Volatile Organic Compounds Produced by a Deep-Sea Bacterium Efficiently Inhibit the Growth of Pseudomonas aeruginosa PAO1
Abstract
1. Introduction
2. Results and Discussion
2.1. The Deep-Sea Bacterium Spongiibacter Nanhainus CSC3.9 Produces Volatile Organic Compounds with Antibacterial and Antifungal Activities
2.2. Identification of Active Compounds against P. aeruginosa PAO1 within VOC-3.9
2.3. VOC-3.9 Disorders the Cell Division Process of P. aeruginosa PAO1
2.4. VOC-3.9 Impedes the Quorum Sensing (QS) Systems Associated with the Biofilm Formation and Dispersion Processes of P. aeruginosa PAO1
2.5. VOC-3.9 Hinders Iron Uptake in P. aeruginosa PAO1
3. Materials and Methods
3.1. Bacterial Strains and Culture Conditions
3.2. Collection of Volatile Organic Compounds (VOCs)
3.3. Activity Test of VOC-3.9
3.4. Antibacterial and Antifungal Assays of VOC-3.9
3.5. Characterization of VOC-3.9 by GC-MS
3.6. Activity Assays of Single Components of VOC-3.9 against P. aeruginosa PAO1
3.7. Transmission Electron Microscopy (TEM) Observation
3.8. Proteomics Analysis
3.9. Protein Overexpression in P. aeruginosa PAO1
3.10. The Inhibition and Dispersion Assays of Biofilm Formation in P. aeruginosa PAO1 Treated with VOC-3.9
3.11. Detection of Intracellular Ferrous Ion Concentrations in P. aeruginosa PAO1
3.12. Detection of Intracellular Reactive Oxygen Species (ROS) Levels in P. aeruginosa PAO1
3.13. Statistical Analysis
3.14. Data Availability
4. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Yang, H.; Jin, L.; Zhao, D.; Lian, Z.; Appu, M.; Huang, J.; Zhang, Z. Antibacterial and antibiofilm formation activities of pyridinium-based cationic pillar[5]arene against Pseudomonas aeruginosa. J. Agric. Food Chem. 2021, 69, 4276–4283. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dolan, S.K.; Wijaya, A.; Kohlstedt, M.; Glaser, L.; Brear, P.; Silva-Rocha, R.; Wittmann, C.; Welch, M. Systems-wide dissection of organic acid assimilation in Pseudomonas aeruginosa reveals a novel path to underground metabolism. mBio 2022, 13, e02541-22. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pang, Z.; Raudonis, R.; Glick, B.R.; Lin, T.J.; Cheng, Z. Antibiotic resistance in Pseudomonas aeruginosa: Mechanisms and alternative therapeutic strategies. Biotechnol. Adv. 2019, 37, 177–192. [Google Scholar] [CrossRef] [Scilit]
- Szamosvari, D.; Savchenko, V.; Badouin, N.; Bottcher, T. Beyond iron: Metal-binding activity of the Pseudomonas quinolone signal-motif. Org. Biomol. Chem. 2023, 21, 5158–5163. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barrios, A.F.; Covo, V.; Medina, L.M.; Vives-Florez, M.; Achenie, L. Quorum quenching analysis in Pseudomonas aeruginosa and Escherichia coli: Network topology and inhibition mechanism effect on the optimized inhibitor dose. Bioprocess. Biosyst. Eng. 2009, 32, 545–556. [Google Scholar] [CrossRef] [Scilit]
- Feng, Q.; Luo, L.; Chen, X.; Zhang, K.; Fang, F.; Xue, Z.; Li, C.; Cao, J.; Luo, J. Facilitating biofilm formation of Pseudomonas aeruginosa via exogenous N-Acy-L-homoserine lactones stimulation: Regulation on the bacterial motility, adhesive ability and metabolic activity. Bioresour. Technol. 2021, 341, 125727. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kashammer, L.; van den Ent, F.; Jeffery, M.; Jean, N.L.; Hale, V.L.; Lowe, J. Cryo-EM structure of the bacterial divisome core complex and antibiotic target FtsWIQBL. Nat. Microbiol. 2023, 8, 1149–1159. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kureisaite-Ciziene, D.; Varadajan, A.; McLaughlin, S.H.; Glas, M.; Monton Silva, A.; Luirink, R.; Mueller, C.; den Blaauwen, T.; Grossmann, T.N.; Luirink, J.; et al. Structural analysis of the interaction between the bacterial cell division proteins FtsQ and FtsB. mBio 2018, 9, e01346-18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marmont, L.S.; Bernhardt, T.G. A conserved subcomplex within the bacterial cytokinetic ring activates cell wall synthesis by the FtsW-FtsI synthase. Proc. Natl. Acad. Sci. USA 2020, 117, 23879–23885. [Google Scholar] [CrossRef] [Scilit]
- Wu, S.; Liu, G.; Jin, W.; Xiu, P.; Sun, C. Antibiofilm and anti-infection of a marine bacterial exopolysaccharide against Pseudomonas aeruginosa. Front. Microbiol. 2016, 7, 102. [Google Scholar] [CrossRef] [Scilit]
- Chakraborty, K.; Kizhakkekalam, V.K.; Joy, M.; Dhara, S. Difficidin class of polyketide antibiotics from marine macroalga-associated Bacillus as promising antibacterial agents. Appl. Microbiol. Biotechnol. 2021, 105, 6395–6408. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Orfali, R.; Perveen, S.; Al-Taweel, A.; Ahmed, A.F.; Majrashi, N.; Alluhay, K.; Khan, A.; Luciano, P.; Taglialatela-Scafati, O. Penipyranicins A-C: Antibacterial methylpyran polyketides from a hydrothermal spring sediment Penicillium sp. J. Nat. Prod. 2020, 83, 3591–3597. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Saha, M.; Fink, P. Algal volatiles-the overlooked chemical language of aquatic primary producers. Biol. Rev. Camb. Philos. Soc. 2022, 97, 2162–2173. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- da Cruz, E.P.; Jansen, E.T.; Costa, L.D.; de Souza, E.J.D.; Fonseca, L.M.; Gandra, E.A.; Zavareze, E.D.; Dias, A.R.G. Use of red onion skin (Allium cepa L.) in the production of bioactive extract and application in water-absorbing cryogels based on corn starch. Food Hydrocoll. 2023, 145, 109133. [Google Scholar] [CrossRef] [Scilit]
- Almeida, O.A.C.; de Araujo, N.O.; Dias, B.H.S.; de Sant’Anna Freitas, C.; Coerini, L.F.; Ryu, C.M.; de Castro Oliveira, J.V. The power of the smallest: The inhibitory activity of microbial volatile organic compounds against phytopathogens. Front. Microbiol. 2022, 13, 951130. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Baiome, B.A.; Ye, X.; Yuan, Z.; Gaafar, Y.Z.A.; Melak, S.; Cao, H. Identification of volatile organic compounds produced by Xenorhabdus indica strain AB and investigation of their antifungal activities. Appl. Environ. Microbiol. 2022, 88, e00155-22. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Choudoir, M.; Rossabi, S.; Gebert, M.; Helmig, D.; Fierer, N. A phylogenetic and functional perspective on volatile organic compound production by Actinobacteria. mSystems 2019, 4, e00295-18. [Google Scholar] [CrossRef] [Scilit]
- Garrido, A.; Atencio, L.A.; Bethancourt, R.; Bethancourt, A.; Guzmán, H.; Gutiérrez, M.; Durant-Archibold, A.A. Antibacterial activity of volatile organic compounds produced by the octocoral-associated bacteria Bacillus sp. BO53 and Pseudoalteromonas sp. GA327. Antibiotics 2020, 9, 923. [Google Scholar] [CrossRef] [Scilit]
- Hummadi, E.H.; Cetin, Y.; Demirbek, M.; Kardar, N.M.; Khan, S.; Coates, C.J.; Eastwood, D.C.; Dudley, E.; Maffeis, T.; Loveridge, J.; et al. Antimicrobial volatiles of the insect pathogen Metarhizium brunneum. J. Fungi 2022, 8, 326. [Google Scholar] [CrossRef] [Scilit]
- Grahovac, J.; Pajcin, I.; Vlajkov, V. Bacillus VOCs in the context of biological control. Antibiotics 2023, 12, 581. [Google Scholar] [CrossRef] [Scilit]
- Berlinck, R.G.S.; Monteiro, A.F.; Bertonha, A.F.; Bernardi, D.I.; Gubiani, J.R.; Slivinski, J.; Michaliski, L.F.; Tonon, L.A.C.; Venancio, V.A.; Freire, V.F. Approaches for the isolation and identification of hydrophilic, light-sensitive, volatile and minor natural products. Nat. Prod. Rep. 2019, 36, 981–1004. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Achyuthan, K.E.; Harper, J.C.; Manginell, R.P.; Moorman, M.W. Volatile metabolites emission by in vivo microalgae-an overlooked opportunity? Metabolites 2017, 7, 39. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zheng, R.; Wang, C.; Cai, R.; Shan, Y.; Sun, C. Mechanisms of nucleic acid degradation and high hydrostatic pressure tolerance of a novel deep-sea wall-less bacterium. mBio 2023, 14, e00958-23. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, W.; Wang, J.; Huang, D.; Cheng, W.; Shao, Z.; Cai, M.; Zheng, L.; Yu, Z.; Zhang, J. Volatile organic compounds from Bacillus aryabhattai MCCC 1K02966 with multiple modes against Meloidogyne incognita. Molecules 2021, 27, 103. [Google Scholar] [CrossRef] [Scilit]
- Khatami, S.H.; Karami, S.; Siahkouhi, H.R.; Taheri-Anganeh, M.; Fathi, J.; Aghazadeh Ghadim, M.B.; Taghvimi, S.; Shabaninejad, Z.; Tondro, G.; Karami, N.; et al. Aptamer-based biosensors for Pseudomonas aeruginosa detection. Mol. Cell Probes 2022, 66, 101865. [Google Scholar] [CrossRef] [Scilit]
- Shan, Y.; Liu, G.; Cai, R.; Liu, R.; Zheng, R.; Sun, C. A deep-sea bacterium senses blue light via a BLUF-dependent pathway. mSystems 2022, 7, e01279-21. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Veselova, M.A.; Plyuta, V.A.; Khmel, I.A. Volatile compounds of bacterial origin: Structure, biosynthesis, and biological activity. Microbiology 2019, 88, 261–274. [Google Scholar] [CrossRef] [Scilit]
- Wang, E.; Liu, X.; Si, Z.; Li, X.; Bi, J.; Dong, W.; Chen, M.; Wang, S.; Zhang, J.; Song, A.; et al. Volatile organic compounds from rice rhizosphere bacteria inhibit growth of the pathogen Rhizoctonia solani. Agriculture 2021, 11, 368. [Google Scholar] [CrossRef] [Scilit]
- Zhao, Q.; Cao, J.; Cai, X.; Wang, J.; Kong, F.; Wang, D.; Wang, J. Antagonistic activity of volatile organic compounds produced by acid-tolerant Pseudomonas protegens CLP-6 as biological fumigants to control tobacco bacterial wilt caused by Ralstonia solanacearum. Appl. Environ. Microbiol. 2023, 89, e01892-22. [Google Scholar] [CrossRef] [Scilit]
- Ahmad, I.; Beg, A.Z. Antimicrobial and phytochemical studies on 45 Indian medicinal plants against multi-drug resistant human pathogens. J. Ethnopharmacol. 2001, 74, 113–123. [Google Scholar] [CrossRef] [Scilit]
- Horváth, G.; Jámbor, N.; Végh, A.; Böszörményi, A.; Lemberkovics, É.; Héthelyi, É.; Kovács, K.; Kocsis, B. Antimicrobial activity of essential oils: The possibilities of TLC-bioautography. Flavour Fragr. J. 2010, 25, 178–182. [Google Scholar] [CrossRef] [Scilit]
- Tuttobene, M.R.; Pérez, J.F.; Pavesi, E.; Mora, P.; Biancotti, D.; Cribb, P.; Altilio, M.; Müller, G.; Gramajo, H.; Tamagno, G.; et al. Light modulates important pathogenic determinants and virulence in ESKAPE pathogens Acinetobacter baumannii, Pseudomonas aeruginosa, and Staphylococcus aureus. J. Bacteriol. 2021, 203, e00566-20. [Google Scholar] [CrossRef] [Scilit]
- Hickey, M.E.; Lee, J.L. A comprehensive review of Vibrio (Listonella) anguillarum: Ecology, pathology and prevention. Rev. Aquacult 2018, 10, 585–610. [Google Scholar] [CrossRef] [Scilit]
- Fu, M.; Crous, P.W.; Bai, Q.; Zhang, P.F.; Xiang, J.; Guo, Y.S.; Zhao, F.F.; Yang, M.M.; Hong, N.; Xu, W.X.; et al. Colletotrichum species associated with anthracnose of Pyrus spp. in China. Persoonia 2019, 42, 1–35. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kurt, S.; Uysal, A.; Soylu, E.M.; Kara, M.; Soylu, S. Characterization and pathogenicity of Fusarium solani associated with dry root rot of citrus in the eastern Mediterranean region of Turkey. J. Gen. Plant Pathol. 2020, 86, 326–332. [Google Scholar] [CrossRef] [Scilit]
- O’Donnell, K.; Ward, T.J.; Robert, V.A.R.G.; Crous, P.W.; Geiser, D.M.; Kang, S. DNA sequence-based identification of Fusarium: Current status and future directions. Phytoparasitica 2015, 43, 583–595. [Google Scholar] [CrossRef] [Scilit]
- Vakalounakis, D.J.; Wang, Z.; Fragkiadakis, G.A.; Skaracis, G.N.; Li, D.B. Characterization of Fusarium oxysporum isolates obtained from cucumber in China by pathogenicity, VCG, and RAPD. Plant Dis. 2004, 88, 645–649. [Google Scholar] [CrossRef] [Scilit]
- Zheng, H.; Zhong, Z.; Shi, M.; Zhang, L.; Lin, L.; Hong, Y.; Fang, T.; Zhu, Y.; Guo, J.; Zhang, L.; et al. Comparative genomic analysis revealed rapid differentiation in the pathogenicity-related gene repertoires between Pyricularia oryzae and Pyricularia penniseti isolated from a Pennisetum grass. BMC Genom. 2018, 19, 927. [Google Scholar] [CrossRef] [Scilit]
- Tao, L.; Jilin, J.; Jifen, J.; Zhijun, P.; Fuxian, L. Volatile constituents from Myricarubra cv. DingAo Orient Pearl and its antitumor activity. Nat. Prod. Res. Dev. 2014, 26, 1839–1842. [Google Scholar]
- Feng, B.; Chen, D.; Jin, R.; Li, E.; Li, P. Bioactivities evaluation of an endophytic bacterial strain Bacillus velezensis JRX-YG39 inhabiting wild grape. BMC Microbiol. 2022, 22, 170. [Google Scholar] [CrossRef] [Scilit]
- Ge, S.; Peng, W.; Li, D.; Mo, B.; Zhang, M.; Qin, D. Study on antibacterial molecular drugs in Eucalyptus granlla wood extractives by GC-MS. Pak. J. Pharm. Sci. 2015, 28, 1445–1448. [Google Scholar] [PubMed]
- Rajivgandhi, G.; Muneeswaran, T.; Maruthupandy, M.; Ramakritinan, C.M.; Saravanan, K.; Ravikumar, V.; Manoharan, N. Antibacterial and anticancer potential of marine endophytic actinomycetes Streptomyces coeruleorubidus GRG 4 (KY457708) compound against colistin resistant uropathogens and A549 lung cancer cells. Microb. Pathog. 2018, 125, 325–335. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ribeiro, V.P.; Arruda, C.; Aldana-Mejia, J.A.; Bastos, J.K.; Tripathi, S.K.; Khan, S.I.; Khan, I.A.; Ali, Z. Phytochemical, antiplasmodial, cytotoxic and antimicrobial evaluation of a southeast Brazilian Brown Propolis produced by Apis mellifera bees. Chem. Biodivers. 2021, 18, e2100288. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mishra, R.; Kushveer, J.S.; Khan, M.I.K.; Pagal, S.; Meena, C.K.; Murali, A.; Dhayalan, A.; Venkateswara Sarma, V. 2,4-Di-tert-butylphenol isolated from an endophytic fungus, Daldinia eschscholtzii, reduces virulence and quorum sensing in Pseudomonas aeruginosa. Front. Microbiol. 2020, 11, 1668. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Konarzewska, Z.; Sliwinska-Wilczewska, S.; Felpeto, A.B.; Vasconcelos, V.; Latala, A. Assessment of the allelochemical activity and biochemical profile of different phenotypes of picocyanobacteria from the genus Synechococcus. Mar. Drugs 2020, 18, 179. [Google Scholar] [CrossRef] [Scilit]
- Mahmud, M.L.; Islam, S.; Biswas, S.; Mortuza, M.G.; Paul, G.K.; Uddin, M.S.; Akhtar, E.E.M.; Saleh, M.A.; Zaman, S.; Syed, A.; et al. Klebsiella pneumoniae volatile organic compounds (VOCs) protect Artemia salina from fish pathogen Aeromonas sp.: A combined in vitro, in vivo, and in silico approach. Microorganisms 2023, 11, 172. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mallik, S.; Dodia, H.; Ghosh, A.; Srinivasan, R.; Good, L.; Raghav, S.K.; Beuria, T.K. FtsE, the nucleotide binding domain of the ABC transporter homolog FtsEX, regulates septal PG synthesis in E. coli. Microbiol. Spectr. 2023, 11, e02863-22. [Google Scholar] [CrossRef] [Scilit]
- Casiraghi, A.; Suigo, L.; Valoti, E.; Straniero, V. Targeting bacterial cell division: A binding site-centered approach to the most promising inhibitors of the essential protein FtsZ. Antibiotics 2020, 9, 69. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rasamiravaka, T.; El Jaziri, M. Quorum-sensing mechanisms and bacterial response to antibiotics in P. aeruginosa. Curr. Microbiol. 2016, 73, 747–753. [Google Scholar] [CrossRef] [Scilit]
- Kuang, Z.; Bennett, R.C.; Lin, J.; Hao, Y.; Zhu, L.; Akinbi, H.T.; Lau, G.W. Surfactant phospholipids act as molecular switches for premature induction of quorum sensing-dependent virulence in Pseudomonas aeruginosa. Virulence 2020, 11, 1090–1107. [Google Scholar] [CrossRef] [Scilit]
- Andrews, S.C.; Robinson, A.K.; Rodriguez-Quinones, F. Bacterial iron homeostasis. FEMS Microbiol. Rev. 2003, 27, 215–237. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Díaz-Pérez, S.P.; Solis, C.S.; López-Bucio, J.S.; Valdez Alarcón, J.J.; Villegas, J.; Reyes-De la Cruz, H.; Campos-Garcia, J. Pathogenesis in Pseudomonas aeruginosa PAO1 biofilm-associated is dependent on the pyoverdine and pyocyanin siderophores by quorum sensing modulation. Microb. Ecol. 2022, 86, 727–741. [Google Scholar] [CrossRef] [Scilit]
- Feng, W.; Han, X.; Hu, H.; Chang, M.; Ding, L.; Xiang, H.; Chen, Y.; Li, Y. 2D vanadium carbide MXenzyme to alleviate ROS-mediated inflammatory and neurodegenerative diseases. Nat. Commun. 2021, 12, 2203. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Borisov, V.B.; Siletsky, S.A.; Nastasi, M.R.; Forte, E. ROS defense systems and terminal oxidases in bacteria. Antioxidants 2021, 10, 839. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chaves-Lopez, C.; Paparella, A.; Tofalo, R.; Suzzi, G. Proteolytic activity of Saccharomyces cerevisiae strains associated with Italian dry-fermented sausages in a model system. Int. J. Food Microbiol. 2011, 150, 50–58. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hoyland-Kroghsbo, N.M.; Paczkowski, J.; Mukherjee, S.; Broniewski, J.; Westra, E.; Bondy-Denomy, J.; Bassler, B.L. Quorum sensing controls the Pseudomonas aeruginosa CRISPR-Cas adaptive immune system. Proc. Natl. Acad. Sci. USA 2017, 114, 131–135. [Google Scholar] [CrossRef] [Scilit]
- Mandel, M.; Higa, A. Calcium-dependent bacteriophage DNA infection. J. Mol. Biol. 1970, 53, 159–162. [Google Scholar] [CrossRef] [Scilit]
- Saporito, P.; Vang Mouritzen, M.; Lobner-Olesen, A.; Jenssen, H. LL-37 fragments have antimicrobial activity against Staphylococcus epidermidis biofilms and wound healing potential in HaCaT cell line. J. Pept. Sci. 2018, 24, e3080. [Google Scholar] [CrossRef] [Scilit]






), Heme uptake pathway: Has, Phu systems (
), Feo uptake pathways (
), and heterologous uptake pathway (
).
), Heme uptake pathway: Has, Phu systems (
), Feo uptake pathways (
), and heterologous uptake pathway (
).
| Prim Name | Sequence (5′-3′) |
|---|---|
| ftsZ-f | TACGAATTCAATGTTTGAACTGGTCGATAACA (EcoRΙ, underlined) |
| ftsZ-r | AGAGGATCCTCAATCGGCCTGACGAC (BamHΙ, underlined) |
| ftsL-f | TACGAATTCAATGAGCCGTCTCTTCGTCAAG (EcoRΙ, underlined) |
| ftsL-r | AGAGGATCCTCATGGCGCCACCATCCT (BamHΙ, underlined) |
| ftsB-f | TACGAATTCTTGAGGTTACGTAGCCCCTACT (EcoRΙ, underlined) |
| ftsB-r | AGAGGATCCTCACTTGGCGAGCTGGTAGA (BamHΙ, underlined) |
| ftsI-f | TACGAATTCATGAAACTGAATTATTTCCAGGGCG (EcoRΙ, underlined) |
| ftsI-r | AGAGGATCCTCAGCCACGCCCTCCTTTTG (BamHΙ, underlined) |
| ftsE-f | TACGAATTCATGATCCGCTTCGAGCAGGT (EcoRΙ, underlined) |
| ftsE-r | AGAGGATCCTCAGGCCTCATCCTCACGGTCA (BamHΙ, underlined) |
| ftsQ-f | TACGAATTCATGAATGGCGTACTGCTCCG (EcoRΙ, underlined) |
| ftsQ-r | AGAGGATCCTCACTGCACGGCGCTGG (BamHΙ, underlined) |
| Gm-f | AATATTGAAAAAGGAAGAGTATGTTACGCAGCAGCAACGA |
| Gm-r | GAGTAAACTTGGTCTGACAGTTAGGTGGCGGTACTTGGGT |
| pUCP18-f | CTGTCAGACCAAGTTTACTCATATATACTT |
| pUCP18-r | ACTCTTCCTTTTTCAATATTATTGAAGCAT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hu, Y.; Liu, G.; Sun, C.; Wu, S. Volatile Organic Compounds Produced by a Deep-Sea Bacterium Efficiently Inhibit the Growth of Pseudomonas aeruginosa PAO1. Mar. Drugs 2024, 22, 233. https://doi.org/10.3390/md22050233
Hu Y, Liu G, Sun C, Wu S. Volatile Organic Compounds Produced by a Deep-Sea Bacterium Efficiently Inhibit the Growth of Pseudomonas aeruginosa PAO1. Marine Drugs. 2024; 22(5):233. https://doi.org/10.3390/md22050233
Chicago/Turabian StyleHu, Yuanyuan, Ge Liu, Chaomin Sun, and Shimei Wu. 2024. "Volatile Organic Compounds Produced by a Deep-Sea Bacterium Efficiently Inhibit the Growth of Pseudomonas aeruginosa PAO1" Marine Drugs 22, no. 5: 233. https://doi.org/10.3390/md22050233
APA StyleHu, Y., Liu, G., Sun, C., & Wu, S. (2024). Volatile Organic Compounds Produced by a Deep-Sea Bacterium Efficiently Inhibit the Growth of Pseudomonas aeruginosa PAO1. Marine Drugs, 22(5), 233. https://doi.org/10.3390/md22050233

