Next Article in Journal
Assessing the Residual Stand Damage after Thinning with Different Levels of Mechanization
Next Article in Special Issue
Climate Change Responses of High-Elevation Polylepis Forests
Previous Article in Journal
Ecological Niche Studies on Hylurgus ligniperda and Its Co-Host Stem-Boring Insects
Previous Article in Special Issue
Development of SSR Markers for and Fingerprinting of Walnut Genetic Resources
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Forests
Volume 15
Issue 5
10.3390/f15050793
forests-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Analysis of the Genetic Diversity and Mating System of the Endangered Plant Keteleeria davidiana var. calcarea

by
Xinfeng Pan
,
Huizhen Qin
,
Haidu Jiang
,
Lihui Peng
,
Yishan Yang
,
Jianmin Tang
,
Rong Zou
,
Zongyou Chen
,
Xiao Wei
and
Shengfeng Chai
*
Guangxi Key Laboratory of Plant Functional Phytochemicals and Sustainable Utilization, Guangxi Institute of Botany, Guangxi Zhuang Autonomous Region and Chinese Academy of Sciences, Guilin 541006, China
*
Author to whom correspondence should be addressed.
Forests 2024, 15(5), 793; https://doi.org/10.3390/f15050793
Submission received: 24 February 2024 / Revised: 17 April 2024 / Accepted: 24 April 2024 / Published: 30 April 2024
(This article belongs to the Special Issue Genetic Variation and Adaptation of Forest Trees to Environmental Changes)
Browse Figures
Review Reports Versions Notes

Abstract

:
Keteleeria davidiana var. calcarea is an endangered plant endemic to China. It is mainly distributed in the karst areas of the Guangxi and Guizhou Provinces. It is characterized by small populations and intermittent distribution. This study aimed to explore the genetic diversity and mating system of wild populations of Keteleeria davidiana var. calcarea in fragmented habitats. To achieve this, we genotyped 46 maternal trees and 214 progenies from four fragmented populations of Keteleeria davidiana var. calcarea using nine pairs of microsatellite primers. The genetic diversity of Keteleeria davidiana var. calcarea (Ho = 0.68, He = 0.63) was lower than that of the species overall but higher than that of other Keteleeria plants. The incidence of unbiased expected heterozygosity (uHe) and allelic richness (Ar) was higher in the maternal generation than in the progeny. This suggests that the genetic diversity of the progeny was lower than that of the maternal generation. Keteleeria davidiana var. calcarea is divided into four populations, but there is significant genetic exchange between the populations according to STRUCTURE and gene flow analyses. The multilocus mating system analysis (MLTR) results indicate that the multilocus outcrossing rate (tm) was 0.902, the single-locus outcrossing rate (ts) was 0.606, the bimaternal inbreeding coefficient (tm-ts) was 0.295, and the coefficient of inbreeding depression(δ) was 0.904. These results suggest a certain degree of selfing and inbreeding in Keteleeria davidiana var. calcarea. To prevent problems associated with inbreeding and conserve the genetic diversity of Keteleeria davidiana var. calcarea, we recommend establishing seed gardens, using artificial pollination, and employing asexual propagation techniques for conservation intervention.

1. Introduction

Keteleeria davidiana var. calcarea is a rare and endangered species belonging to the genus Keteleeria in the Pinaceae family. It is a valuable plant resource in China, mainly distributed in the karst and rocky mountains at the junction of Guangxi and Guizhou Provinces [1]. This species is drought-tolerant and excellent for afforestation in limestone mountains. Its hard wood can also be used as timber for building [2]. Keteleeria davidiana var. calcarea has been listed as a second-level key protected wild plant in China due to its weak natural regeneration ability and excessive logging by human beings, which has gradually reduced the habitat area and drastically decreased the population such that it is on the verge of extinction [3,4].
To expedite the effective conservation of wild populations of Keteleeria davidiana var. calcarea, Jiang et al. conducted a study on the effects of various treatments on the seedlings of endangered Keteleeria davidiana var. calcarea cuttings [2]. Jiang et al. examined the seed germination characteristics of Keteleeria davidiana var. calcarea and discovered that the low seed germination rate and the significant influence of environmental factors on seed germination may be two primary reasons for the population’s endangerment [5]. Shi et al. successfully deciphered the complete chloroplast genome sequence of Keteleeria davidiana var. calcarea, filling a gap in the evolutionary and phylogenetic studies at the molecular level [6]. However, there are few studies on genetic diversity and mating systems, and these are crucial for developing conservation management strategies for Keteleeria davidiana var. calcarean [7].
There is a positive correlation between genetic diversity and a species’ ability to adapt to its environment. The more variable the genetic structure, the better the species can adapt to mutations and harsh environments. Furthermore, greater genetic diversity allows for a wider ecological niche and increases the chances of survival when the environment stabilizes. However, some studies show no significant correlation between the ecological niche of a species and its genetic diversity [8]. Studying the genetic diversity of species can provide insights into their evolutionary events and population dynamics and serve as a basis for molecular classification and phylogeny. However, most studies have focused on changes in genetic diversity between populations, with little emphasis on changes across generations [8,9,10]. The genetic monitoring of different generations within populations is crucial for characterizing the developmental status of populations, as changes in the genetic composition of populations depend on generation turnover [11]. The use of simple sequence repeats (SSRs) in studying mating systems in plants provides insight into genotype distribution and population dynamics, including the effective population size, sex ratio, and degree of stochastic mating. This correlation enhances our understanding of genetic diversity within species [12]. Keteleeria davidiana var. calcarea is currently facing population survival problems due to habitat fragmentation. It is difficult for us to assess the degree to which habitat fragmentation has occurred [13]. Fragmentation impacts plant adaptations and mating systems [14]. Therefore, mating results reflect evidence of habitat fragmentation.
Microsatellites, also known as SSRs, are tandem repeat sequences composed of 1–6 base pair repeat units [15,16]. They have been extensively utilized as markers of genetic differences due to their abundance and ease of detection [17]. Several mating systems based on microsatellite technology have been investigated [18]. For example, Sun et al. studied Vitex negundo var. heterophylla using SSR markers and found a mixed mating system that predominantly comprised outcrossing and inbreeding depression [19]. Zhang et al., using 11 pairs of SSR primers, showed that Camellia oleifera “Ruan Zhi” has a high degree of outcrossing [20]. Fuchs et al. found that Chamaedorea tepejilote populations have moderate to high nuclear simple sequence repeat (SSR) genetic diversity, possibly due to their large population size and the use of an outcrossing mating system [21].
SSR markers were utilized to investigate the mating system of the natural population of Keteleeria davidiana var. calcarea. The study aimed to reveal the mating mechanism of the species’ natural population, explore differences in genetic diversity between the maternal tree and progeny, and assist the long-term conservation of the natural population of Keteleeria davidiana var. calcarea.

2. Materials and Methods

2.1. Plant Materials

This study is based on a detailed survey of the natural range of Keteleeria davidiana var. calcarea in 2020 [22]. Samples were collected from four natural populations: Rong’an, Fuchuan, Lingui, and Gongcheng (Table 1, Figure 1). The landscape of the four natural habitats is karst and stony mountains, and all have a subtropical monsoon climate (average temperature 18–19 °C). Soils in the Keteleeria davidiana var. calcarea range are black calcareous, brown calcareous, or loess, which are acidic, neutral, or weakly alkaline. The community is mainly in the well-preserved geomantic forests by the village and roadside, with fragmented distribution and an obvious vertical structure divided into three layers: tree, shrub, and herb. Keteleeria davidiana var. calcarea is the dominant species in the tree layer (Figure S3). There are differences in terms of the number of individuals and population structure in different populations, with both GC and FC populations having over 400 individuals, mainly middle-aged or elderly, and a higher number of fruiting plants. The number of individuals in both the RA and GL populations is under 150. The RA population is mainly composed of middle-aged individuals, while the GL population is mainly composed of small and medium-sized individuals. Both populations have fewer fruiting plants.
The number of fruiting plants of Keteleeria davidiana var. calcarea in the four populations varied greatly. We collected samples of all fruiting plants from the LG and RA populations and balanced the total number of samples through sampling spacing to obtain as many representative samples as possible from the GC and FC populations. We used random sampling and spaced them more than 20 m apart. Five to twenty plants were selected as maternal tree plants in each population according to the actual situation, and seeds were obtained as progeny for planting. One year later, 2–5 progeny plants were selected from each of the 46 maternal trees from the progeny forests, resulting in a total of 214 plants in the progeny population. The blade material was stored at −20 °C for future use.

2.2. Data Analysis

2.2.1. DNA Extraction and SSR-PCR Amplification

The total genomic DNA of the maternal trees and progeny populations was extracted using the magnetic bead method genomic DNA extraction kit from Tiangen Biochemicals, and the concentration and quality were detected using 1% agarose gel electrophoresis. The DNA was then stored at −20 °C for spare use.
Based on the findings of Shi et al. [23] and according to the SSR loci information obtained from the transcriptome sequencing data, 325 pairs of primers were selected for amplification and validation, and 9 pairs of SSR primers with clear bands and high stability were selected. Nine pairs of polymorphic primer results were selected for PCR amplification (Table 2). A PCR amplification reaction was carried out using the TP-M13-SSR technique [24]. A 15 μL system was used for PCR, in which 2 × Taq PCR Master Mix 7.5 μL, mix primer 2.0 μL, DNA template 1 μL (50–200 ng), and ddH20 4.5 μL were used. The PCR amplification procedure was as follows: 96 °C for 3 min (96 °C for 30 s, 56 °C for 1 min, 72 °C for 1 min) for 30 cycles and 72 °C for 10 min. The amplified products were detected for length polymorphism on ABI 3730 XL DNA sequences.

2.2.2. Genetic Diversity Analysis

Using LIZ500 as an internal standard, the fluorescence signal detection results of PCR products were analyzed for peak patterns and allele reading using GeneMarker software version 3.0.1 (available at https://softgenetics.com/information/request-trial/, accessed on 17 May 2019). Subsequently, the genetic diversity was analyzed using FSTAT version 2.9.3.2 [25]. Diversity parameters included the number of alleles (N), average number of alleles (Na), effective number of alleles (Ne), observed heterozygosity (Ho), expected heterozygosity (He), unbiased expected heterozygosity (uHe), and percentage of polymorphism loci (PPL). Allele richness (Ar) was assessed by ADZE. Micro-checker version 2.2.3 software was used to determine the presence of null alleles and to screen for genotyping errors before subjecting the data to statistical analysis. Fixation indices (f) were calculated by GENEPOP to determine each population’s Hardy–Weinberg equilibrium [26]. Additionally, 1000 simulations were performed with FSTAT 2.9.3.2 to detect differences in the aforementioned genetic diversity parameters between mature plants and seeds within each patch, as well as across each life history stage.

2.2.3. Genetic Structure and Gene Flow Analysis

The genetic relationships between populations were analyzed using GenAlEx version 6.5 software to perform the analysis of molecular variance (AMOVA) and principal coordinate analysis (PCoA) based on the genetic distance matrix [27]. The simulations were performed using an “admixture” model for mixed individuals, assuming correlated allelic frequencies. The preliminary analysis involved 20 independent runs of the Markov Monte Carlo chain (MCMC), with 10,000 and 30,000 iterations each, testing for possible numbers of clusters (K) between 1 and 20. The optimal K value was determined using the highest ΔK method in STRUCTURE HARVESTER [28].
GenAlEx version 6.5 was also used to generate values for the genetic differentiation (Fst), gene flow (Nm), Nei’s genetic distance (D), and genetic identity (I). Nm, determined based on Gst, was calculated using the formula Nm = (1 − Gst)/2 Gst. Visualization of the results for Fst, Nm, D, and I used R version 4.3.3. In order to ascertain whether there is a correlation between genetic distance and the geographic distance between pairs of populations, we employed Mantel’s generalized regression procedure [29]. The geographic distance between populations was calculated using the latitude and longitude coordinates.

2.2.4. Mating System Analysis

The mating system parameters were calculated using MLTR [30] version 3.4 software, employing the maximum likelihood estimation method with 1000 bootstrap resamples within a 95% confidence interval. Parameters included the multilocus outcrossing rate (tm), single-locus outcrossing rate (ts), bimaternal inbreeding coefficient (tm-ts), single-locus inbreeding coefficient (F), single-locus paternity correlation (rp(s)), and multilocus paternity correlation (rp(m)). The tm-ts value estimates the level of bimaternal inbreeding, with higher values indicating closer kinship between maternal individuals; rp estimates the paternal correlation, representing the proportion of full-sibs (i.e., outcrossed progeny sharing the same father) within a family. The average effective number of pollen donors Nep = 1/rp(m) and the coefficient of inbreeding depression (δ) was estimated using tm and F values, δ = 1 − 2Ftm/(1 − tm)(1 − F). Descriptive statistical values are expressed as the mean (standard deviation) [31]. F is the single-locus inbreeding coefficient, and tm is the multilocus outcrossing rate.

3. Results

3.1. Genetic Diversity

Nine pairs of microsatellite primers amplified 48 alleles (N) ranging from 2 to 11 in each of the four wild populations of Keteleeria davidiana var. calcarea, with an average of 5.33 alleles per locus (Table 3). The maternal trees and progeny in the four wild populations had moderate genetic diversity, with the total number of alleles ranging from 22 to 40 in the maternal trees and 24 to 48 in the progeny. The null allele frequencies estimated by Micro-checker (Table S1) were relatively high (over 0.10) in the P56 loci, but null allele frequencies at the P56 locus did not show differences at the population level.
Nine microsatellite loci (Table 3) showed that a total of 112 individual alleles (Na) were detected in the maternal population, an average of 12.44 per locus; 144 Na were detected in the progeny population, an average of 16 per locus. The mean values of the effective number of alleles (Ne) and the fixation index (f) mean values were 3.11 and 0.05, respectively; the Ne and f mean values of the progeny of the four habitats were 4.00 and 0.17, respectively; and the percent polymorphic loci (PPL) of the maternal trees and progeny were 86.11% and 94.44%. In addition, the mean values of observed heterozygosity (Ho) and expected heterozygosity (He) of the maternal trees were 0.38 and 0.41, respectively, and the mean values of Ho and He of the progeny were 0.35 and 0.41, respectively (Table 4). Due to the large difference in the number of samples in the population, there was unbiased expected heterozygosity (uHe) with allelic richness (Ar), and the mean values of uHe and Ar were 0.435 and 2.099, respectively, while the mean values of uHe and Ar of the progeny were 0.427 and 2.049, respectively. The f of the progeny and the maternal trees were both greater than 0, and the value for the progeny was higher than for the maternal trees. This indicates an excess of homozygous in both the progeny and the maternal trees and the fact that inbreeding is occurring to stabilize the populations. The uHe and Ar values of the progeny of the four wild populations of Keteleeria davidiana var. calcarea were lower than those of the maternal trees, which shows that the genetic diversity of the progeny was lower.

3.2. Genetic Structure

Principal coordinate analysis (PCoA) of the genetic distances of 260 samples from four populations of Keteleeria davidiana var. calcarea was performed (Figure 2A). PC1 and PC2 explained 13.87% and 23.68% of the variation, respectively. The GC population is independent of the LG, RA, and FC populations. The UPGMA were similar to the PCoA results (Figure 2A and Figure S1). Using the online tool STRUCTURE HARVESTER, we calculated the optimal Delta K value (i.e., the optimal population stratification scenario). Extreme values occurred at K = 2 (Figure 2B). At K = 2, all samples were categorized into two subgroups, with orange representing the first subgroup and blue representing the second subgroup. The orange subgroup included LG, RA, and FC, and the blue subgroup only included GC (Figure 2C). Meanwhile, an admixture of different populations in the genetic structure suggested the presence of interspecific gene flow (Figure 3).

3.3. Genetic Differentiation and Gene Flow

The population genetic differentiation coefficient was greatest between RA and LG (Fst = 0.16), and it is noteworthy that the genetic differentiation coefficients between LG and the other two populations were all greater than 0.1 (LG vs. FC, Fst = 0.12; LG vs. GC, Fst = 0.14), with the remaining three populations less than 0.1 from each other (Figure 3A). Correspondingly, the three populations, RA, FC, and GC, had gene flow greater than 2.5 with each other, with FC having the largest gene flow value with GC (Nm = 3.33). Gene flow between LG and the other three was less than 2 (Figure 3A). In terms of Nei’s genetic distance, LG was greater than 0.25 with the other three populations, with less than 0.2 between the other three populations (Figure 3B). In terms of genetic identity, LG was less than 0.76 with the other three populations and greater than 0.8 between the other three populations (Figure 3B). Based on Mantel analyses, there was no linear relationship between geographic and genetic distance (p > 0.05) (Figure S2).
The analysis of molecular variance (AMOVA) of Keteleeria davidiana var. calcarea populations shows that 59.310% of the genetic variation occurred within the individual, 25.120% between individuals, and 15.570% between populations (Table S2). The AMOVA results indicate that the genetic variation of Keteleeria davidiana var. calcarea populations was mainly at the within-individual level.

3.4. Mating System

Table 5 shows that, at the species level, the mating system parameters of Keteleeria davidiana var. calcarea were (multilocus outcrossing rate (tm)) 0.902 (0.025) and (single-locus outcrossing rate (ts)) 0.606 (0.035). Therefore, the percentage of selfing (1-tm) was 0.098. The bimaternal inbreeding coefficient was 0.295 (0.028). The multilocus correlation of paternity (rp(m)) was 0.490 (0.057). The above indicators suggest that Keteleeria davidiana var. calcarea has some degree of inbreeding and self-crossing at the species level. The coefficient of inbreeding depression (δ) and effective number of pollen donors (Nep) were 2.04 and 0.967, respectively, indicating the presence of inbreeding decline in Keteleeria davidiana var. calcarea.
At the population level, the tm values of LG and RA were greater than or equal to 1 and higher than FC and GC, indicating that self-crossing was only found in FC and GC. The tm-ts values varied considerably between populations, ranging from 0.082 to 0.275. The tm-ts values of LG were smaller than in the other three populations, suggesting that mating among relatives is occurring in the RA, FC, and GC populations. LG (15.38) and RA (23.25) were higher than FC (1.71) and GC (5.20) in Nep. According to δ, FC (1.02) and GC (1.04) showed inbreeding depression except for RA (−0.057) and LG (0).

4. Discussion

4.1. Genetic Diversity

Keteleeria davidiana var. calcarea exhibits lower genetic diversity compared to more widespread plants (Ho = 0.68, He = 0.63) and similar levels of diversity to endemic plants (Ho = 0.42, He = 0.32) [32]. The distribution range of Keteleeria is narrow, and the genetic diversity is closely related to its distribution range [33]. Keteleeria davidiana var. calcarea has a high level of genetic diversity (Ho = 0.340, He = 0.420) compared to other Keteleeria plants (Keteleeria davidiana var. formosana (Ho = 0.100, He = 0.075) [33] and Keteleeria evelyniana (He = 0.418) [34]), which indicates that Keteleeria davidiana var. calcarea is more capable of adapting to its environment and has a higher evolutionary potential. Therefore, its endangerment is not caused by internal factors of low genetic diversity. The presence of 32 distinct alleles in the progeny may be attributed to unsampled adults in the population, new allele forms being introduced from neighboring populations, or gene flow from other sources. Similar observations have been reported in studies of Acrocomia aculeata [35] and Butia eriospatha [36].
The detailed analysis and comparison of the genetic diversity of the maternal trees and progeny reveal that, while both He and Ne were lower than in the progeny, Ho, Ar, and uHe were higher than in the progeny. This suggests that, even in the presence of gene flow and unsampled maternal trees [19,37], there is still a downward trend in the genetic diversity of Keteleeria davidiana var. calcarea. The primary reason for this may be that many of the naturally regenerating progeny come from the same maternal trees, resulting in inbreeding. This phenomenon has also been observed in other endangered plants. For example, Lu et al. found higher genetic diversity in adult trees than in seedlings of both the mangrove species, Rhizophora apiculata and Avicennia marina [38]. Compared with the decline of 14.59% Ho in Vatica guangxiensis, the decline in genetic diversity of Keteleeria davidiana var. calcarea is not serious but still worthy of concern [39].
The genetic diversity of the progeny was lower than that of the maternal trees. Furthermore, the f of the progeny was higher than that of the maternal trees, and both the progeny and maternal trees had an f value greater than 0. These results clearly indicate that the progeny were more severely self-crossing or inbreeding compared to the maternal trees. Related research suggests that self-crossing and inbreeding are effective strategies to increase the plant population in the context of habitat fragmentation and limited wind pollination [40,41]. An f value greater than 0 also indicates that heterozygote deficiency is prevalent in Keteleeria davidiana var. calcarea. This is due to some degree of inbreeding decline and genetic drift, which, in turn, leads to reduced genetic diversity [42,43]. In order to further investigate the differences in genetic diversity between genetic progeny and maternal trees, the mating system should be analyzed.

4.2. Gene Flow and Gene Structure

Wind pollination has been demonstrated in Castanopsis sclerophylla and Corylus mandshurica to maintain high genetic diversity and gene flow and to prevent population differentiation in plants subjected to habitat fragmentation [44,45]. A thorough analysis of genetic variation and genetic structure is crucial for uncovering genetic traits and comprehending evolutionary history. Additionally, it serves as a valuable resource for developing conservation policies for Keteleeria davidiana var. calcarea. The sample variation between populations in this study was small, and the AMOVA results detected 15.570% genetic variation between populations (Table S2). Keteleeria davidiana var. calcarea, as a wind pollinator, has a longer pollination distance relative to animal pollinators, which may be related to its lower genetic variance. Shih et al. also reported low genetic variation variability in K. davidiana var. formosana from Taiwan [33]. The gene structure was not completely differentiated according to population, and results matching the gene structure appeared in the cluster analysis of the evolutionary tree. This could mean that there is a more frequent exchange of genes between populations or that populations have experienced similar selective pressures and environmental influences, resulting in similar genetic traits. It is also likely that the species has historically had a large distribution area, with more extensive gene flow between populations [46,47]. The progeny were closely related, which would ultimately lead to a decrease in genetic diversity. Similar results were also found in a study of Vatica guangxiensis [39].
In this study, LG was found to have larger Fst and Nei’s genetic distance values and smaller Nm and genetic identity than those corresponding to the other three populations. This may be due to the fact that there is less gene exchange between this population and the other three populations, resulting in a higher degree of genetic differentiation. This may be caused by factors such as geographical isolation, selection pressure, and differences in biological behavior that limit gene flow [48,49]. These factors may prevent gene exchange between different populations, thus increasing genetic differentiation. After excluding the effect of geographical distance (Figure S2), LG was found to differ from other populations in the height of elevation. It is hypothesized that the lower elevation of Keteleeria davidiana var. calcarea, a wind-pollinated species, may have formed a natural barrier to LG, limiting gene flow and leading to greater genetic differentiation from the other three populations. The genetic diversity of LG populations and their corresponding conservation are important.

4.3. Mating System

Unfortunately, there have been no systematic studies on the reproductive strategies of Keteleeria davidiana var. calcarea. This study found that Keteleeria davidiana var. calcarea had a high multilocus outcrossing rate at the population level (tm = 0.902), but it was lower than other species in the Pinaceae family, such as Cedrus libani A. Rich (tm = 0.940) [50] and Pinus sylvestris L. (tm = 0.998) [51]. This suggests that Keteleeria davidiana var. calcarea is a mixed mating system dominated by outcrossing, but 1-tm = 0.098 and tm-ts = 0.295 > 0, suggesting that there is a degree of selfing and inbreeding. The degree of self-crossing (or inbreeding) is influenced by population size and habitat fragmentation. The spatial genetic structure (SGS) is an important reason for the generation of mating systems [52]. The SGS is caused by seed dispersal around fruiting maternal trees, which results in the relatedness of nearby individuals. This phenomenon has been characterized in Acrocomia aculeata [53,54]. FC and GC had higher tm-ts values and smaller tm and had more plants in the habitat than RA and LG. Therefore, it was hypothesized that the SGS may have some relationship with the population size of Keteleeria davidiana var. calcarea. There are similar findings in Dipteryx alata vogel: low population density resulted in lower levels of outcrossing and mating among relatives but longer pollen dispersal distances. In contrast, higher-density populations showed higher levels of outcrossing, more mating among relatives, and shorter pollen dispersal distances [55].
The diversity of pollen found in progeny is described by the multilocus correlation of paternity (rp(m)) [30]. This correlation measures the probability that two individuals taken at random from the same matrix are full siblings. Keteleeria davidiana var. calcarea had a higher value of multilocus correlation, which suggests that the progeny derived from crosses with several closely related pollen donors. Among the four populations, FC and GC had higher rp(m) values, and Nep values were also the highest among the populations. This result is most likely related to fewer Nep. In the study of the habitat and population structure of Keteleeria davidiana var. calcarea forests, both populations of FC and GC were characterized by a high number of middle-aged and old-aged individuals, a low number of seedlings and young trees, and a declining population trend, which matches the results of our mating system. Similar results were found in Euterpe precatoria and Ormosia hosiei [56,57]. Therefore, for the conservation of FC and GC populations, captive breeding may be necessary.
This study detected inbreeding depression at the species level in Keteleeria davidiana var. calcarea (δ = 0.96 > 0). Many rare and endangered species use inbreeding to increase the number of individuals in their progeny in order to prevent extinction under harsh environmental conditions [58,59,60]. For plants, inbreeding can improve the adaptability of populations to fragmented habitats and mitigate the effects of insufficient numbers of pollination patterns. However, inbreeding leads to a loss of genetic diversity and, ultimately, worsens survival and development [61,62]. Prolonged inbreeding is capable of causing inbreeding depression, thereby making progeny vulnerable to extinction in the face of environmental fluctuations. The presence of a certain degree of inbreeding depression in the mating system may, therefore, be an important factor in the endangerment of Keteleeria davidiana var. Calcarea.

5. Conclusions

The results of the SSR-based genetic diversity detection show that Keteleeria davidiana var. calcarea had high genetic diversity in Keteleeria plants. However, the progeny exhibited a decreasing trend in genetic diversity when compared to the maternal trees. This suggests that, while wind-pollinated species can tolerate some environmental and anthropogenic influences, excessive habitat fragmentation still has a negative impact on genetic diversity. Analyzing the reasons for the decline in genetic diversity, we found that self-crossing and inbreeding depression existed at the species level and in the mating system of Keteleeria davidiana var. calcarea. Therefore, it is possible that excessive habitat fragmentation has caused self-crossing and inbreeding depression in Keteleeria davidiana var. calcarea, resulting in a decrease in genetic diversity.
To conserve the genetic diversity of Keteleeria davidiana var. calcarea, it is important to take measures, such as manually selecting different maternal trees to avoid inbreeding during pollination. This task involves establishing seed gardens and collecting seeds from different populations for artificial propagation. Additionally, asexual propagation technology for Keteleeria davidiana var. calcarea should be developed to rescue the population.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/f15050793/s1, Figure S1: Deprogram of UPGMA cluster analysis base on Nei’s genetic distance between four populations; Figure S2: Linear regression analysis of genetic distance versus geographic distance. R2, coefficient of determination; Figure S3: Plant and habitat conditions of Keteleeria davidiana var. Calcarea. (A) Photographs of Keteleeria davidiana var. calcarea plants. (B) Photographs of Keteleeria davidiana var. calcarea habitat. Table S1: The null allele frequencies estimated by Micro-checker; Table S2: Analysis of coefficients of variation for individuals and populations; degree of freedom; SS, sum of squares; MS, mean square; Est. Var, estimate of variance; %, percentage of total variation based on 999 permutations.

Author Contributions

Conceptualization, X.P., H.Q. and S.C.; methodology, X.P. and H.J.; software, Y.Y. and J.T.; validation, R.Z.; formal analysis, X.P. and Z.C.; investigation, S.C.; resources, L.P.; data curation, X.P.; writing—original draft preparation, X.P. and S.C.; writing—review and editing, X.P.; visualization, X.P. and S.C.; supervision, S.C.; project administration, X.P. and S.C.; funding acquisition, X.W. and S.C. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Key Research and Development Program (2022YFF1300700), Guangxi Natural Science Foundation (2018GXNSFAA281015), and Guangxi Forestry Science and Technology Promotion Demonstration Project (2023LYKJ03 and [2022]GT23).

Data Availability Statement

Data are contained within the article.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Huang, L. Keteleeria calcarea cheng et lkfua valuable tree for afforesting the limestone hills. Guihaia 1982, 2, 103–104. (In Chinese) [Google Scholar]
  2. Jiang, B.; Wen, G.; Tang, Y.; Jiang, Q. Effects of different treatments on cuttage cultivation and growth of Keteleeria calcarea. Guihaia 2008, 4, 549–552. (In Chinese) [Google Scholar]
  3. State Forestry and Grassland Administration of China. National Forestry and Grassland Administration, Ministry of Agriculture and Rural Affairs (No. 15, 2021). List. State Key Prot. Wild Plants 2021, 15, 1–18. (In Chinese) [Google Scholar]
  4. Lu, Z.; Qin, H.; Jin, X.; Zhang, Z.; Yang, Q.; Hong, D.; Li, D.; Li, K.; Yuan, L.; Zhou, Z.; et al. On the Necessity, Principle, and Process of Updating the List of National Key Protected Wild Plants. Biodivers. Sci. 2021, 29, 1577–1582. [Google Scholar] [CrossRef]
  5. Jiang, H.; Xie, W.; Chai, S.; Tang, J.; Jiang, Y.; Qin, H.; Wei, X. Seed germination characteristics of Keteleeria calcarea, a precious tree species in karst area. Guihaia 2022, 42, 951–960. (In Chinese) [Google Scholar] [CrossRef]
  6. Li, J.; Cheng, N.; Shi, Y. The Complete Chloroplast Genome of Keteleeria Davidiana Var. Calcarea (Pinaceae), an Endangered Species Endemic to China. Mitochondrial DNA Part B 2021, 6, 693–695. [Google Scholar] [CrossRef] [PubMed]
  7. Xie, W.; Chai, S.; Jiang, Y.; Tang, J.; Chen, Z.; Zou, R.; Wei, X. ISSR analysis on genetic diversity of Keteleeria calcarea. Guihaia 2017, 37, 36–41. (In Chinese) [Google Scholar] [CrossRef]
  8. Zhou, Q.; Wang, G.; Li, Y. Analysis of the Conservation Status, Genetic Diversity and Population Structure of Endangered Ostrya Rehderiana Resources Using SSR Markers. Forests 2023, 14, 1519. [Google Scholar] [CrossRef]
  9. Liesebach, H.; Schneck, D. Flowering Behavior of Clones in a Norway Maple (Acer platanoides) Seed Orchard and Mating System Analysis Using Nuclear SSR Markers. Eur. J. For. Res. 2022, 141, 561–569. [Google Scholar] [CrossRef]
  10. Imai, R.; Tsuda, Y.; Matsumoto, S.; Ebihara, A.; Watano, Y. The Relationship between Mating System and Genetic Diversity in Diploid Sexual Populations of Cyrtomium falcatum in Japan. PLoS ONE 2016, 11, e0163683. [Google Scholar] [CrossRef]
  11. Yuanyuan, L.; Chaonan, L.; Rong, W.; Shuixing, L.; Shouqian, N.; Jingwen, W.; Xiaoyong, C. Applications of molecular markers in conserving endangered species. Biodivers. Sci. 2020, 28, 367–375. (In Chinese) [Google Scholar] [CrossRef]
  12. Neel, M.C. Conservation Implications of the Reproductive Ecology of Agalinis acuta (Scrophulariaceae). Am. J. Bot. 2002, 89, 972–980. [Google Scholar] [CrossRef] [PubMed]
  13. Young, A.; Boyle, T.; Brown, T. The Population Genetic Consequences of Habitat Fragmentation for Plants. Trends Ecol. Evol. 1996, 11, 413–418. [Google Scholar] [CrossRef] [PubMed]
  14. Seltmann, P.; Cocucci, A.; Renison, D.; Cierjacks, A.; Hensen, I. Mating System, Outcrossing Distance Effects and Pollen Availability in the Wind-Pollinated Treeline Species Polylepis australis BITT. (Rosaceae). Basic Appl. Ecol. 2009, 10, 52–60. [Google Scholar] [CrossRef]
  15. van Belkum, A.; Scherer, S.; van Alphen, L.; Verbrugh, H. Short-Sequence DNA Repeats in Prokaryotic Genomes. Microbiol. Mol. Biol. Rev. MMBR 1998, 62, 275–293. [Google Scholar] [CrossRef] [PubMed]
  16. Li, Y.; Korol, A.B.; Fahima, T.; Beiles, A.; Nevo, E. Microsatellites: Genomic Distribution, Putative Functions and Mutational Mechanisms: A Review. Mol. Ecol. 2002, 11, 2453–2465. [Google Scholar] [CrossRef] [PubMed]
  17. Li, Y.-C.; Korol, A.B.; Fahima, T.; Nevo, E. Microsatellites within Genes: Structure, Function, and Evolution. Mol. Biol. Evol. 2004, 21, 991–1007. [Google Scholar] [CrossRef] [PubMed]
  18. Agarwal, M.; Shrivastava, N.; Padh, H. Advances in Molecular Marker Techniques and Their Applications in Plant Sciences. Plant Cell Rep. 2008, 27, 617–631. [Google Scholar] [CrossRef] [PubMed]
  19. Sun, X.; Wang, F.; Cui, R.; Liu, X.; Li, X.; Dong, J.; Sun, L.; Qin, S.; Wang, R.; Zheng, P.; et al. Studies on Reproductive Strategies of Vitex negundo L. Var. Heterophylla (Franch.) Rehder (Lamiaceae) Based on Morphological Characteristics and SSR Markers. Ecol. Evol. 2020, 10, 5270–5280. [Google Scholar] [CrossRef]
  20. Zhang, Z.; Meng, J.; Pan, D.; Yang, C.; Li, Y. Mating System and Progeny Genetic Diversity of Camellia Oleifera ‘Ruan Zhi’. J. For. Res. 2019, 30, 1805–1810. [Google Scholar] [CrossRef]
  21. Fuchs, E.J.; Cascante-Marín, A.; Madrigal-Brenes, R.; Quesada, M. Genetic Diversity and Phylogeographic Patterns of the Dioecious Palm Chamaedorea tepejilote (Arecaceae) in Costa Rica: The Role of Mountain Ranges and Possible Refugia. AoB PLANTS 2023, 15, plac060. [Google Scholar] [CrossRef] [PubMed]
  22. Jiang, H.; Chai, S.; Tang, J.; Jiang, Y.; Wei, X. Habitat Condition and Population Structure Characteristics of Keteleeria calcarea Forest in Karst Area of Guangxi. J. Guangxi Acad. Sci. 2020, 36, 56–64. [Google Scholar] [CrossRef]
  23. Shi, Y.; Lai, I.; Wang, X.; Qin, H.; Chai, S. Development of EST-SSR Primers in Keteleeria calcarea Based on Tran- scriptome Sequencing. Mol. Plant Breed. 2024, 22, 2257–2264. (In Chinese) [Google Scholar]
  24. Schuelke, M. An Economic Method for the Fluorescent Labeling of PCR Fragments. Nat. Biotechnol. 2000, 18, 233–234. [Google Scholar] [CrossRef] [PubMed]
  25. Goudet, J.-M. FSTAT, a Program to Estimate and Test Gene Diversities and Fixation Indices (Version 2.9.3). 2001. Available online: https://www2.unil.ch/popgen/softwares/fstat.htm (accessed on 23 February 2024).
  26. Rousset, F. Genepop’007: A Complete Re-Implementation of the Genepop Software for Windows and Linux. Mol. Ecol. Resour. 2008, 8, 103–106. [Google Scholar] [CrossRef] [PubMed]
  27. Peakall, R.; Smouse, P.E. GenAlEx 6.5: Genetic Analysis in Excel. Population Genetic Software for Teaching and Research–an Update. Bioinform. Oxf. Engl. 2012, 28, 2537–2539. [Google Scholar] [CrossRef]
  28. Earl, D.A.; vonHoldt, B.M. STRUCTURE HARVESTER: A Website and Program for Visualizing STRUCTURE Output and Implementing the Evanno Method. Conserv. Genet. Resour. 2011, 4, 359–361. [Google Scholar] [CrossRef]
  29. Diniz-Filho, J.A.F.; Soares, T.N.; Lima, J.S.; Dobrovolski, R.; Landeiro, V.L.; de Campos Telles, M.P.; Rangel, T.F.; Bini, L.M. Mantel Test in Population Genetics. Genet. Mol. Biol. 2013, 36, 475–485. [Google Scholar] [CrossRef] [PubMed]
  30. Ritland, K. Extensions of Models for the Estimation of Mating Systems Using n Independent Loci. Heredity 2002, 88, 221–228. [Google Scholar] [CrossRef]
  31. Ritland, K. A Series of FORTRAN Computer Programs for Estimating Plant Mating Systems. J. Hered. 1990, 81, 236–237. [Google Scholar] [CrossRef]
  32. Kaljund, K.; Jaaska, V. No Loss of Genetic Diversity in Small and Isolated Populations of Medicago sativa Subsp. Falcata. Biochem. Syst. Ecol. 2010, 38, 510–520. [Google Scholar] [CrossRef]
  33. Shih, K.-M.; Chang, C.-T.; Chung, J.-D.; Chiang, Y.-C.; Hwang, S.-Y. Adaptive Genetic Divergence Despite Significant Isolation-by-Distance in Populations of Taiwan Cow-Tail Fir (Keteleeria davidiana Var. Formosana). Front. Plant Sci. 2018, 9, 92. [Google Scholar] [CrossRef]
  34. Lieu, T.T.; Phong, D.T.; Hien, V.T.T. Genetic diversity among natural populations of Keteleeria evelyniana mast. in central higlands of vietnam using ssr markers. Vietnam J. Sci. Technol. 2018, 56, 275. [Google Scholar] [CrossRef]
  35. Lanes, É.C.M.; Motoike, S.Y.; Kuki, K.N.; Resende, M.D.V.; Caixeta, E.T. Mating System and Genetic Composition of the Macaw Palm (Acrocomia aculeata): Implications for Breeding and Genetic Conservation Programs. J. Hered. 2016, 107, 527–536. [Google Scholar] [CrossRef] [PubMed]
  36. Nazareno, A.G.; dos Reis, M.S. At Risk of Population Decline? An Ecological and Genetic Approach to the Threatened Palm Species Butia eriospatha (Arecaceae) of Southern Brazil. J. Hered. 2013, 105, 120–129. [Google Scholar] [CrossRef]
  37. Hu, X.-S. Mating System as a Barrier to Gene Flow: Mating system and isolating barrier. Evolution 2015, 69, 1158–1177. [Google Scholar] [CrossRef] [PubMed]
  38. Lu, W.; Zou, Z.; Hu, X.; Yang, S. Genetic Diversity and Mating System of Two Mangrove Species (Rhizophora apiculata and Avicennia marina) in a Heavily Disturbed Area of China. Diversity 2022, 14, 115. [Google Scholar] [CrossRef]
  39. Zhu, X.; Zou, R.; Tang, J.; Deng, L.; Wei, X. Genetic Diversity Variation during the Natural Regeneration of Vatica Guangxiensis, an Endangered Tree Species with Extremely Small Populations. Glob. Ecol. Conserv. 2023, 42, e02400. [Google Scholar] [CrossRef]
  40. Reed, D.H.; Frankham, R. Correlation between Fitness and Genetic Diversity. Conserv. Biol. 2003, 17, 230–237. [Google Scholar] [CrossRef]
  41. Dillon, R.; Coates, D.; Standish, R.; Monks, L.; Waycott, M. Assessing Plant Translocation Success: Common Metrics Mask High Levels of Inbreeding in a Recently Established Banksia brownii (Proteaceae) Population. Aust. J. Bot. 2023, 71, 79–92. [Google Scholar] [CrossRef]
  42. Leimu, R.; Mutikainen, P.; Koricheva, J.; Fischer, M. How General Are Positive Relationships between Plant Population Size, Fitness and Genetic Variation? J. Ecol. 2006, 94, 942–952. [Google Scholar] [CrossRef]
  43. Charlesworth, B.; Charlesworth, D. The Genetic Basis of Inbreeding Depression. Genet. Res. 1999, 74, 329–340. [Google Scholar] [CrossRef] [PubMed]
  44. Wang, R.; Compton, S.G.; Chen, X.-Y. Fragmentation Can Increase Spatial Genetic Structure without Decreasing Pollen-Mediated Gene Flow in a Wind-Pollinated Tree: Spatial genetic structure of castanopsis. Mol. Ecol. 2011, 20, 4421–4432. [Google Scholar] [CrossRef] [PubMed]
  45. Zong, J.-W.; Zhao, T.-T.; Ma, Q.-H.; Liang, L.-S.; Wang, G.-X. Assessment of Genetic Diversity and Population Genetic Structure of Corylus mandshurica in China Using SSR Markers. PLoS ONE 2015, 10, e0137528. [Google Scholar] [CrossRef] [PubMed]
  46. Dafni, A.; Tzohari, H.; Ben-Shlomo, R.; Vereecken, N.J.; Ne’eman, G. Flower Colour Polymorphism, Pollination Modes, Breeding System and Gene Flow in Anemone coronaria. Plants 2020, 9, 397. [Google Scholar] [CrossRef] [PubMed]
  47. Escudero, M.; Vargas, P.; Valcárcel, V.; Luceño, M. Strait of Gibraltar: An Effective Gene-flow Barrier for Wind-pollinated Carex helodes (Cyperaceae) as Revealed by DNA Sequences, AFLP, and Cytogenetic Variation. Am. J. Bot. 2008, 95, 745–755. [Google Scholar] [CrossRef]
  48. Lenormand, T. Gene Flow and the Limits to Natural Selection. Trends Ecol. Amp Evol. 2002, 17, 183–189. [Google Scholar] [CrossRef]
  49. Sexton, J.P.; Hangartner, S.B.; Hoffmann, A.A. Genetic Isolation by Environment or Distance: Which Pattern of Gene Flow Is Most Common? Evol. Int. J. Org. Evol. 2014, 68, 1–15. [Google Scholar] [CrossRef]
  50. BïLgen, B.B.; Kurt, Y.; Kaya, N. Mating System in Natural Populations of Taurus Cedar (Cedrus libani A.Rich.). Turk. J. Agric. For. 2012, 36, 379–387. [Google Scholar] [CrossRef]
  51. Burczyk, J. Mating System Variation in a Scots Pine Clonal Seed Orchard. Silvae Genet. 1998, 47, 155–158. [Google Scholar]
  52. Ritland, K. The Genetic-Mating Structure of Subdivided Populations II. Correlated Mating Models. Theor. Popul. Biol. 1988, 34, 320–346. [Google Scholar] [CrossRef]
  53. Vinson, C.C.; Mangaravite, E.; Sebbenn, A.M.; Lander, T.A. Using Molecular Markers to Investigate Genetic Diversity, Mating System and Gene Flow of Neotropical Trees. Braz. J. Bot. 2018, 41, 481–496. [Google Scholar] [CrossRef]
  54. Díaz-Hernández, B.G.; Colombo, C.A.; Morales-Marroquín, J.A.; Sanitá-Rodrigues, M.; Azevedo-Filho, J.A.; Zucchi, M.I. Assessing the Genetic Vulnerability of Macaúba Palm [Acrocomia aculeata (Jacq.) Lodd. ex Mart.] through the Mating System and Genetic Diversity of Open-pollinated Progenies. Ann. Appl. Biol. 2023, 184, 238–249. [Google Scholar] [CrossRef]
  55. Tambarussi, E.V.; Sebbenn, A.M.; Alves-Pereira, A.; Vencovsky, R.; Cambuim, J.; Da Silva, A.; Moraes, M.; De Moraes, M.L.T. Dipteryx alata Vogel (Fabaceae) a Neotropical Tree with High Level of Selfing: Implication for Conservation and Breeding Programs. Ann. For. Res. 2017, 60, 243–261. [Google Scholar] [CrossRef]
  56. Perrut-Lima, P.; Sebbenn, A.M.; Francisconi, A.F.; Picanço-Rodrigues, D.; Clement, C.R. Genetic Diversity and Mating System of Euterpe precatoria in Three Localities along the Lower Solimões River in Central Amazonia. Silvae Genet. 2023, 72, 81–91. [Google Scholar] [CrossRef]
  57. Li, F.; Chen, H.; Liu, S.; Zhang, H.; Zhou, Z. Mating Systems of Single Families and Population Genetic Diversity of Endangered Ormosia hosiei in South China. Genes 2022, 13, 2117. [Google Scholar] [CrossRef] [PubMed]
  58. Liu, Y.; Wang, H.; Yang, J.; Dao, Z.; Sun, W. Conservation Genetics and Potential Geographic Distribution Modeling of Corybas taliensis, a Small “sky Island” Orchid Species in China. BMC Plant Biol. 2024, 24, 11. [Google Scholar] [CrossRef] [PubMed]
  59. Price, J.H.; Brandvain, Y.; Smith, K.P. Measurements of Lethal and Nonlethal Inbreeding Depression Inform the de Novo Domestication of Silphium integrifolium. Am. J. Bot. 2021, 108, 980–992. [Google Scholar] [CrossRef]
  60. Andersson, S.; Waldmann, P. Inbreeding Depression in a Rare Plant, Scabiosa canescens (Dipsacaceae). Hereditas 2002, 136, 207–211. [Google Scholar] [CrossRef]
  61. Lloyd, M.W.; Tumas, H.R.; Neel, M.C. Limited Pollen Dispersal, Small Genetic Neighborhoods, and Bimaternalal Inbreeding in Vallisneria americana. Am. J. Bot. 2018, 105, 227–240. [Google Scholar] [CrossRef]
  62. Almeida-Rocha, J.M.; Soares, L.A.S.S.; Andrade, E.R.; Gaiotto, F.A.; Cazetta, E. The Impact of Anthropogenic Disturbances on the Genetic Diversity of Terrestrial Species: A Global Meta-Analysis. Mol. Ecol. 2020, 29, 4812–4822. [Google Scholar] [CrossRef] [PubMed]
Forests 15 00793 g001
Figure 1. Sampling locations of Keteleeria davidiana var. calcarea. Different shapes represent populations in different locations: pentagram refers to LG; triangle refers to RA; square refers to FC; round refers to RA.
Figure 1. Sampling locations of Keteleeria davidiana var. calcarea. Different shapes represent populations in different locations: pentagram refers to LG; triangle refers to RA; square refers to FC; round refers to RA.
Forests 15 00793 g001
Forests 15 00793 g002
Figure 2. Genetic structures of Keteleeria davidiana var. calcarea. (A) Principal coordinate analysis (PCoA) plot generated for the SSR data. (B) Delta K for K = 1–20. (C) Genetic structure bar plots at K = 2.
Figure 2. Genetic structures of Keteleeria davidiana var. calcarea. (A) Principal coordinate analysis (PCoA) plot generated for the SSR data. (B) Delta K for K = 1–20. (C) Genetic structure bar plots at K = 2.
Forests 15 00793 g002
Forests 15 00793 g003
Figure 3. Genetic differentiation (Fst), gene flow (Nm), Nei’s genetic distance (D), and genetic identity (I). (A) The top right indicates Fst, and the bottom left indicates Nm between populations. (B) The top right indicates Nei’s genetic distance, and the bottom left indicates genetic identity between populations.
Figure 3. Genetic differentiation (Fst), gene flow (Nm), Nei’s genetic distance (D), and genetic identity (I). (A) The top right indicates Fst, and the bottom left indicates Nm between populations. (B) The top right indicates Nei’s genetic distance, and the bottom left indicates genetic identity between populations.
Forests 15 00793 g003
Table 1. The survey of the stands of Keteleeria davidiana var. calcarea community.
Table 1. The survey of the stands of Keteleeria davidiana var. calcarea community.
PopulationElevation (m)AspectSlope (°)LatitudeLongitudeMaternal TreesProgeny
GC670WS4525°50′26″110°05′47″2098
LG160WS4025°12′47″110°11′51″522
FC334ES3525°02′24″111°18′47″1573
RA480WS4525°01′46″109°34′50″621
Table 2. Primer sequence information.
Table 2. Primer sequence information.
Primer No.Repeat MotifPrimer Sequence (5′-3′)Expected Size (bp)Tm (°C)
P7(AGA)8F: CCAACATTGCAGTTGACGAC13254
R: CATCATCCTCACCACATTGC
P49(TC)10F: TTGGCCAGGTCAGAAATAGG17160
R: CCCATTGCCTCAAGAGAGAG
P56(TA)11F: GTCAAAGACAACAGACGCCA21259.8
R: CTTGGGGATACAACCAAGGA
P60(AT)11F: GAACCCCCACCTGTACCTCT23860.4
R: CGAGTATGCATCCACGTCAA
P64(TA)11F: GCTGCGAAGCTGCTAAAACT25560
R: CGGCCTCTCACTTCTGGTAG
P130(TA)11F: CAAATTCTCCCAGAGGAAGC23455
R: GGTCAGTGTCCTTCCTCCAA
P150(TG)12F: ATCTCCTTGCTGATTGGGTG19455
R: CCTCCTGCAACGGTTATGTT
P153(GT)10F: CCTTTCACACGCACTAGCAA26756.5
R: CGCACCTCTTATCCACCACT
P156(AT)11F: ATCCGTATCCGTTTCCGTTT11053.5
R: TTTTTGCTGGAGTGTGTTGC
Table 3. Number of alleles amplified by nine pairs of microsatellite primers in wild populations of Keteleeria davidiana var. calcarea.
Table 3. Number of alleles amplified by nine pairs of microsatellite primers in wild populations of Keteleeria davidiana var. calcarea.
PrimerMaternal Trees Progeny
LGRAFCGCLGRAFCGC
P13022222222
P15021222122
P15335353677
P4931233233
P56225823711
P6022342335
P646471075611
P15613332354
P7112312103
total 2221294024274548
Table 4. Genetic diversity of maternal and progeny in wild populations of the Keteleeria davidiana var. calcarea.
Table 4. Genetic diversity of maternal and progeny in wild populations of the Keteleeria davidiana var. calcarea.
StagePopulationNe (SE)Ho (SE)He (SE)uHe (SE)Ar (SE)F (SE)PPL (%)
Maternal treesLG2.444(0.322) 0.333(0.042) 0.387(0.088) 0.430(0.075)2.058(0.032)0.106(0.008) 77.78
RA2.333(0.182) 0.361(0.003) 0.341(0.046) 0.383(0.003)1.964(0.091)−0.007(0.000) 66.67
FC3.222(0.029) 0.375(0.039) 0.402(0.037) 0.418(0.022)2.059(0.003)0.010(0.001) 100.00
GC4.444(0.090) 0.450(0.036) 0.496(0.098) 0.509(0.093)2.315(0.005)0.085(0.002) 100.00
average3.111(0.355) 0.380(0.65) 0.406(0.033) 0.435(0.033)2.099(0.048)0.048(0.014) 86.11
ProgenyLG2.670(0.035) 0.350(0.091) 0.390(0.066) 0.398(0.025)1.901(0.009)0.120(0.002) 88.89
RA3.000(0.165) 0.330(0.082) 0.360(0.014) 0.365(0.071)1.907(0.071)0.070(0.000) 88.89
FC5.000(0.175) 0.310(0.034) 0.450(0.039) 0.456(0.033)2.164(0.038)0.270(0.000) 100.00
GC5.330(0.092) 0.380(0.033) 0.480(0.064) 0.488(0.019)2.224(0.048)0.220(0.007) 100.00
average4.000(0.316) 0.340(0.020) 0.420(0.040) 0.427(0.067)2.049(0.048)0.170(0.001) 94.44
Ne, the number of effective alleles; Ho, the observed heterozygosity; He, the expected heterozygosity; uHe, unbiased expected heterozygosity; Ar, allelic richness; f, fixation index; PPL, percent polymorphic loci.
Table 5. Mating system parameters for Keteleeria davidiana var. calcarea.
Table 5. Mating system parameters for Keteleeria davidiana var. calcarea.
tm (SE)ts (SE)tm-ts (SE)rt (SE)rp(m) (SE)rp(s) (SE)rp(s)-rp(m) (SE)Nepδ
LG1.000 (0.000)0.918 (0.037)0.082 (0.037)0.103 (0.000)0.064 (0.028)0.073 (0.019)0.009 (0.015)15.3840
RA1.134 (0.079)0.977 (0.090)0.158 (0.090)−0.443 (0.512)0.043 (0.395)0.021 (0.293)0.001 (0.268)23.255−0.057
FC0.859 (0.046)0.603 (0.079)0.257 (0.049)−0.215 (0.318)0.584 (0.137)0.808 (0.248)0.224 (0.165)1.7121.029
GC0.810 (0.060)0.671 (0.061)0.140 (0.024)0.325 (0.179)0.192 (0.080)0.095 (0.084)−0.097 (0.070)5.2081.048
Species level0.902 (0.025)0.606 (0.035)0.295 (0.028)0.145 (0.114)0.490 (0.057)0.461 (0.099)−0.028 (0.069)2.0400.967
tm: The multilocus outcrossing rate; ts: the single-locus outcrossing rate; tm-ts: bimaternal inbreeding coefficient; rt: outcrossing rate; rp(m): multilocus correlation of paternity; rp(s): single-locus correlation of paternity; δ: coefficient of inbreeding depression. Nep: effective number of pollen donors.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Pan, X.; Qin, H.; Jiang, H.; Peng, L.; Yang, Y.; Tang, J.; Zou, R.; Chen, Z.; Wei, X.; Chai, S. Analysis of the Genetic Diversity and Mating System of the Endangered Plant Keteleeria davidiana var. calcarea. Forests 2024, 15, 793. https://doi.org/10.3390/f15050793

AMA Style

Pan X, Qin H, Jiang H, Peng L, Yang Y, Tang J, Zou R, Chen Z, Wei X, Chai S. Analysis of the Genetic Diversity and Mating System of the Endangered Plant Keteleeria davidiana var. calcarea. Forests. 2024; 15(5):793. https://doi.org/10.3390/f15050793

Chicago/Turabian Style

Pan, Xinfeng, Huizhen Qin, Haidu Jiang, Lihui Peng, Yishan Yang, Jianmin Tang, Rong Zou, Zongyou Chen, Xiao Wei, and Shengfeng Chai. 2024. "Analysis of the Genetic Diversity and Mating System of the Endangered Plant Keteleeria davidiana var. calcarea" Forests 15, no. 5: 793. https://doi.org/10.3390/f15050793

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop