skwarczynskia, M. Cell-penetrating peptides: Efficient vectors for vaccine delivery. Curr. Drug Deliv. 2019, 16, 430–443. [Google Scholar] [CrossRef] [PubMed]
- Sajja, R.K.; Cudic, P.; Cucullo, L. In vitro characterization of odorranalectin for peptide-based drug delivery across the blood–brain barrier. BMC Neurosci. 2019, 20, 22. [Google Scholar] [CrossRef]
- Rashidian, G.; Moosazadeh Moghaddam, M.; Mirnejad, R.; Mohammadi Azad, Z. Supplementation of zebrafish (danio rerio) diet using a short antimicrobial peptide: Evaluation of growth performance, immunomodulatory function, antioxidant activity, and disease resistance. Fish Shellfish Immunol. 2021, 119, 42–50. [Google Scholar] [CrossRef] [PubMed]
- Traub, S.; von Aulock, S.; Hartung, T.; Hermann, C. Mdp and other muropeptides--direct and synergistic effects on the immune system. J. Endotoxin Res. 2006, 12, 69–85. [Google Scholar] [CrossRef] [Green Version]
- Ogawa, C.; Liu, Y.J.; Kobayashi, K.S. Muramyl dipeptide and its derivatives: Peptide adjuvant in immunological disorders and cancer therapy. Curr. Bioact. Compd. 2011, 7, 180–197. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yoo, Y.C.; Yoshimatsu, K.; Koike, Y.; Hatsuse, R.; Yamanishi, K.; Tanishita, O.; Arikawa, J.; Azuma, I. Adjuvant activity of muramyl dipeptide derivatives to enhance immunogenicity of a hantavirus-inactivated vaccine. Vaccine 1998, 16, 216–224. [Google Scholar] [CrossRef]
- Patel, A.; Dong, J.C.; Trost, B.; Richardson, J.S.; Tohme, S.; Babiuk, S.; Kusalik, A.; Kung, S.K.; Kobinger, G.P. Pentamers not found in the universal proteome can enhance antigen specific immune responses and adjuvant vaccines. PLoS ONE 2012, 7, e43802. [Google Scholar] [CrossRef]
- Reyna-Margarita, H.R.; Irais, C.M.; Mario-Alberto, R.G.; Agustina, R.M.; Luis-Benjamin, S.G.; David, P.E. Plant phenolics and lectins as vaccine adjuvants. Curr. Pharm. Biotechnol. 2019, 20, 1236–1243. [Google Scholar] [CrossRef]
- Unitt, J.; Hornigold, D. Plant lectins are novel toll-like receptor agonists. Biochem. Pharmacol. 2011, 81, 1324–1328. [Google Scholar] [CrossRef] [Green Version]
- Wang, M.; Chen, Y.; Zhang, Y.; Zhang, L.; Lu, X.; Chen, Z. Mannan-binding lectin directly interacts with toll-like receptor 4 and suppresses lipopolysaccharide-induced inflammatory cytokine secretion from thp-1 cells. Cell. Mol. Immunol. 2011, 8, 265–275. [Google Scholar] [CrossRef] [Green Version]
- Gun, S.Y.; Claser, C.; Tan, K.S.W.; Rénia, L. Interferons and interferon regulatory factors in malaria. Mediat. Inflamm. 2014, 2014, 243713. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Luna, O.; Gomez, J.; Cárdenas, C.; Albericio, F.; Marshall, S.; Guzmán, F. Deprotection reagents in fmoc solid phase peptide synthesis: Moving away from piperidine? Molecules 2016, 21, 1542. [Google Scholar] [CrossRef]
- Guzmán, F.; Gauna, A.; Luna, O.; Román, T.; Álvarez, C.; Albericio, F.; Cárdenas, C. The tea-bag protocol for comparison of fmoc removal reagents in solid-phase peptide synthesis. Amino Acids 2020, 52, 1201–1205. [Google Scholar] [CrossRef]
- Cárdenas, C.; Guzmán, F.; Carmona, M.; Muñoz, C.; Nilo, L.; Labra, A.; Marshall, S.H. Synthetic peptides as a promising alternative to control viral infections in atlantic salmon. Pathogens 2020, 9, 600. [Google Scholar] [CrossRef] [PubMed]
- Chico, V.; Gomez, N.; Estepa, A.; Perez, L. Rapid detection and quantitation of viral hemorrhagic septicemia virus in experimentally challenged rainbow trout by real-time rt-pcr. J. Virol. Methods 2006, 132, 154–159. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-delta delta c(t)) method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Raida, M.K.; Buchmann, K. Temperature-dependent expression of immune-relevant genes in rainbow trout following yersinia ruckeri vaccination. Dis. Aquat. Org. 2007, 77, 41–52. [Google Scholar] [CrossRef] [PubMed]
- Ortega-Villaizan, M.; Chico, V.; Martinez-Lopez, A.; Falco, A.; Perez, L.; Coll, J.M.; Estepa, A. In vitro analysis of the factors contributing to the antiviral state induced by a plasmid encoding the viral haemorrhagic septicaemia virus glycoprotein g in transfected trout cells. Vaccine 2011, 29, 737–743. [Google Scholar] [CrossRef]
Peptide | Dipole Moment (Debye) | N° of Hydrogen Bond Donors | N° of Hydrogen Bond Acceptors | logP |
---|---|---|---|---|
4341 | 90.132 | 18 | 19 | −1.73 |
4342 | 38.657 | 26 | 24 | −0.55 |
4343 | 42.921 | 11 | 10 | −2.48 |
Name | Peptide Sequence | Length | Source |
---|---|---|---|
4341 | Rhd-LNKKTVVRKI | 10 aas | [43] |
4342 | Rhd-YASPKCFRYPNGVLACT | 17 aas | [44] |
4343 | Rhd-SPYGRC | 6 aas | [45] |
Gene | Forward Primer (5′−3′) | Reverse Primer (5′−3′) | Probe (5′−3′) | Reference or Accession Number |
---|---|---|---|---|
ef1α | ACCCTCCTCTTGGTCGTTTC | TGATGACACCAACAGCAACA | GCTGTGCGTGACATGAGGCA | [67] |
ifit5 | CCCTCAATGACTCTGACAAGCA | CCCTGCCCTCATCTTTCTTCT | CCAGCTTCGGCCTGTTTCTGTTCCA | [38] |
mx1-3 | TGAAGCCCAGGATGAAATGG | TGGCAGGTCGATGAGTGTGA | ACCTCATCAGCCTAGAGATTGGCTCCCC | [68] |
nkef | CGCTGGACTTCACCTTTGTGT | ACCTCACAACCGATCTTCCTAAAC | [28] | |
vig1 | CTACAATCAAGGTGGTGAACAATGT | GTGGAAACAAAAACCGCACTTATA | TCTCAAGCTTCGGCAACTCCAAGCA | [28] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Salvador-Mira, M.; Chico, V.; Arostica, M.; Guzmán, F.; Roher, N.; Perez, L.; Ortega-Villaizan, M.d.M. Immunomodulatory Lectin-like Peptides for Fish Erythrocytes-Targeting as Potential Antiviral Drug Delivery Platforms. Int. J. Mol. Sci. 2021, 22, 11821. https://doi.org/10.3390/ijms222111821
Salvador-Mira M, Chico V, Arostica M, Guzmán F, Roher N, Perez L, Ortega-Villaizan MdM. Immunomodulatory Lectin-like Peptides for Fish Erythrocytes-Targeting as Potential Antiviral Drug Delivery Platforms. International Journal of Molecular Sciences. 2021; 22(21):11821. https://doi.org/10.3390/ijms222111821
Chicago/Turabian StyleSalvador-Mira, Maria, Veronica Chico, Monica Arostica, Fanny Guzmán, Nerea Roher, Luis Perez, and Maria del Mar Ortega-Villaizan. 2021. "Immunomodulatory Lectin-like Peptides for Fish Erythrocytes-Targeting as Potential Antiviral Drug Delivery Platforms" International Journal of Molecular Sciences 22, no. 21: 11821. https://doi.org/10.3390/ijms222111821