Manzamine A Exerts Anticancer Activity against Human Colorectal Cancer Cells
Abstract
1. Introduction
2. Results
2.1. Manz A Inhibits Cell Proliferation in Human Colorectal Carcinoma Cells
2.2. Manz A Reduces Gene Expressions Involved in Several Fundamental Pathways
2.3. Manz A Induces Cell Cycle Arrest at G0/G1 Phase
2.4. Manz A Induces Caspase-Dependent Apoptotic Cell Death
2.5. Epithelial–Mesenchymal Transition (EMT) Is Inactivated in Manz A Treated HCT116 Cells
2.6. Manz A Suppresses EMT Markers and Migration of Colorectal Carcinoma Cells
3. Discussion
4. Materials and Methods
4.1. Reagents and Chemicals
4.2. Cell Culture
4.3. Cell Proliferation Analysis and Colony Formation Assay
4.4. Microarray Analysis
4.5. Functional Enrichment Analysis and Data Visualization
4.6. Flow Cytometry Analysis
4.7. Caspases 3/7 Activities Assay
4.8. Transwell Migration Assay
4.9. Western Blot Analysis
4.10. RNA Isolation, Reverse Transcription and Quantitative Real-Time PCR (qPCR) Analysis
4.11. Immunocytochemistry
4.12. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Williams, T.G.; Cubiella, J.; Griffin, S.J.; Walter, F.M.; Usher-Smith, J.A. Risk prediction models for colorectal cancer in people with symptoms: A systematic review. BMC Gastroenterol. 2016, 16, 63. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kuipers, E.J.; Grady, W.M.; Lieberman, D.; Seufferlein, T.; Sung, J.J.; Boelens, P.G.; van de Velde, C.J.; Watanabe, T. Colorectal cancer. Nat. Rev. Dis. Primers 2015, 1, 15065. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marmol, I.; Sanchez-de-Diego, C.; Pradilla Dieste, A.; Cerrada, E.; Rodriguez Yoldi, M.J. Colorectal Carcinoma: A General Overview and Future Perspectives in Colorectal Cancer. Int. J. Mol. Sci. 2017, 18, 197. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Center, M.M.; Jemal, A.; Ward, E. International trends in colorectal cancer incidence rates. Cancer Epidemiol. Biomark. Prev. 2009, 18, 1688–1694. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Welch, J.P.; Donaldson, G.A. The clinical correlation of an autopsy study of recurrent colorectal cancer. Ann. Surg. 1979, 189, 496–502. [Google Scholar] [PubMed]
- Siegel, R.L.; Miller, K.D.; Jemal, A. Cancer statistics, 2016. CA Cancer J. Clin. 2016, 66, 7–30. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Colussi, D.; Brandi, G.; Bazzoli, F.; Ricciardiello, L. Molecular pathways involved in colorectal cancer: Implications for disease behavior and prevention. Int. J. Mol. Sci. 2013, 14, 16365–16385. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Grady, W.M.; Carethers, J.M. Genomic, and epigenetic instability in colorectal cancer pathogenesis. Gastroenterology 2008, 135, 1079–1099. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Grady, W.M.; Pritchard, C.C. Molecular alterations and biomarkers in colorectal cancer. Toxicol. Pathol. 2014, 42, 124–139. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Edrada, R.A.; Proksch, P.; Wray, V.; Witte, L.; Muller, W.E.; Van Soest, R.W. Four new bioactive manzamine-type alkaloids from the Philippine marine sponge Xestospongia ashmorica. J. Nat. Prod. 1996, 59, 1056–1060. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ichiba, T.; Corgiat, J.M.; Scheuer, P.J.; Kelly-Borges, M. 8-Hydroxymanzamine A, a beta-carboline alkaloid from a sponge, Pachypellina sp. J. Nat. Prod. 1994, 57, 168–170. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Watanabe, D.; Tsuda, M.; Kobayashi, J. Three new manzamine congeners from Amphimedon sponge. J. Nat. Prod. 1998, 61, 689–692. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sakai, R.; Higa, T.; Jefford, C.W.; Bernardinelli, G. Manzamine A, a novel antitumor alkaloid from a sponge. J. Am. Chem. Soc. 1986, 108, 6404–6405. [Google Scholar] [CrossRef] [Scilit]
- Rao, K.V.; Donia, M.S.; Peng, J.; Garcia-Palomero, E.; Alonso, D.; Martinez, A.; Medina, M.; Franzblau, S.G.; Tekwani, B.L.; Khan, S.I.; et al. Manzamine B and E and Ircinal A Related Alkaloids from an Indonesian Acanthostrongylophora Sponge and Their Activity against Infectious, Tropical Parasitic, and Alzheimer’s Diseases. J. Nat. Prod. 2006, 69, 1034–1040. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rao, K.V.; Santarsiero, B.D.; Mesecar, A.D.; Schinazi, R.F.; Tekwani, B.L.; Hamann, M.T. New Manzamine Alkaloids with Activity against Infectious and Tropical Parasitic Diseases from an Indonesian Sponge. J. Nat. Prod. 2003, 66, 823–828. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ang, K.K.H.; Holmes, M.J.; Higa, T.; Hamann, M.T.; Kara, U.A.K. In Vivo Antimalarial Activity of the Beta-Carboline Alkaloid Manzamine A. Antimicrob. Agents Chemother. 2000, 44, 1645–1649. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rao, K.V.; Kasanah, N.; Wahyuono, S.; Tekwani, B.L.; Schinazi, R.F.; Hamann, M.T. Three new manzamine alkaloids from a common Indonesian sponge and their activity against infectious and tropical parasitic diseases. J. Nat. Prod. 2004, 67, 1314–1318. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yousaf, M.; Hammond, N.L.; Peng, J.; Wahyuono, S.; McIntosh, K.A.; Charman, W.N.; Mayer, A.M.S.; Hamann, M.T. New Manzamine Alkaloids from an Indo-Pacific Sponge. Pharmacokinetics, Oral Availability, and the Significant Activity of Several Manzamines against HIV-I, AIDS Opportunistic Infections, and Inflammatory Diseases. J. Med. Chem. 2004, 47, 3512–3517. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Peng, J.; Hu, J.F.; Kazi, A.B.; Li, Z.; Avery, M.; Peraud, O.; Hill, R.T.; Franzblau, S.G.; Zhang, F.; Schinazi, R.F.; et al. Manadomanzamines A and B: A novel alkaloid ring system with potent activity against mycobacteria and HIV-1. J. Am. Chem. Soc. 2003, 125, 13382–13386. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guzman, E.A.; Johnson, J.D.; Linley, P.A.; Gunasekera, S.E.; Wright, A.E. A novel activity from an old compound: Manzamine A reduces the metastatic potential of AsPC-1 pancreatic cancer cells and sensitizes them to TRAIL-induced apoptosis. Investig. New Drugs 2011, 29, 777–785. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kallifatidis, G.; Hoepfner, D.; Jaeg, T.; Guzman, E.A.; Wright, A.E. The marine natural product manzamine A targets vacuolar ATPases and inhibits autophagy in pancreatic cancer cells. Mar. Drugs 2013, 11, 3500–3516. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Otto, T.; Sicinski, P. Cell cycle proteins as promising targets in cancer therapy. Nat. Rev. Cancer 2017, 17, 93–115. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lamouille, S.; Xu, J.; Derynck, R. Molecular mechanisms of epithelial-mesenchymal transition. Nat. Rev. Mol. Cell Biol. 2014, 15, 178–196. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bertoli, C.; Skotheim, J.M.; de Bruin, R.A. Control of cell cycle transcription during G1 and S phases. Nat. Rev. Mol. Cell Biol. 2013, 14, 518–528. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Trimarchi, J.M.; Lees, J.A. Sibling rivalry in the E2F family. Nat. Rev. Mol. Cell Biol. 2002, 3, 11–20. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Eferl, R.; Wagner, E.F. AP-1: A double-edged sword in tumorigenesis. Nat. Rev. Cancer 2003, 3, 859–868. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kasibhatla, S.; Brunner, T.; Genestier, L.; Echeverri, F.; Mahboubi, A.; Green, D.R. DNA damaging agents induce expression of Fas ligand and subsequent apoptosis in T lymphocytes via the activation of NF-kappa B and AP-1. Mol. Cell 1998, 1, 543–551. [Google Scholar] [CrossRef] [Scilit]
- Passegue, E.; Jochum, W.; Schorpp-Kistner, M.; Mohle-Steinlein, U.; Wagner, E.F. Chronic myeloid leukemia with increased granulocyte progenitors in mice lacking junB expression in the myeloid lineage. Cell 2001, 104, 21–32. [Google Scholar] [CrossRef] [Scilit]
- Bottone, F.G., Jr.; Moon, Y.; Kim, J.S.; Alston-Mills, B.; Ishibashi, M.; Eling, T.E. The anti-invasive activity of cyclooxygenase inhibitors is regulated by the transcription factor ATF3 (activating transcription factor 3). Mol. Cancer Ther. 2005, 4, 693–703. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yan, C.; Lu, D.; Hai, T.; Boyd, D.D. Activating transcription factor 3, a stress sensor, activates p53 by blocking its ubiquitination. EMBO J. 2005, 24, 2425–2435. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lu, D.; Wolfgang, C.D.; Hai, T. Activating transcription factor 3, a stress-inducible gene, suppresses Ras-stimulated tumorigenesis. J. Biol. Chem. 2006, 281, 10473–10481. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Eo, H.J.; Kwon, T.H.; Park, G.H.; Song, H.M.; Lee, S.J.; Park, N.H.; Jeong, J.B. In Vitro Anticancer Activity of Phlorofucofuroeckol A via Upregulation of Activating Transcription Factor 3 against Human Colorectal Cancer Cells. Mar. Drugs 2016, 14, 69. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Park, G.H.; Song, H.M.; Jeong, J.B. Kahweol from Coffee Induces Apoptosis by Upregulating Activating Transcription Factor 3 in Human Colorectal Cancer Cells. Biomol. Ther. (Seoul) 2017, 25, 337–343. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Van Cutsem, E.; Oliveira, J. Advanced colorectal cancer: ESMO clinical recommendations for diagnosis, treatment and follow-up. Ann. Oncol. 2009, 20 (Suppl. S4), 61–63. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Biasco, G.; Derenzini, E.; Grazi, G.; Ercolani, G.; Ravaioli, M.; Pantaleo, M.A.; Brandi, G. Treatment of hepatic metastases from colorectal cancer: Many doubts, some certainties. Cancer Treat. Rev. 2006, 32, 214–228. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vatandoust, S.; Price, T.J.; Karapetis, C.S. Colorectal cancer: Metastases to a single organ. World J. Gastroenterol. 2015, 21, 11767–11776. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kwon, M.J. Emerging roles of claudins in human cancer. Int. J. Mol. Sci. 2013, 14, 18148–18180. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dhawan, P.; Singh, A.B.; Deane, N.G.; No, Y.; Shiou, S.R.; Schmidt, C.; Neff, J.; Washington, M.K.; Beauchamp, R.D. Claudin-1 regulates cellular transformation and metastatic behavior in colon cancer. J. Clin. Investig. 2005, 115, 1765–1776. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Karagiannis, G.S.; Poutahidis, T.; Erdman, S.E.; Kirsch, R.; Riddell, R.H.; Diamandis, E.P. Cancer associated fibroblasts drive the progression of metastasis through both paracrine and mechanical pressure on cancer tissue. Mol. Cancer Res. 2012, 10, 1403–1418. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chang, H.Y.; Ye, S.P.; Pan, S.L.; Kuo, T.T.; Liu, B.C.; Chen, Y.L.; Huang, T.C. Overexpression of miR-194 reverses HMGA2-driven signatures in colorectal cancer. Theranostics 2017, 7, 3889–3900. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, D.W.; Sherman, B.T.; Lempicki, R.A. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat. Protoc. 2009, 4, 44–57. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Joshi-Tope, G.; Gillespie, M.; Vastrik, I.; D’Eustachio, P.; Schmidt, E.; de Bono, B.; Jassal, B.; Gopinath, G.R.; Wu, G.R.; Matthews, L.; et al. Reactome: A knowledgebase of biological pathways. Nucleic Acids Res. 2005, 33, D428–D432. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Subramanian, A.; Tamayo, P.; Mootha, V.K.; Mukherjee, S.; Ebert, B.L.; Gillette, M.A.; Paulovich, A.; Pomeroy, S.L.; Golub, T.R.; Lander, E.S.; et al. Gene set enrichment analysis: A knowledge-based approach for interpreting genome-wide expression profiles. Proc. Natl. Acad. Sci. USA 2005, 102, 15545–15550. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shannon, P.; Markiel, A.; Ozier, O.; Baliga, N.S.; Wang, J.T.; Ramage, D.; Amin, N.; Schwikowski, B.; Ideker, T. Cytoscape: A software environment for integrated models of biomolecular interaction networks. Genome Res. 2003, 13, 2498–2504. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Isserlin, R.; Merico, D.; Voisin, V.; Bader, G.D. Enrichment Map—A Cytoscape app to visualize and explore OMICs pathway enrichment results. F1000Research 2014, 3, 141. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hong, Y.; Downey, T.; Eu, K.W.; Koh, P.K.; Cheah, P.Y. A ‘metastasis-prone’ signature for early-stage mismatch-repair proficient sporadic colorectal cancer patients and its implications for possible therapeutics. Clin. Exp. Metastasis 2010, 27, 83–90. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| Gene | Forward (5′ to 3′) | Reverse (5′ to 3′) |
|---|---|---|
| VIM | AGTCCACTGAGTACCGGAGAC | CATTTCACGCATCTGGCGTTC |
| CDH1 | ATTTTTCCCTCGACACCCGAT | TCCCAGGCGTAGACCAAGA |
| CTNNB1 | GTCTGAGGACAAGCCACAAGA | TCCCTGGGCACCAATATCAAG |
| FN1 | GGCCAGTCCTACAACCAGTAT | TCGGGAATCTTCTCTGTCAGC |
| TWIST1 | GCTGAGCAAGATTCAGACCCT | TCCATCCTCCAGACCGAGAA |
| SNAI1 | AAGGGACTGTGAGTAATGGCTG | TAGTTCTGGGAGACACATCGGT |
| ZEB1 | CAGCTTGATACCTGTGAATGGG | TATCTGTGGTCGTGTGGGACT |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lin, L.-C.; Kuo, T.-T.; Chang, H.-Y.; Liu, W.-S.; Hsia, S.-M.; Huang, T.-C. Manzamine A Exerts Anticancer Activity against Human Colorectal Cancer Cells. Mar. Drugs 2018, 16, 252. https://doi.org/10.3390/md16080252
Lin L-C, Kuo T-T, Chang H-Y, Liu W-S, Hsia S-M, Huang T-C. Manzamine A Exerts Anticancer Activity against Human Colorectal Cancer Cells. Marine Drugs. 2018; 16(8):252. https://doi.org/10.3390/md16080252
Chicago/Turabian StyleLin, Li-Chun, Tzu-Ting Kuo, Hsin-Yi Chang, Wen-Shan Liu, Shih-Min Hsia, and Tsui-Chin Huang. 2018. "Manzamine A Exerts Anticancer Activity against Human Colorectal Cancer Cells" Marine Drugs 16, no. 8: 252. https://doi.org/10.3390/md16080252
APA StyleLin, L.-C., Kuo, T.-T., Chang, H.-Y., Liu, W.-S., Hsia, S.-M., & Huang, T.-C. (2018). Manzamine A Exerts Anticancer Activity against Human Colorectal Cancer Cells. Marine Drugs, 16(8), 252. https://doi.org/10.3390/md16080252

