Next Article in Journal
Immunostimulatory Effects of Korean Mineral-Rich Seawaters on Cyclophosphamide-Induced Immunosuppression in Mice
Next Article in Special Issue
Exploring Sources, Biological Functions, and Potential Applications of the Ubiquitous Marine Cyclic Dipeptide: A Concise Review of Cyclic Glycine-Proline
Previous Article in Journal
Marine-Derived Sulfated Glycans Inhibit the Interaction of Heparin with Adhesion Proteins of Mycoplasma pneumoniae
Previous Article in Special Issue
Antibacterial Polyketides from the Deep-Sea Cold-Seep-Derived Fungus Talaromyces sp. CS-258
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Volatile Organic Compounds Produced by a Deep-Sea Bacterium Efficiently Inhibit the Growth of Pseudomonas aeruginosa PAO1

1
College of Life Sciences, Qingdao University, 308 Ningxia Road, Qingdao 266071, China
2
CAS Key Laboratory of Experimental Marine Biology & Center of Deep Sea Research, Institute of Oceanology, Chinese Academy of Sciences, Qingdao 266071, China
3
Laboratory for Marine Biology and Biotechnology, Qingdao Marine Science and Technology Center, Qingdao 266071, China
4
Center of Ocean Mega-Science, Chinese Academy of Sciences, Qingdao 266071, China
5
College of Earth Science, University of Chinese Academy of Sciences, Beijing 101408, China
*
Authors to whom correspondence should be addressed.
Mar. Drugs 2024, 22(5), 233; https://doi.org/10.3390/md22050233
Submission received: 19 April 2024 / Revised: 16 May 2024 / Accepted: 17 May 2024 / Published: 20 May 2024
(This article belongs to the Special Issue Bioactive Compounds from the Deep-Sea-Derived Microorganisms 2.0)

Abstract

The deep-sea bacterium Spongiibacter nanhainus CSC3.9 has significant inhibitory effects on agricultural pathogenic fungi and human pathogenic bacteria, especially Pseudomonas aeruginosa, the notorious multidrug-resistant pathogen affecting human public health. We demonstrate that the corresponding antibacterial agents against P. aeruginosa PAO1 are volatile organic compounds (VOCs, namely VOC-3.9). Our findings show that VOC-3.9 leads to the abnormal cell division of P. aeruginosa PAO1 by disordering the expression of several essential division proteins associated with septal peptidoglycan synthesis. VOC-3.9 hinders the biofilm formation process and promotes the biofilm dispersion process of P. aeruginosa PAO1 by affecting its quorum sensing systems. VOC-3.9 also weakens the iron uptake capability of P. aeruginosa PAO1, leading to reduced enzymatic activity associated with key metabolic processes, such as reactive oxygen species (ROS) scavenging. Overall, our study paves the way to developing antimicrobial compounds against drug-resistant bacteria by using volatile organic compounds.

Graphical Abstract

1. Introduction

Pseudomonas aeruginosa is a widespread pathogen found in various environments including aqueous environments and the infected tissues of human beings. P. aeruginosa poses a significant challenge to global human health as it can lead to both acute and chronic infections [1]. In patients with lung diseases, particularly those with cystic fibrosis, colonization of the lungs by P. aeruginosa is a major contributor to illness and mortality [2]. Notably, research indicates that this infection is associated with the formation of highly antibiotic-resistant biofilms [3]. Biofilm formation in P. aeruginosa is governed by intricate bacterial regulatory systems, which include quorum sensing (QS) systems reliant on cell density and intercellular communication [1]. QS systems in P. aeruginosa play a crucial role in regulating the release of virulence factors and influencing iron uptake processes [4]. Therefore, the inhibition of QS systems has garnered considerable interest, including quorum quenching (QQ), which involves the use of chemical or enzymatic means to inhibit QS systems, thereby attenuating behaviors regulated by QS systems [5]. QS systems regulate the expression of a series of key genes by sensing signaling molecules called autoinducers. As cell density increases, autoinducers accumulate in the extracellular environment. When the concentration of the autoinducer reaches a certain threshold, QS systems are activated [6]. The activation of QS systems relies on the essential process of cell division, which not only facilitates bacterial population growth but also aids in the transmission of genetic information within P. aeruginosa [7]. Cell division in bacteria is mediated by the cytokinesis complex, which consists of the eukaryotic microtubule protein homolog FtsZ self-assembling into dynamic protofilaments and serving as scaffolds for cell division and dozens of other related proteins [8]. The division complex promotes cell division through a series of processes, mainly including cell shrinking as well as synthesis of the septal peptidoglycan (sPG) wall [9]. The synthesis of sPG during bacterial cell division is a crucial and highly conserved process that is essential for reproduction, which makes division proteins intriguing targets in the search for novel antibiotics.
Searching for novel antibiotics against P. aeruginosa is always a fascinating direction in both microbiological and biomedical fields. Recently, many drug candidates targeting different essential growth processes of P. aeruginosa have been reported, such as exopolysaccharide EPS273 [10], difficidin analogs [11], and pyran polyketide penipyranicins A–C [12]. In addition to non-volatile natural products, volatile organic compounds (VOCs) are increasingly recognized as promising bioactive molecules due to their wide range of ecological functions [13]. Biological VOCs are produced by plants [14], fungi [15], and bacteria [16]. Microbial VOCs have been reported to be by-products produced by microorganisms during primary metabolism or secondary metabolism [17]. Several studies have indicated that microbial VOCs exhibit inhibitory effects on P. aeruginosa [18,19]. Nevertheless, the mechanisms by which VOCs inhibit P. aeruginosa have not been deeply elucidated due to their small molecular weight and volatile characteristics [20]. Importantly, VOCs also broadly exist in aquatic environments. Research suggests that the production of VOCs can suppress other microorganisms within the same ecological niche, thereby providing ecological advantages to the strain. Additionally, VOCs enable predators to detect nearby prey based on specific VOC signatures [21,22].
The ocean, being the largest aquatic environment on Earth, presents an ideal setting for the search for novel VOCs. Additionally, the deep sea represents a unique habitat where microorganisms have developed distinct metabolic mechanisms in adaptation to extreme conditions of high pressure, low temperature, and other specific environmental factors [23]. The primary or secondary metabolites generated by these microorganisms in their life processes serve as a valuable resource for the discovery of novel VOCs. Indeed, VOCs produced by a deep-sea bacterium Bacillus aryabhattai MCCC 1K02966 have been demonstrated to possess nematocidal activity [24]. In this study, we find that the volatile compound VOC-3.9, produced by the deep-sea Gram-negative bacterium Spongiibacter nanhainus CSC3.9, exhibits strong inhibitory activities against several known agricultural pathogenic fungi and the human pathogenic bacterium P. aeruginosa PAO1. In addition, the relevant antimicrobial mechanisms were systematically revealed.

2. Results and Discussion

2.1. The Deep-Sea Bacterium Spongiibacter Nanhainus CSC3.9 Produces Volatile Organic Compounds with Antibacterial and Antifungal Activities

In 2017, the World Health Organization designated P. aeruginosa as the top priority among drug-resistant bacteria in the quest for new antibiotics [25]. Consequently, we consistently used P. aeruginosa PAO1 as the model bacterium to screen for relevant active strains throughout the experiment. In this study, we discovered that the deep-sea bacterium Spongiibacter nanhainus CSC3.9 synthesized bioactive compounds that effectively inhibited the growth of Pseudomonas aeruginosa PAO1 through screening. S. nanhainus CSC3.9, a Gram-negative bacterium isolated from deep-sea cold seeps, has been shown to possess the ability to sense blue light in our recent study [26]. However, inhibitory activity was only detected in the liquid medium but not in the agar plate tested by the traditional agar diffusion method. Moreover, none of the retained substances exhibited inhibitory activity when we tried to concentrate the active fraction using freeze-drying and vacuum- spinning methods. Based on our experiences and previous reports [27,28,29], we speculated that the antibacterial substance produced by S. nanhainus CSC3.9 might be volatile. Therefore, we vaporized the original antibacterial substances by using a rotary evaporator under vacuum at 45 °C and collected the distilled fractions. Indeed, the distilled parts showed an evident inhibitory effect on the growth of P. aeruginosa PAO1 on the silica gel plates by using a modified bioautography method (Figure 1A), which was usually utilized to detect the activity of volatile organic compounds (VOCs) [30,31]. The above results clearly indicated that the antibacterial substances produced by S. nanhainus CSC3.9 were VOCs, and we named them VOC-3.9 in this study.
In order to measure the antibacterial spectrum of VOC-3.9, various bacteria and fungi were selected. In addition to P. aeruginosa PAO1, VOC-3.9 also effectively inhibited the growth of other Gram-negative pathogenic bacteria such as Vibrio anguillarum and Salmonella choleraesuis. It is known that S. choleraesuis are common human- and food-pathogenic bacteria, and their antibiotic resistance is increasing year by year [32]. V. anguillarum is a pathogenic bacterium that severely impacts the aquaculture industry, causing infections such as fish hemorrhagic septicemia and vibriosis [33]. VOC-3.9 slightly inhibited the Gram-positive pathogenic bacterium Staphylococcus aureus (Figure 1B), and evidently inhibited four agricultural pathogenic fungi (including Colletotrichum fioriniae, Fusarium solani, Fusarium oxysporum, and Pyricularia oryzae) (Figure 1C). For the four fungal pathogens, C. fioriniae is an important plant pathogenic, saprophytic, and endophytic fungus that causes rot in important crops such as strawberries, apples, blueberries, and pears [34]; F. solani can cause root rot in a wide range of economically important crops such as citrus, vegetables, flowers, field crops worldwide [35], and even humans and animals [36]; F. oxysporum is a pathogen that affects cucumbers [37]; P. oryzae is an important pathogen that causes rice blast disease [38]. Therefore, the above results suggested that VOC-3.9 had a broad inhibitory spectrum and could be developed as a potential antibiotic against both bacterial and fungal pathogens in the medical and agricultural fields.

2.2. Identification of Active Compounds against P. aeruginosa PAO1 within VOC-3.9

Considering that P. aeruginosa is one of the most notorious pathogens affecting human public health, our focus was on understanding the inhibitory mechanism of VOC-3.9 against P. aeruginosa PAO1. To identify the effective constituents of VOC-3.9 against P. aeruginosa PAO1, we further analyzed it using solid-phase microextraction (SPME) coupled with GC-MS (Figure 2A). A total of 14 compounds within VOC-3.9 were identified, including four esters, three ketones, four phenols/aldehydes/alcohols, and three other types of compounds (Figure 2B). Among these 14 compounds within VOC-3.9, eight of them (Phthalic acid, hex-3-yl isobutyl ester; Dibutyl phthalate; Hexanedioic acid, bis(2-ethylhexyl) ester; Bis(2-ethylhexyl) phthalate; 3-Hydroxy-4-methoxybenzaldehyde; 2-ethyl-1-hexanol; 2, 4-Di-tert-butylphenol; Methoxy-phenyl-oxime) have been reported as biological sources, and were shown to have inhibitory effects on fungal, bacterial, or tumor cells [28,39,40,41,42,43,44,45]. To our knowledge, the other six substances (including 2-Hydroxy-iso-butyrophenone; 2, 6-Di-tert-butyl-4-hydroxy-4-methylcyclohexa-2, 5-dien-1-one; (1-hydroxycyclohexyl) phenyl-methanone; 2, 4, 6-trimethyl-benzaldehyde; 1, 1′-[oxybis(methylene)] bis-benzene, and Indeno[1, 2, 3-cd] pyrene) are proposed for the first time as microbial sources in our present study (Figure 2B).
To further determine which substances within VOC-3.9 indeed perform key roles in inhibiting the growth of P. aeruginosa PAO1, six available chemically synthesized VOCs were selected for activity assays. Due to the volatilization of VOC-3.9, we chose a higher concentration for the activity assay. The results showed that 2-Hydroxy-iso-butyrophenone; 2, 4, 6-trimethyl-benzaldehyde, and 2-ethyl-1-hexanol could inhibit the growth of P. aeruginosa PAO1 to some extent at a concentration of 5 mg mL−1 for 24 h at 37 °C with a rotation speed of 150 rpm (Figure 3A). Among them, 2-Hydroxy-iso-butyrophenone showed the strongest inhibiting activity. In addition, 2-Hydroxy-iso-butyrophenone completely inhibits the growth of P. aeruginosa PAO1 at a concentration of 2.4 mg mL−1. Given the volatile characteristics of 2-Hydroxy-iso-butyrophenone, its working concentration in nature should be much lower than 2.4 mg mL−1. As far as we know, 2-Hydroxy-iso-butyrophenone is the first reported microbial VOC against P. aeruginosa PAO1. We further treated P. aeruginosa PAO1 with 2-Hydroxy-iso-butyrophenone at a concentration of 0.3 mg mL−1 for 16 h at 37 °C with a rotation speed of 150 rpm and observed the cell morphological changes using TEM. The cells of P. aeruginosa PAO1 became stretched (Figure 3B), suggesting 2-Hydroxy-iso-butyrophenone significantly disordered the growth of P. aeruginosa PAO1 and should be one of the essential antibacterial components within VOC-3.9. Importantly, three other substances within VOC-3.9 (including Bis(2-ethylhexyl) phthalate; 2, 4-Di-tert-butylphenol, and Methoxy-phenyl-oxime) have been shown to possess potential inhibitory activities against P. aeruginosa [42,44,45]. Among them, Bis(2-ethylhexyl) phthalate was produced by the actinomycete strain GRG4 and inhibited P. aeruginosa by altering the integrity of the cell membrane and content efflux, leading to cell death [42]; 2,4-Di-tert-butylphenol was produced by the fungal strain Diaporthe phaseolorum SSP12 and hindered the quorum sensing (QS) systems of P. aeruginosa PAO1 [44]; methoxy-phenyl-oxime was produced by the bacterium Klebsiella pneumoniae and showed potential anti-biofilm activity against P. aeruginosa [46]. Collectively, we speculated that VOC-3.9 should contain several effective components against P. aeruginosa PAO1 by acting on various targets, and some of them might have a cooperative relationship. In the future, much effort should be exhibited to clearly disclose the exact structure and function of each component within VOC-3.9.

2.3. VOC-3.9 Disorders the Cell Division Process of P. aeruginosa PAO1

To better understand the inhibitory mechanism of VOC-3.9 against P. aeruginosa PAO1, we treated P. aeruginosa PAO1 cultures with 0.3 mg mL−1 VOC-3.9 for 16 h at 37 °C with a rotation speed of 150 rpm, and then observed bacterial cells with TEM. Compared to the control cells, the cell size of VOC-3.9-treated P. aeruginosa PAO1 exhibited significant elongation (Figure 4A), even longer than those treated by 2-Hydroxy-iso-butyrophenone alone (Figure 3B), indicating some other compounds within VOC-3.9 also possess antibacterial activities. To explore the antibacterial mechanism of VOC-3.9 against P. aeruginosa PAO1, we, respectively, treated P. aeruginosa PAO1 with 0.375 mg mL−1 and 0.75 mg mL−1 VOC-3.9, and performed proteomic analysis at 37 °C for 16 h with a rotation speed of 150 rpm. Treatment with an equivalent amount of sterile water was used as the control. The proteomic results showed that VOC-3.9 led to significantly upregulated expressions of proteins involved in the cell division process of P. aeruginosa PAO1 (Figure 4B). This result was consistent with the TEM observation results (Figure 4A), indicating that the cell division process of P. aeruginosa PAO1 was evidently affected by VOC-3.9. The upregulated proteins included those associated with septal peptidoglycan (sPG) synthesis (FtsW and FtsI) and the activation of sPG synthesis (FtsB, FtsQ, and FtsL) [9], as well as peptidoglycan hydrolysis (FtsE and FtsX) [47]. Clearly, based on both microscopic and proteomic results, the cell division process of P. aeruginosa PAO1 was disordered by VOC-3.9, especially through upregulating some essential Fts factors involved in cell division.
Next, we overexpressed five genes (including ftsB, ftsL, ftsI ftsE, and ftsQ) in P. aeruginosa PAO1 that were most significantly upregulated by VOC-3.9 and checked the corresponding effects on the bacterial cell division process. The empty vector used for overexpression was transformed to P. aeruginosa PAO1 and used as the control. The TEM observation results showed that the overexpression of ftsB, ftsL, ftsI ftsE, and ftsQ indeed increased the cell length of P. aeruginosa PAO1 cells when compared to the control group (Figure 4C), confirming the validity of the proteomic results. These findings suggest that VOC-3.9 disrupts the cell division process of P. aeruginosa PAO1 by upregulating the expression of key Fts factors associated with sPG synthesis, resulting in cytokinesis abnormalities. It is known that cell division is a crucial process for bacterial growth and reproduction, and it has always been an important target in the search for antibacterial agents [48]. VOC-3.9, a cell division inhibitor, effectively impedes the rapid proliferation of P. aeruginosa PAO1, making it a good candidate for preventing and controlling infectious diseases caused by P. aeruginosa PAO1.

2.4. VOC-3.9 Impedes the Quorum Sensing (QS) Systems Associated with the Biofilm Formation and Dispersion Processes of P. aeruginosa PAO1

When analyzing the proteomic results of P. aeruginosa PAO1 treated by VOC-3.9, we found that the expressions of many proteins associated with QS systems (e.g., LasR, RhlR, PqsB, and AmbB) were significantly downregulated (Figure 5A). It is well known that both QS systems and biofilm formation/dispersion are closely correlated and are essential for the growth and infection of P. aeruginosa PAO1 [49]. We thus checked the inhibitory effect of VOC-3.9 on the biofilm formation of P. aeruginosa PAO1 by using 96-well polystyrene plates. The results showed that biofilm formation was markedly inhibited (Figure 5B, panel a) and biofilm dispersion was significantly promoted (Figure 5B, panel b) in P. aeruginosa PAO1 by the supplement of 0.375 mg mL−1 and 0.75 mg mL−1 VOC-3.9, respectively. The biofilm inhibition ratio and biofilm dispersion ratio of P. aeruginosa PAO1 could, respectively, reach 64.56% and 79.99% by the treatment of VOC-3.9 (Figure 5C). QS systems are critical in regulating the generation of virulence factors in P. aeruginosa PAO1 [50], and the biofilm is a good target for developing novel antibiotics and avoiding drug resistance [10]. Obviously, VOC-3.9 effectively inhibits the QS systems associated with biofilm formation and dispersion in P. aeruginosa PAO1 (Figure 5). These results demonstrate the potential of VOC-3.9 as a drug candidate with anti-biofilm activities that can lower antibiotic resistance against P. aeruginosa PAO1.

2.5. VOC-3.9 Hinders Iron Uptake in P. aeruginosa PAO1

Iron is an essential cofactor of several core enzyme systems of P. aeruginosa PAO1 and also plays a key role in biofilm formation in P. aeruginosa PAO1. To obtain extracellular iron, P. aeruginosa PAO1 secretes high-affinity siderophores and heme to bind extracellular Fe3+, which is subsequently transported across the cell membrane and ultimately reduced to Fe2+ [51]. Interestingly, the proteomic results showed that the expressions of many key genes associated with iron uptake (e.g., pchR, fpvA and phuT) and reduction processes (e.g., PA4708) of P. aeruginosa PAO1 were evidently downregulated (Figure 6A). Indeed, the intracellular ferrous ion concentrations were markedly decreased when P. aeruginosa PAO1 was treated with 0.3 mg mL−1 VOC-3.9 at 37 °C for 16 h with a rotation speed of 150 rpm (Figure 6B), confirming that the iron uptake processes of P. aeruginosa PAO1 were hindered by supplementation with VOC-3.9. A previous study has shown that QS systems and iron uptake processes interact with each other and cooperatively regulate the expression of various genes including virulence factors [52].
On the other hand, iron is an essential cofactor for several core enzyme systems, including peroxidase and catalase, associated with reactive oxygen species (ROS) scavenging [53]. Excess intracellular ROS can react with bacterial lipids, DNA, and proteins, resulting in lipid peroxidation and gene mutations [54]. Indeed, exposure to VOC-3.9 resulted in a significant decrease in the expressions of some peroxidases and catalases (Figure 6A), and an obvious increase in the intracellular ROS concentration of P. aeruginosa PAO1 (Figure 6C). The results indicate that the treatment of P. aeruginosa PAO1 with VOC-3.9 could result in an elevation in the amount of ROS, thereby leading to further cell damage.

3. Materials and Methods

3.1. Bacterial Strains and Culture Conditions

Spongiibacter nanhainus CSC3.9 was previously isolated from deep-sea cold seeps [26]. S. nanhainus CSC3.9 and Vibrio anguillarum were cultured in 2216E medium (containing 5 g L−1 tryptone, and 1 g L−1 yeast extract in a liter of filtered seawater with pH adjusted to about 7.4; Oxoid, Basingstoke UK). Apart from V. anguillarum, other pathogenic bacteria (including Pseudomonas aeruginosa PAO1, Staphylococcus aureus, and Salmonella choleraesuis) were cultured in Luria Bertani (LB) medium (containing 10 g L−1 tryptone, 5 g L−1 yeast extract, and 10 g L−1 NaCl in a liter of distilled water with pH adjusted to 7.0; Oxoid, Basingstoke, UK) at 37 °C. The pathogenic fungal strains (including Colletotrichum fioriniae, Fusarium solani, Fusarium oxysporum, and Pyricularia oryzae) were inoculated onto potato dextrose agar (PDA) medium (containing 200 g L−1 potato, 20 g L−1 glucose, and 15 g L−1 agar in a liter of distilled water; Solarbio, Beijing, China). The cultures were incubated at 28 °C. The final gentamicin concentration used for assays was 25 μg mL−1.

3.2. Collection of Volatile Organic Compounds (VOCs)

To obtain VOCs, the supernatant of S. nanhainus CSC3.9 cultured in 2216E medium for 7 days was subjected to alcoholic precipitation. Then, the precipitate was solubilized using ultrapure water and boiled for 30 min to remove proteins. The solution was centrifuged at 8000× g for 20 min. Subsequently, the fractions with higher molecular weights were removed using an ultrafiltration tube with a molecular retention capacity of 3000 Da. Finally, the fractions were collected by vaporization using a rotary evaporator under vacuum at 45 °C to obtain the gas chromatography-mass spectrometry (GC-MS) sample, named VOC-3.9.

3.3. Activity Test of VOC-3.9

For activity assays of VOC-3.9, the traditional TLC-bioautography method was performed with minor modifications [30,31]. Briefly, 60 μL cell-free supernatant of S. nanhainus CSC3.9 was taken as a suspension drop on a 3 × 5 cm sterilized silica gel plate (Jiaoao, Yantai, China), and the same amount of sterile water was used as a control. The overnight-cultured P. aeruginosa PAO1 was then added to the LB solid medium at 1% inoculum, mixed well, and poured onto the silica gel plates spiked with VOC-3.9 or water. After that, the silica gel plates were incubated at 37 °C for 24 h. After removing the solid medium, the silica gel plates were treated with 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT, Sigma, Saint Louis, MO, USA) for 30 min.

3.4. Antibacterial and Antifungal Assays of VOC-3.9

Briefly, overnight cultured bacterial or fungal cells were used as the seed solution. Bacterial cells were added to LB medium or 2216E medium at a concentration of 1 × 105 CFU (colony forming unit) mL−1. Activated, equally sized fungal pellets were added to the PDB medium. In the control group, an equivalent amount of sterile water was added. The cultures of V. anguillarum and fungal strains were cultured at 28 °C for 24 h with a rotation speed of 150 rpm. Other bacterial strains were cultured at 37 °C for 24 h with a rotation speed of 150 rpm. Finally, the growth status of different bacterial and fungal strains was visually observed.

3.5. Characterization of VOC-3.9 by GC-MS

To identify the components of VOC-3.9, solid-phase microextraction (SPME) coupled with chromatographic tandem mass spectrometric analysis was performed according to the method described previously [55]. The SPME fibers (65 μm, polydimethylsiloxane/divinylbenzene (Supelco, Bedford, MA, USA)) were inserted into headspace vials, which were then exposed to adsorption at the shaking rate of 450 rpm and the temperature of 80 °C for 30 min. The compounds were then analyzed on a GC-MS coupled to an 8890-5977B (Agilent, Santa Clara, CA, USA) in the injection port at 250 °C for 5 min. Helium was used as the carrier gas at a flow rate of 1.2 mL min−1 through an HP-5MS column (30 m × 0.25 m × 0.5 μm) (Agilent, Santa Clara, CA, USA). The temperature increase program was set as follows: the initial column temperature was 40 °C, held for 5 min, increased to 320 °C at a rate of 10 °C min−1, and finally held for 2 min. The mass spectrometer was used in the electron ionization mode with a source temperature of 230 °C and a quadrupole temperature of 150 °C, and the full scan m/z was used, in the range of 20–500. The mass spectrometry data were computer-matched with compounds contained in Agilent Hewlett-Packard NIST 20 and the Wiley ver. 6 MASS SPECTRAL DATABASE to the mass spectrometry data for volatile peak designation.

3.6. Activity Assays of Single Components of VOC-3.9 against P. aeruginosa PAO1

Six chemically produced single substances (including 2-Hydroxy-iso-butyrophenone; 2, 4, 6-trimethyl-benzaldehyde; 2-ethyl-1-hexanol; 1, 1′-[oxybis(methylene)] bis-benzene, Bis(2-ethylhexyl) phthalate; Hexanedioic acid, bis(2-ethylhexyl) ester) within VOC-3.9 were purchased from reagent companies according to the type of reagent. Activity assays of these six substances against P. aeruginosa PAO1 were performed as described above. However, due to the lack of methods for detecting inhibitory concentrations of VOCs under sterile and aerobic conditions, we used high concentrations for bacteriostatic activity testing to make sure that activity can be detected. The final concentration for each compound in the test tubes was 2~5 mg mL−1. Overnight pure cultured P. aeruginosa PAO1 was inoculated into test tubes at a 1% concentration and subsequently incubated at 37 °C for 24 h with a rotation speed of 150 rpm. The inhibitory effect of six substances on P. aeruginosa PAO1 was determined through the turbidity of the bacterial suspension. Furthermore, we determined the antimicrobial concentration of 2-Hydroxy-iso-butyrophenone. However, due to the volatile nature of VOC-3.9, the exact inhibitory concentration of VOC-3.9 against P. aeruginosa PAO1 needs to be double-checked using various methods.

3.7. Transmission Electron Microscopy (TEM) Observation

To check the morphological changes of P. aeruginosa PAO1 after 2-Hydroxy-iso-butyrophenone or VOC-3.9 treatment, the cells of P. aeruginosa PAO1 were observed by TEM (Hitachi HT7700, Tokyo, Japan). Briefly, P. aeruginosa PAO1 cultures were inoculated at a 1% concentration in LB medium supplemented with 0.3 mg mL−1 2-Hydroxy-iso-butyrophenone or 0.3 mg mL−1 of VOC-3.9 at 37 °C with a rotation of 150 rpm for 16 h. Bacterial cells cultured with sterile water as controls were centrifuged at 3000× g for 10 min and washed twice with 0.1 M phosphate buffer solution (PBS). Cells were adsorbed on a copper mesh for 30 min and non-adsorbed cultures were rinsed away. The adsorbed mesh was dried on filter paper for 10 min. TEM was used for the final observation of the samples.

3.8. Proteomics Analysis

A previous study revealed that the QS systems of P. aeruginosa PAO1 had been activated when the OD600 value reached 1.0 [56]. To investigate the effects of VOC-3.9 on the QS systems and other key metabolic processes of P. aeruginosa PAO1, we monitored the OD600 values and collected the cells for proteomic analysis when the OD600 values of P. aeruginosa PAO1 were, respectively, 1.166, 1.186, and 1.078 for the control group and two experimental groups. Briefly, P. aeruginosa PAO1 cultures were, respectively, inoculated in LB medium supplemented with 0.375 mg mL−1 and 0.75 mg mL−1 of VOC-3.9 at 37 °C for 16 h with a rotation of 150 rpm. Bacterial cells cultured in the same condition supplemented with the same amount of sterile water were used as the control. Thereafter, the cultures were collected by centrifugation at 3000× g for 10 min, a twofold volume of lysis buffer (containing 8 M urea, 0.5% protease inhibitor cocktail III, 1% SDS) was added, and the lysates were fully shaken. Then, the samples were placed in a water bath at 100 °C for 30 min and broken three times on ice using ultrasound at 25% power. Finally, each sample was centrifuged at 10,000× g for 10 min to collect the supernatant and measure the concentration. Then, the peptide segments were digested and dissolved in a solvent containing 0.1% formic acid and 2% acetonitrile/water. They were separated using a C18 SPE column (25 cm length, 75/100 μm, Agilent, USA). The separation was carried out using a nanoElute UHPLC system (Bruker Daltonics, Billerica, MA, USA) and analyzed with a timsTOF Pro mass spectrometer. The MS/MS scan range was set from 100 to 1, 700 m/z. All of the above proteomic analyses were performed by PTMBiolabs (Hangzhou, China).

3.9. Protein Overexpression in P. aeruginosa PAO1

To overexpress proteins in P. aeruginosa PAO1, the commercial plasmid pUCP18 (Tingke, Beijing, China) was used as a starting vector. Based on our test, P. aeruginosa PAO1 exhibited sensitivity to gentamicin. Therefore, the original ampicillin resistance gene of pUCP18 was replaced with the gentamicin resistance gene. The Gm fragment and linearized plasmid fragment were amplified using the forward primers Gm-f and pUCP-f and the reverse primers Gm-r and pUCP18-r, respectively, and the 20 bp sequences at both ends of the linearized plasmid were included in the Gm-f/r primers as homologous regions, and then the Gm-resistant plasmid pUCP18-Gm was constructed using the homologous recombination kit (ABclonal, Wuhan, China). Subsequently, the encoding sequence of the targeting protein was amplified by the corresponding primers (fts-f/r) listed in Table 1. To conveniently clone the corresponding DNA fragment into the vector, appropriate endonuclease cutting sites were, respectively, introduced into two end primers. The vector and DNA fragment were cut by the same two endonucleases for 30 min and ligated together to construct the final expression vector. The resulting construct was then transformed into E. coli for replication and the final vector was verified by sequencing. Finally, the expression vector was transformed into P. aeruginosa PAO1 as described previously [57], and the corresponding assays were performed.

3.10. The Inhibition and Dispersion Assays of Biofilm Formation in P. aeruginosa PAO1 Treated with VOC-3.9

The anti-biofilm activity assay was performed by the method described previously [58]. P. aeruginosa PAO1 was cultured in LB medium overnight at 37 °C, diluted to an OD600 of 0.1, and divided into two groups: one group was treated with 0.375 mg mL−1 VOC-3.9 and one with water. Each group had three replicates, statically incubated in 96-well polystyrene plates at 37 °C for 24 h. After discarding planktonic debris, the biofilm was washed with PBS and stained with 1% crystal violet for 10 min. Subsequently, the non-adherent crystal violet was washed away using PBS. After drying, the crystal violet was dissolved in 95% ethanol. Absorbance at 595 nm was measured to quantify the biofilm.
To test the dispersion rate of VOC-3.9 on the preformed biofilm, overnight cultured P. aeruginosa PAO1 was similarly diluted to an OD600 of 0.1 using LB medium, and 200 μL of the diluted culture was incubated statically at 37 °C for 24 h. After washing away the planktonic bacterial cells, VOC-3.9 at a final concentration of 0.75 mg mL−1 was added. The control group was set up by adding the same amount of sterile water. The plate was then statically incubated for another 24 h, and the remaining biofilm was examined and quantified as described above. The above experiments were each repeated three times.

3.11. Detection of Intracellular Ferrous Ion Concentrations in P. aeruginosa PAO1

To detect intracellular ferrous ion concentrations in P. aeruginosa PAO1, an overnight culture was inoculated as the seed solution. The cells were then cultured in a LB medium supplemented with 0.3 mg mL−1 VOC-3.9 for 16 h at 37 °C with a rotation of 150 rpm at a 1% seeding concentration. Bacterial cells cultured in the same condition supplemented with the same amount of sterile water were used as the control. The cultures were centrifuged at 4 °C and 5000× g for 10 min. The collected cells were resuspended in PBS and were broken by ultrasonic fragmentation. The supernatant was collected at 4 °C and subjected to gradient dilution, and the protein concentration was measured at 562 nm using a BCA kit (Solarbio, Beijing, China). Simultaneously, the reaction between ferrous ions and tri-pyridyl-triazine under acidic conditions was carried out, and the concentration of ferrous ions was determined at 593 nm using the ferrous ion content detection kit (Solarbio, Beijing, China) as per the instructions. The experiments were performed in triplicate.

3.12. Detection of Intracellular Reactive Oxygen Species (ROS) Levels in P. aeruginosa PAO1

Intracellular ROS amounts of P. aeruginosa PAO1 were detected using DCFH-DA (Solarbio, Beijing, China) fluorescent probes. P. aeruginosa PAO1 cells were cultured overnight at 37 °C, collected, and diluted with PBS to an OD600 of 0.3. Subsequently, the diluted culture was incubated in the dark at 37 °C for 30 min with a working concentration of 10 μM DCFH-DA. Following incubation, the cells were washed twice with PBS to wash away the DCFH-DA that had not entered the cells. The DCFH-DA-loaded P. aeruginosa PAO1 cells were exposed to VOC-3.9 at concentrations of 0.3 mg mL−1. The above mixture exposed to the same amount of PBS was used as a control. A 100 μL solution from each sample was taken for detection at λex 488 nm and λem 525 nm every two minutes, and the experiments were performed in triplicate.

3.13. Statistical Analysis

All data are expressed as means ± SD. Statistical significances were analyzed by two-tailed Student’s t-tests using SPSS 17.0 (IBM). Differences of p ≤ 0.05 were considered statistically significant (* p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001). We generated the heat maps in the R software environment (R version 4.2.2). Graphical analysis was performed using the Origin 2021 software package.

3.14. Data Availability

The mass spectrometry proteomics data have been deposited to the Proteome Xchange Consortium (http://www.ebi.ac.uk/pride (accessed on 20 January 2024)) with the dataset identifier PXD045249.

4. Conclusions

Overall, the volatile organic component VOC-3.9 produced by the Gram-negative bacterium Spongiibacter nanhainus CSC3.9 from the deep sea effectively inhibits environmental and human pathogenic bacteria as well as agricultural pathogenic fungi, especially P. aeruginosa PAO1. Based on the combination of microscopic, proteomic, and biochemical data shown in this study, we propose the overall growth inhibition pathways in P. aeruginosa PAO1 treated by VOC-3.9 as follows (Figure 7). First, VOC-3.9 induces abnormal cell division by interfering with the expression of essential division proteins associated with septal peptidoglycan synthesis. Furthermore, VOC-3.9 impedes bacterial quorum sensing systems, thereby hindering biofilm formation and promoting biofilm dispersion processes. Lastly, VOC-3.9 disrupts the iron uptake systems, leading to reduced enzymatic activity associated with key metabolic processes (e.g., ROS elimination). Future efforts will be required to identify the exact components directing antibacterial function and study their synergistic effects and mechanisms both in vitro and in vivo.

Author Contributions

Y.H., C.S. and S.W. conceived and designed the study; Y.H. conducted most of the experiments; G.L. helped to purify the natural products; Y.H., C.S. and S.W. led the writing of the manuscript; all authors contributed to and reviewed the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Science and Technology Innovation Project of Laoshan Laboratory (Grant No. 2022QNLM030004-3; LSKJ202203103), Shandong Provincial Natural Science Foundation (ZR2021ZD28), the NSFC Innovative Group Grant (No. 42221005), Key Collaborative Research Program of the Alliance of International Science Organizations (Grant No. ANSO-CR-KP-2022-08), Strategic Priority Research Program of the Chinese Academy of Sciences (Grant No. XDA22050301), Key Deployment Projects of Center of Ocean Mega-Science of the Chinese Academy of Sciences (Grant No. COMS2020Q04), and the Taishan Scholars Program (Grant No. tstp20230637).

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Yang, H.; Jin, L.; Zhao, D.; Lian, Z.; Appu, M.; Huang, J.; Zhang, Z. Antibacterial and antibiofilm formation activities of pyridinium-based cationic pillar[5]arene against Pseudomonas aeruginosa. J. Agric. Food Chem. 2021, 69, 4276–4283. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Dolan, S.K.; Wijaya, A.; Kohlstedt, M.; Glaser, L.; Brear, P.; Silva-Rocha, R.; Wittmann, C.; Welch, M. Systems-wide dissection of organic acid assimilation in Pseudomonas aeruginosa reveals a novel path to underground metabolism. mBio 2022, 13, e02541-22. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Pang, Z.; Raudonis, R.; Glick, B.R.; Lin, T.J.; Cheng, Z. Antibiotic resistance in Pseudomonas aeruginosa: Mechanisms and alternative therapeutic strategies. Biotechnol. Adv. 2019, 37, 177–192. [Google Scholar] [CrossRef] [Scilit]
  4. Szamosvari, D.; Savchenko, V.; Badouin, N.; Bottcher, T. Beyond iron: Metal-binding activity of the Pseudomonas quinolone signal-motif. Org. Biomol. Chem. 2023, 21, 5158–5163. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Barrios, A.F.; Covo, V.; Medina, L.M.; Vives-Florez, M.; Achenie, L. Quorum quenching analysis in Pseudomonas aeruginosa and Escherichia coli: Network topology and inhibition mechanism effect on the optimized inhibitor dose. Bioprocess. Biosyst. Eng. 2009, 32, 545–556. [Google Scholar] [CrossRef] [Scilit]
  6. Feng, Q.; Luo, L.; Chen, X.; Zhang, K.; Fang, F.; Xue, Z.; Li, C.; Cao, J.; Luo, J. Facilitating biofilm formation of Pseudomonas aeruginosa via exogenous N-Acy-L-homoserine lactones stimulation: Regulation on the bacterial motility, adhesive ability and metabolic activity. Bioresour. Technol. 2021, 341, 125727. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Kashammer, L.; van den Ent, F.; Jeffery, M.; Jean, N.L.; Hale, V.L.; Lowe, J. Cryo-EM structure of the bacterial divisome core complex and antibiotic target FtsWIQBL. Nat. Microbiol. 2023, 8, 1149–1159. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  8. Kureisaite-Ciziene, D.; Varadajan, A.; McLaughlin, S.H.; Glas, M.; Monton Silva, A.; Luirink, R.; Mueller, C.; den Blaauwen, T.; Grossmann, T.N.; Luirink, J.; et al. Structural analysis of the interaction between the bacterial cell division proteins FtsQ and FtsB. mBio 2018, 9, e01346-18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  9. Marmont, L.S.; Bernhardt, T.G. A conserved subcomplex within the bacterial cytokinetic ring activates cell wall synthesis by the FtsW-FtsI synthase. Proc. Natl. Acad. Sci. USA 2020, 117, 23879–23885. [Google Scholar] [CrossRef] [Scilit]
  10. Wu, S.; Liu, G.; Jin, W.; Xiu, P.; Sun, C. Antibiofilm and anti-infection of a marine bacterial exopolysaccharide against Pseudomonas aeruginosa. Front. Microbiol. 2016, 7, 102. [Google Scholar] [CrossRef] [Scilit]
  11. Chakraborty, K.; Kizhakkekalam, V.K.; Joy, M.; Dhara, S. Difficidin class of polyketide antibiotics from marine macroalga-associated Bacillus as promising antibacterial agents. Appl. Microbiol. Biotechnol. 2021, 105, 6395–6408. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Orfali, R.; Perveen, S.; Al-Taweel, A.; Ahmed, A.F.; Majrashi, N.; Alluhay, K.; Khan, A.; Luciano, P.; Taglialatela-Scafati, O. Penipyranicins A-C: Antibacterial methylpyran polyketides from a hydrothermal spring sediment Penicillium sp. J. Nat. Prod. 2020, 83, 3591–3597. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Saha, M.; Fink, P. Algal volatiles-the overlooked chemical language of aquatic primary producers. Biol. Rev. Camb. Philos. Soc. 2022, 97, 2162–2173. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. da Cruz, E.P.; Jansen, E.T.; Costa, L.D.; de Souza, E.J.D.; Fonseca, L.M.; Gandra, E.A.; Zavareze, E.D.; Dias, A.R.G. Use of red onion skin (Allium cepa L.) in the production of bioactive extract and application in water-absorbing cryogels based on corn starch. Food Hydrocoll. 2023, 145, 109133. [Google Scholar] [CrossRef] [Scilit]
  15. Almeida, O.A.C.; de Araujo, N.O.; Dias, B.H.S.; de Sant’Anna Freitas, C.; Coerini, L.F.; Ryu, C.M.; de Castro Oliveira, J.V. The power of the smallest: The inhibitory activity of microbial volatile organic compounds against phytopathogens. Front. Microbiol. 2022, 13, 951130. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Baiome, B.A.; Ye, X.; Yuan, Z.; Gaafar, Y.Z.A.; Melak, S.; Cao, H. Identification of volatile organic compounds produced by Xenorhabdus indica strain AB and investigation of their antifungal activities. Appl. Environ. Microbiol. 2022, 88, e00155-22. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  17. Choudoir, M.; Rossabi, S.; Gebert, M.; Helmig, D.; Fierer, N. A phylogenetic and functional perspective on volatile organic compound production by Actinobacteria. mSystems 2019, 4, e00295-18. [Google Scholar] [CrossRef] [Scilit]
  18. Garrido, A.; Atencio, L.A.; Bethancourt, R.; Bethancourt, A.; Guzmán, H.; Gutiérrez, M.; Durant-Archibold, A.A. Antibacterial activity of volatile organic compounds produced by the octocoral-associated bacteria Bacillus sp. BO53 and Pseudoalteromonas sp. GA327. Antibiotics 2020, 9, 923. [Google Scholar] [CrossRef] [Scilit]
  19. Hummadi, E.H.; Cetin, Y.; Demirbek, M.; Kardar, N.M.; Khan, S.; Coates, C.J.; Eastwood, D.C.; Dudley, E.; Maffeis, T.; Loveridge, J.; et al. Antimicrobial volatiles of the insect pathogen Metarhizium brunneum. J. Fungi 2022, 8, 326. [Google Scholar] [CrossRef] [Scilit]
  20. Grahovac, J.; Pajcin, I.; Vlajkov, V. Bacillus VOCs in the context of biological control. Antibiotics 2023, 12, 581. [Google Scholar] [CrossRef] [Scilit]
  21. Berlinck, R.G.S.; Monteiro, A.F.; Bertonha, A.F.; Bernardi, D.I.; Gubiani, J.R.; Slivinski, J.; Michaliski, L.F.; Tonon, L.A.C.; Venancio, V.A.; Freire, V.F. Approaches for the isolation and identification of hydrophilic, light-sensitive, volatile and minor natural products. Nat. Prod. Rep. 2019, 36, 981–1004. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Achyuthan, K.E.; Harper, J.C.; Manginell, R.P.; Moorman, M.W. Volatile metabolites emission by in vivo microalgae-an overlooked opportunity? Metabolites 2017, 7, 39. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Zheng, R.; Wang, C.; Cai, R.; Shan, Y.; Sun, C. Mechanisms of nucleic acid degradation and high hydrostatic pressure tolerance of a novel deep-sea wall-less bacterium. mBio 2023, 14, e00958-23. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Chen, W.; Wang, J.; Huang, D.; Cheng, W.; Shao, Z.; Cai, M.; Zheng, L.; Yu, Z.; Zhang, J. Volatile organic compounds from Bacillus aryabhattai MCCC 1K02966 with multiple modes against Meloidogyne incognita. Molecules 2021, 27, 103. [Google Scholar] [CrossRef] [Scilit]
  25. Khatami, S.H.; Karami, S.; Siahkouhi, H.R.; Taheri-Anganeh, M.; Fathi, J.; Aghazadeh Ghadim, M.B.; Taghvimi, S.; Shabaninejad, Z.; Tondro, G.; Karami, N.; et al. Aptamer-based biosensors for Pseudomonas aeruginosa detection. Mol. Cell Probes 2022, 66, 101865. [Google Scholar] [CrossRef] [Scilit]
  26. Shan, Y.; Liu, G.; Cai, R.; Liu, R.; Zheng, R.; Sun, C. A deep-sea bacterium senses blue light via a BLUF-dependent pathway. mSystems 2022, 7, e01279-21. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Veselova, M.A.; Plyuta, V.A.; Khmel, I.A. Volatile compounds of bacterial origin: Structure, biosynthesis, and biological activity. Microbiology 2019, 88, 261–274. [Google Scholar] [CrossRef] [Scilit]
  28. Wang, E.; Liu, X.; Si, Z.; Li, X.; Bi, J.; Dong, W.; Chen, M.; Wang, S.; Zhang, J.; Song, A.; et al. Volatile organic compounds from rice rhizosphere bacteria inhibit growth of the pathogen Rhizoctonia solani. Agriculture 2021, 11, 368. [Google Scholar] [CrossRef] [Scilit]
  29. Zhao, Q.; Cao, J.; Cai, X.; Wang, J.; Kong, F.; Wang, D.; Wang, J. Antagonistic activity of volatile organic compounds produced by acid-tolerant Pseudomonas protegens CLP-6 as biological fumigants to control tobacco bacterial wilt caused by Ralstonia solanacearum. Appl. Environ. Microbiol. 2023, 89, e01892-22. [Google Scholar] [CrossRef] [Scilit]
  30. Ahmad, I.; Beg, A.Z. Antimicrobial and phytochemical studies on 45 Indian medicinal plants against multi-drug resistant human pathogens. J. Ethnopharmacol. 2001, 74, 113–123. [Google Scholar] [CrossRef] [Scilit]
  31. Horváth, G.; Jámbor, N.; Végh, A.; Böszörményi, A.; Lemberkovics, É.; Héthelyi, É.; Kovács, K.; Kocsis, B. Antimicrobial activity of essential oils: The possibilities of TLC-bioautography. Flavour Fragr. J. 2010, 25, 178–182. [Google Scholar] [CrossRef] [Scilit]
  32. Tuttobene, M.R.; Pérez, J.F.; Pavesi, E.; Mora, P.; Biancotti, D.; Cribb, P.; Altilio, M.; Müller, G.; Gramajo, H.; Tamagno, G.; et al. Light modulates important pathogenic determinants and virulence in ESKAPE pathogens Acinetobacter baumannii, Pseudomonas aeruginosa, and Staphylococcus aureus. J. Bacteriol. 2021, 203, e00566-20. [Google Scholar] [CrossRef] [Scilit]
  33. Hickey, M.E.; Lee, J.L. A comprehensive review of Vibrio (Listonella) anguillarum: Ecology, pathology and prevention. Rev. Aquacult 2018, 10, 585–610. [Google Scholar] [CrossRef] [Scilit]
  34. Fu, M.; Crous, P.W.; Bai, Q.; Zhang, P.F.; Xiang, J.; Guo, Y.S.; Zhao, F.F.; Yang, M.M.; Hong, N.; Xu, W.X.; et al. Colletotrichum species associated with anthracnose of Pyrus spp. in China. Persoonia 2019, 42, 1–35. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Kurt, S.; Uysal, A.; Soylu, E.M.; Kara, M.; Soylu, S. Characterization and pathogenicity of Fusarium solani associated with dry root rot of citrus in the eastern Mediterranean region of Turkey. J. Gen. Plant Pathol. 2020, 86, 326–332. [Google Scholar] [CrossRef] [Scilit]
  36. O’Donnell, K.; Ward, T.J.; Robert, V.A.R.G.; Crous, P.W.; Geiser, D.M.; Kang, S. DNA sequence-based identification of Fusarium: Current status and future directions. Phytoparasitica 2015, 43, 583–595. [Google Scholar] [CrossRef] [Scilit]
  37. Vakalounakis, D.J.; Wang, Z.; Fragkiadakis, G.A.; Skaracis, G.N.; Li, D.B. Characterization of Fusarium oxysporum isolates obtained from cucumber in China by pathogenicity, VCG, and RAPD. Plant Dis. 2004, 88, 645–649. [Google Scholar] [CrossRef] [Scilit]
  38. Zheng, H.; Zhong, Z.; Shi, M.; Zhang, L.; Lin, L.; Hong, Y.; Fang, T.; Zhu, Y.; Guo, J.; Zhang, L.; et al. Comparative genomic analysis revealed rapid differentiation in the pathogenicity-related gene repertoires between Pyricularia oryzae and Pyricularia penniseti isolated from a Pennisetum grass. BMC Genom. 2018, 19, 927. [Google Scholar] [CrossRef] [Scilit]
  39. Tao, L.; Jilin, J.; Jifen, J.; Zhijun, P.; Fuxian, L. Volatile constituents from Myricarubra cv. DingAo Orient Pearl and its antitumor activity. Nat. Prod. Res. Dev. 2014, 26, 1839–1842. [Google Scholar]
  40. Feng, B.; Chen, D.; Jin, R.; Li, E.; Li, P. Bioactivities evaluation of an endophytic bacterial strain Bacillus velezensis JRX-YG39 inhabiting wild grape. BMC Microbiol. 2022, 22, 170. [Google Scholar] [CrossRef] [Scilit]
  41. Ge, S.; Peng, W.; Li, D.; Mo, B.; Zhang, M.; Qin, D. Study on antibacterial molecular drugs in Eucalyptus granlla wood extractives by GC-MS. Pak. J. Pharm. Sci. 2015, 28, 1445–1448. [Google Scholar] [PubMed]
  42. Rajivgandhi, G.; Muneeswaran, T.; Maruthupandy, M.; Ramakritinan, C.M.; Saravanan, K.; Ravikumar, V.; Manoharan, N. Antibacterial and anticancer potential of marine endophytic actinomycetes Streptomyces coeruleorubidus GRG 4 (KY457708) compound against colistin resistant uropathogens and A549 lung cancer cells. Microb. Pathog. 2018, 125, 325–335. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. Ribeiro, V.P.; Arruda, C.; Aldana-Mejia, J.A.; Bastos, J.K.; Tripathi, S.K.; Khan, S.I.; Khan, I.A.; Ali, Z. Phytochemical, antiplasmodial, cytotoxic and antimicrobial evaluation of a southeast Brazilian Brown Propolis produced by Apis mellifera bees. Chem. Biodivers. 2021, 18, e2100288. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Mishra, R.; Kushveer, J.S.; Khan, M.I.K.; Pagal, S.; Meena, C.K.; Murali, A.; Dhayalan, A.; Venkateswara Sarma, V. 2,4-Di-tert-butylphenol isolated from an endophytic fungus, Daldinia eschscholtzii, reduces virulence and quorum sensing in Pseudomonas aeruginosa. Front. Microbiol. 2020, 11, 1668. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Konarzewska, Z.; Sliwinska-Wilczewska, S.; Felpeto, A.B.; Vasconcelos, V.; Latala, A. Assessment of the allelochemical activity and biochemical profile of different phenotypes of picocyanobacteria from the genus Synechococcus. Mar. Drugs 2020, 18, 179. [Google Scholar] [CrossRef] [Scilit]
  46. Mahmud, M.L.; Islam, S.; Biswas, S.; Mortuza, M.G.; Paul, G.K.; Uddin, M.S.; Akhtar, E.E.M.; Saleh, M.A.; Zaman, S.; Syed, A.; et al. Klebsiella pneumoniae volatile organic compounds (VOCs) protect Artemia salina from fish pathogen Aeromonas sp.: A combined in vitro, in vivo, and in silico approach. Microorganisms 2023, 11, 172. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  47. Mallik, S.; Dodia, H.; Ghosh, A.; Srinivasan, R.; Good, L.; Raghav, S.K.; Beuria, T.K. FtsE, the nucleotide binding domain of the ABC transporter homolog FtsEX, regulates septal PG synthesis in E. coli. Microbiol. Spectr. 2023, 11, e02863-22. [Google Scholar] [CrossRef] [Scilit]
  48. Casiraghi, A.; Suigo, L.; Valoti, E.; Straniero, V. Targeting bacterial cell division: A binding site-centered approach to the most promising inhibitors of the essential protein FtsZ. Antibiotics 2020, 9, 69. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  49. Rasamiravaka, T.; El Jaziri, M. Quorum-sensing mechanisms and bacterial response to antibiotics in P. aeruginosa. Curr. Microbiol. 2016, 73, 747–753. [Google Scholar] [CrossRef] [Scilit]
  50. Kuang, Z.; Bennett, R.C.; Lin, J.; Hao, Y.; Zhu, L.; Akinbi, H.T.; Lau, G.W. Surfactant phospholipids act as molecular switches for premature induction of quorum sensing-dependent virulence in Pseudomonas aeruginosa. Virulence 2020, 11, 1090–1107. [Google Scholar] [CrossRef] [Scilit]
  51. Andrews, S.C.; Robinson, A.K.; Rodriguez-Quinones, F. Bacterial iron homeostasis. FEMS Microbiol. Rev. 2003, 27, 215–237. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  52. Díaz-Pérez, S.P.; Solis, C.S.; López-Bucio, J.S.; Valdez Alarcón, J.J.; Villegas, J.; Reyes-De la Cruz, H.; Campos-Garcia, J. Pathogenesis in Pseudomonas aeruginosa PAO1 biofilm-associated is dependent on the pyoverdine and pyocyanin siderophores by quorum sensing modulation. Microb. Ecol. 2022, 86, 727–741. [Google Scholar] [CrossRef] [Scilit]
  53. Feng, W.; Han, X.; Hu, H.; Chang, M.; Ding, L.; Xiang, H.; Chen, Y.; Li, Y. 2D vanadium carbide MXenzyme to alleviate ROS-mediated inflammatory and neurodegenerative diseases. Nat. Commun. 2021, 12, 2203. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  54. Borisov, V.B.; Siletsky, S.A.; Nastasi, M.R.; Forte, E. ROS defense systems and terminal oxidases in bacteria. Antioxidants 2021, 10, 839. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  55. Chaves-Lopez, C.; Paparella, A.; Tofalo, R.; Suzzi, G. Proteolytic activity of Saccharomyces cerevisiae strains associated with Italian dry-fermented sausages in a model system. Int. J. Food Microbiol. 2011, 150, 50–58. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  56. Hoyland-Kroghsbo, N.M.; Paczkowski, J.; Mukherjee, S.; Broniewski, J.; Westra, E.; Bondy-Denomy, J.; Bassler, B.L. Quorum sensing controls the Pseudomonas aeruginosa CRISPR-Cas adaptive immune system. Proc. Natl. Acad. Sci. USA 2017, 114, 131–135. [Google Scholar] [CrossRef] [Scilit]
  57. Mandel, M.; Higa, A. Calcium-dependent bacteriophage DNA infection. J. Mol. Biol. 1970, 53, 159–162. [Google Scholar] [CrossRef] [Scilit]
  58. Saporito, P.; Vang Mouritzen, M.; Lobner-Olesen, A.; Jenssen, H. LL-37 fragments have antimicrobial activity against Staphylococcus epidermidis biofilms and wound healing potential in HaCaT cell line. J. Pept. Sci. 2018, 24, e3080. [Google Scholar] [CrossRef] [Scilit]
Figure 1. VOC-3.9 exhibits broad-spectrum inhibitory effects against various pathogenic bacteria and fungi. (A) VOC-3.9 possesses a prominent inhibitory effect against Pseudomonas aeruginosa PAO1 tested by a modified bioautography method. A total of 60 μL of sterile water and VOC-3.9 are added to silica gel plates for the control group and experimental group, respectively. The plates are then coated with LB solid medium containing pre-cultured P. aeruginosa PAO1 cells and incubated at 37 °C for 24 h. The presence or absence of antibacterial zones on the plates is visually observed. (B) VOC-3.9 displays obvious inhibitory effects on Gram-negative bacteria (including P. aeruginosa PAO1, Vibrio anguillarum, and Salmonella choleraesuis) at a concentration of 2.5 mg mL−1, cultured for 24 h at 37 °C or 28 °C, and a slight inhibitory effect on the Gram-positive bacterium Staphylococcus aureus. (C) VOC-3.9 exerts evident inhibitory effects on agricultural fungal pathogens, including Colletotrichum fioriniae, Fusarium solani, Fusarium oxysporum, and Pyricularia oryzae.
Figure 1. VOC-3.9 exhibits broad-spectrum inhibitory effects against various pathogenic bacteria and fungi. (A) VOC-3.9 possesses a prominent inhibitory effect against Pseudomonas aeruginosa PAO1 tested by a modified bioautography method. A total of 60 μL of sterile water and VOC-3.9 are added to silica gel plates for the control group and experimental group, respectively. The plates are then coated with LB solid medium containing pre-cultured P. aeruginosa PAO1 cells and incubated at 37 °C for 24 h. The presence or absence of antibacterial zones on the plates is visually observed. (B) VOC-3.9 displays obvious inhibitory effects on Gram-negative bacteria (including P. aeruginosa PAO1, Vibrio anguillarum, and Salmonella choleraesuis) at a concentration of 2.5 mg mL−1, cultured for 24 h at 37 °C or 28 °C, and a slight inhibitory effect on the Gram-positive bacterium Staphylococcus aureus. (C) VOC-3.9 exerts evident inhibitory effects on agricultural fungal pathogens, including Colletotrichum fioriniae, Fusarium solani, Fusarium oxysporum, and Pyricularia oryzae.
Marinedrugs 22 00233 g001
Figure 2. Determination of the composition of VOC-3.9 through gas chromatography-mass spectrometry (GC-MS). (A) Qualitative analysis of the components of VOC-3.9 using solid-phase microextraction (SPME) coupled with GC-MS. (B) Detail information of 14 identified volatile organic compounds within VOC-3.9 based on the GC-MS results shown in panel A. RT indicates retention times; CAS indicates chemical abstracts service number; MW indicates molecular weight. The compounds that have been previously reported to inhibit P. aeruginosa are indicated in bold text. The compounds that have not previously been detected in microorganisms are marked in italics.
Figure 2. Determination of the composition of VOC-3.9 through gas chromatography-mass spectrometry (GC-MS). (A) Qualitative analysis of the components of VOC-3.9 using solid-phase microextraction (SPME) coupled with GC-MS. (B) Detail information of 14 identified volatile organic compounds within VOC-3.9 based on the GC-MS results shown in panel A. RT indicates retention times; CAS indicates chemical abstracts service number; MW indicates molecular weight. The compounds that have been previously reported to inhibit P. aeruginosa are indicated in bold text. The compounds that have not previously been detected in microorganisms are marked in italics.
Marinedrugs 22 00233 g002
Figure 3. Antibacterial assays of six compounds within VOC-3.9 against P. aeruginosa PAO1. (A) 2-Hydroxy-iso-butyrophenone within VOC-3.9 shows significant antibacterial activity against P. aeruginosa PAO1 at concentrations above 2.4 mg mL−1. In comparison, the other five substances within VOC-3.9 at 5 mg mL−1 do not show evident inhibitory effects on the growth of P. aeruginosa PAO1 cultured at 37 °C for 24 h with a rotation speed of 150 rpm. The same amount of sterile water was added to the culture of P. aeruginosa PAO1 and the control. The compound name is indicated above each test tube. (B) TEM observation of the effect of 0.3 mg mL−1 of 2-Hydroxy-iso-butyrophenone on the morphology of P. aeruginosa PAO1 cells cultured at 37 °C for 16 h with a rotation speed of 150 rpm. P. aeruginosa PAO1 cells treated with the same amount of sterile water were used as the control.
Figure 3. Antibacterial assays of six compounds within VOC-3.9 against P. aeruginosa PAO1. (A) 2-Hydroxy-iso-butyrophenone within VOC-3.9 shows significant antibacterial activity against P. aeruginosa PAO1 at concentrations above 2.4 mg mL−1. In comparison, the other five substances within VOC-3.9 at 5 mg mL−1 do not show evident inhibitory effects on the growth of P. aeruginosa PAO1 cultured at 37 °C for 24 h with a rotation speed of 150 rpm. The same amount of sterile water was added to the culture of P. aeruginosa PAO1 and the control. The compound name is indicated above each test tube. (B) TEM observation of the effect of 0.3 mg mL−1 of 2-Hydroxy-iso-butyrophenone on the morphology of P. aeruginosa PAO1 cells cultured at 37 °C for 16 h with a rotation speed of 150 rpm. P. aeruginosa PAO1 cells treated with the same amount of sterile water were used as the control.
Marinedrugs 22 00233 g003
Figure 4. Microscopic and proteomic analyses of the effect of VOC-3.9 on the cell division process of P. aeruginosa PAO1. (A) TEM observation of the morphology of P. aeruginosa PAO1 cells that were cultured in the presence of 0.3 mg mL−1 VOC-3.9. P. aeruginosa PAO1 cells cultured in medium supplemented with the same amount of sterile water are used as the control. The bacterial cells were cultured at 37 °C for 16 h with a rotation speed of 150 rpm. The red arrows indicate cells of P. aeruginosa PAO1 with significant morphological changes. (B) Proteomic assays of P. aeruginosa PAO1 cells that, respectively, cultured in the presence of 0.375 mg mL−1 and 0.75 mg mL−1 VOC-3.9 at 37 °C for 16 h with a rotation speed of 150 rpm. In the heatmap, the expression upregulation folds of Fts-related proteins associated with the cell division process compared to those in the control group are indicated. The expressions of corresponding proteins in P. aeruginosa PAO1 cells cultured in medium supplemented with the same amount of sterile water are used as the control. (C) TEM observation of P. aeruginosa PAO1 cells with overexpression of Fts-related proteins. Morphology of P. aeruginosa PAO1 cells with the overexpression of FtsB (panels c and d), FtsL (panels e and f), FtsI (panels g and h), FtsE (panels i and j), and FtsQ (panels k and l). Morphology of P. aeruginosa PAO1 cells transformed with the empty expression vector is used as the control (panels a and b).
Figure 4. Microscopic and proteomic analyses of the effect of VOC-3.9 on the cell division process of P. aeruginosa PAO1. (A) TEM observation of the morphology of P. aeruginosa PAO1 cells that were cultured in the presence of 0.3 mg mL−1 VOC-3.9. P. aeruginosa PAO1 cells cultured in medium supplemented with the same amount of sterile water are used as the control. The bacterial cells were cultured at 37 °C for 16 h with a rotation speed of 150 rpm. The red arrows indicate cells of P. aeruginosa PAO1 with significant morphological changes. (B) Proteomic assays of P. aeruginosa PAO1 cells that, respectively, cultured in the presence of 0.375 mg mL−1 and 0.75 mg mL−1 VOC-3.9 at 37 °C for 16 h with a rotation speed of 150 rpm. In the heatmap, the expression upregulation folds of Fts-related proteins associated with the cell division process compared to those in the control group are indicated. The expressions of corresponding proteins in P. aeruginosa PAO1 cells cultured in medium supplemented with the same amount of sterile water are used as the control. (C) TEM observation of P. aeruginosa PAO1 cells with overexpression of Fts-related proteins. Morphology of P. aeruginosa PAO1 cells with the overexpression of FtsB (panels c and d), FtsL (panels e and f), FtsI (panels g and h), FtsE (panels i and j), and FtsQ (panels k and l). Morphology of P. aeruginosa PAO1 cells transformed with the empty expression vector is used as the control (panels a and b).
Marinedrugs 22 00233 g004
Figure 5. Proteomic and biochemical analyses of the effects of VOC-3.9 on the quorum-sensing systems and associated biofilm formation and dispersion processes of P. aeruginosa PAO1. (A) Proteomic analysis of the downregulating effects of VOC-3.9 (at 0.375 and 0.75 mg mL−1) on the expressions of key proteins related to the quorum sensing (QS) systems of P. aeruginosa PAO1. The expressions of corresponding proteins in P. aeruginosa PAO1 cells cultured in medium supplemented with the same amount of sterile water are used as the control. (B) Observation of the biofilm formation of P. aeruginosa PAO1 at 37 °C for 24 h in the absence or presence of 0.375 mg mL−1 VOC-3.9 (panel a). Observation of the biofilm dispersion of P. aeruginosa PAO1 at 37 °C for 24 h in the absence or presence of 0.75 mg mL−1 VOC-3.9 (panel b). In the control group, the same amount of sterile water is added to the culture of P. aeruginosa PAO1. (C) Quantitative assays of anti-biofilm activity of 0.375 mg mL−1 VOC-3.9 and biofilm dispersion activity of 0.75 mg mL−1 VOC-3.9 against P. aeruginosa PAO1 based on the results shown in panel (B). The data were presented as means ± SD of three experiments. ** p ≤ 0.01, *** p ≤ 0.001.
Figure 5. Proteomic and biochemical analyses of the effects of VOC-3.9 on the quorum-sensing systems and associated biofilm formation and dispersion processes of P. aeruginosa PAO1. (A) Proteomic analysis of the downregulating effects of VOC-3.9 (at 0.375 and 0.75 mg mL−1) on the expressions of key proteins related to the quorum sensing (QS) systems of P. aeruginosa PAO1. The expressions of corresponding proteins in P. aeruginosa PAO1 cells cultured in medium supplemented with the same amount of sterile water are used as the control. (B) Observation of the biofilm formation of P. aeruginosa PAO1 at 37 °C for 24 h in the absence or presence of 0.375 mg mL−1 VOC-3.9 (panel a). Observation of the biofilm dispersion of P. aeruginosa PAO1 at 37 °C for 24 h in the absence or presence of 0.75 mg mL−1 VOC-3.9 (panel b). In the control group, the same amount of sterile water is added to the culture of P. aeruginosa PAO1. (C) Quantitative assays of anti-biofilm activity of 0.375 mg mL−1 VOC-3.9 and biofilm dispersion activity of 0.75 mg mL−1 VOC-3.9 against P. aeruginosa PAO1 based on the results shown in panel (B). The data were presented as means ± SD of three experiments. ** p ≤ 0.01, *** p ≤ 0.001.
Marinedrugs 22 00233 g005
Figure 6. Proteomic and biochemical analyses of the effects of VOC-3.9 on the iron uptake process and ROS accumulation of P. aeruginosa PAO1. (A) Proteomic analysis of the downregulating effects of VOC-3.9 (at 0.375 and 0.75 mg mL−1) on the expressions of key proteins related to iron uptake, phenazine synthesis, and reactive oxygen species (ROS)-scavenging enzyme of P. aeruginosa PAO1. The expressions of corresponding proteins in P. aeruginosa PAO1 cells cultured in medium supplemented with the same amount of sterile water are used as the control. (B) Detection of intracellular ferrous ion concentrations of P. aeruginosa PAO1 treated with 0.3 mg mL−1 of VOC-3.9 at 37 °C for 16 h with a rotation of 150 rpm, respectively. The intracellular ferrous ion concentration of P. aeruginosa PAO1 treated with the same amount of sterile water is used as the control. (C) Determination of intracellular ROS levels of P. aeruginosa PAO1 treated with 0.3 mg mL−1 VOC-3.9 at 37 °C for 16 h with a rotation of 150 rpm, respectively. The intracellular ROS accumulation level of P. aeruginosa PAO1 treated with the same amount of sterile water is used as the control. The data were presented as means ± SD of three experiments *** p ≤ 0.001.
Figure 6. Proteomic and biochemical analyses of the effects of VOC-3.9 on the iron uptake process and ROS accumulation of P. aeruginosa PAO1. (A) Proteomic analysis of the downregulating effects of VOC-3.9 (at 0.375 and 0.75 mg mL−1) on the expressions of key proteins related to iron uptake, phenazine synthesis, and reactive oxygen species (ROS)-scavenging enzyme of P. aeruginosa PAO1. The expressions of corresponding proteins in P. aeruginosa PAO1 cells cultured in medium supplemented with the same amount of sterile water are used as the control. (B) Detection of intracellular ferrous ion concentrations of P. aeruginosa PAO1 treated with 0.3 mg mL−1 of VOC-3.9 at 37 °C for 16 h with a rotation of 150 rpm, respectively. The intracellular ferrous ion concentration of P. aeruginosa PAO1 treated with the same amount of sterile water is used as the control. (C) Determination of intracellular ROS levels of P. aeruginosa PAO1 treated with 0.3 mg mL−1 VOC-3.9 at 37 °C for 16 h with a rotation of 150 rpm, respectively. The intracellular ROS accumulation level of P. aeruginosa PAO1 treated with the same amount of sterile water is used as the control. The data were presented as means ± SD of three experiments *** p ≤ 0.001.
Marinedrugs 22 00233 g006
Figure 7. A proposed model of VOC-3.9 inhibiting the growth of P. aeruginosa PAO1. This model describes three major physiological processes (including QS systems associated with biofilm formation/dispersion, cell division, and iron uptake processes) in P. aeruginosa PAO1 that are primarily affected by VOC-3.9. The diagram presents four QS-system signal networks in P. aeruginosa PAO1 and their respective autoinducers. The dashed and solid lines represent different transmembrane transport processes. The connection between Fts-related proteins with sPG synthesis is indicated. Various pathways for extracellular Fe3+ uptake by P. aeruginosa PAO1 are shown, including siderophores: pyoverdine and pyochelin (Marinedrugs 22 00233 i001), Heme uptake pathway: Has, Phu systems (Marinedrugs 22 00233 i002), Feo uptake pathways (Marinedrugs 22 00233 i003), and heterologous uptake pathway (Marinedrugs 22 00233 i004).
Figure 7. A proposed model of VOC-3.9 inhibiting the growth of P. aeruginosa PAO1. This model describes three major physiological processes (including QS systems associated with biofilm formation/dispersion, cell division, and iron uptake processes) in P. aeruginosa PAO1 that are primarily affected by VOC-3.9. The diagram presents four QS-system signal networks in P. aeruginosa PAO1 and their respective autoinducers. The dashed and solid lines represent different transmembrane transport processes. The connection between Fts-related proteins with sPG synthesis is indicated. Various pathways for extracellular Fe3+ uptake by P. aeruginosa PAO1 are shown, including siderophores: pyoverdine and pyochelin (Marinedrugs 22 00233 i001), Heme uptake pathway: Has, Phu systems (Marinedrugs 22 00233 i002), Feo uptake pathways (Marinedrugs 22 00233 i003), and heterologous uptake pathway (Marinedrugs 22 00233 i004).
Marinedrugs 22 00233 g007
Table 1. Primers used for protein overexpression in P. aeruginosa PAO1.
Table 1. Primers used for protein overexpression in P. aeruginosa PAO1.
Prim NameSequence (5′-3′)
ftsZ-fTACGAATTCAATGTTTGAACTGGTCGATAACA (EcoRΙ, underlined)
ftsZ-rAGAGGATCCTCAATCGGCCTGACGAC (BamHΙ, underlined)
ftsL-fTACGAATTCAATGAGCCGTCTCTTCGTCAAG (EcoRΙ, underlined)
ftsL-rAGAGGATCCTCATGGCGCCACCATCCT (BamHΙ, underlined)
ftsB-fTACGAATTCTTGAGGTTACGTAGCCCCTACT (EcoRΙ, underlined)
ftsB-rAGAGGATCCTCACTTGGCGAGCTGGTAGA (BamHΙ, underlined)
ftsI-fTACGAATTCATGAAACTGAATTATTTCCAGGGCG (EcoRΙ, underlined)
ftsI-rAGAGGATCCTCAGCCACGCCCTCCTTTTG (BamHΙ, underlined)
ftsE-fTACGAATTCATGATCCGCTTCGAGCAGGT (EcoRΙ, underlined)
ftsE-rAGAGGATCCTCAGGCCTCATCCTCACGGTCA (BamHΙ, underlined)
ftsQ-fTACGAATTCATGAATGGCGTACTGCTCCG (EcoRΙ, underlined)
ftsQ-rAGAGGATCCTCACTGCACGGCGCTGG (BamHΙ, underlined)
Gm-fAATATTGAAAAAGGAAGAGTATGTTACGCAGCAGCAACGA
Gm-rGAGTAAACTTGGTCTGACAGTTAGGTGGCGGTACTTGGGT
pUCP18-fCTGTCAGACCAAGTTTACTCATATATACTT
pUCP18-rACTCTTCCTTTTTCAATATTATTGAAGCAT
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Hu, Y.; Liu, G.; Sun, C.; Wu, S. Volatile Organic Compounds Produced by a Deep-Sea Bacterium Efficiently Inhibit the Growth of Pseudomonas aeruginosa PAO1. Mar. Drugs 2024, 22, 233. https://doi.org/10.3390/md22050233

AMA Style

Hu Y, Liu G, Sun C, Wu S. Volatile Organic Compounds Produced by a Deep-Sea Bacterium Efficiently Inhibit the Growth of Pseudomonas aeruginosa PAO1. Marine Drugs. 2024; 22(5):233. https://doi.org/10.3390/md22050233

Chicago/Turabian Style

Hu, Yuanyuan, Ge Liu, Chaomin Sun, and Shimei Wu. 2024. "Volatile Organic Compounds Produced by a Deep-Sea Bacterium Efficiently Inhibit the Growth of Pseudomonas aeruginosa PAO1" Marine Drugs 22, no. 5: 233. https://doi.org/10.3390/md22050233

APA Style

Hu, Y., Liu, G., Sun, C., & Wu, S. (2024). Volatile Organic Compounds Produced by a Deep-Sea Bacterium Efficiently Inhibit the Growth of Pseudomonas aeruginosa PAO1. Marine Drugs, 22(5), 233. https://doi.org/10.3390/md22050233

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop