Helicobacter pylori cagA, vacA, iceA and babA Genotypes from Peruvian Patients with Gastric Intestinal Metaplasia
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Population and Design
2.2. H. pylori Culture Conditions
2.3. PCR Amplification and Typing
2.4. Statistical Analysis
3. Results
3.1. Patient Demographics
3.2. cagA Genotypes and EPIYA Motifs
3.3. vacA Genotypes
3.4. iceA and babA2 Genotypes
3.5. Relation of Virulence Genotypes with IM
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef] [Scilit]
- Tran, B.; Global Burden of Disease Cancer Collaboration. Global, Regional, and National Cancer Incidence, Mortality, Years of Life Lost, Years Lived With Disability, and Disability-Adjusted Life-Years for 29 Cancer Groups, 1990 to 2017: A Systematic Analysis for the Global Burden of Disease Study. JAMA Oncol. 2019, 5, 1749–1768. [Google Scholar] [CrossRef] [Scilit]
- Lopez, M.J.; Carbajal, J.; Alfaro, A.L.; Saravia, L.G.; Zanabria, D.; Araujo, J.M.; Quispe, L.; Zevallos, A.; Buleje, J.L.; Cho, C.E.; et al. Characteristics of gastric cancer around the world. Crit. Rev. Oncol. Hematol. 2023, 181, 103841. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- INEN; Registro de Cáncer de Lima Metropolitana. Estudio de Incidencia y Mortalidad 2013–2015. Available online: https://portal.inen.sld.pe/ (accessed on 5 October 2023).
- Tirado-Hurtado, I.; Carlos, C.; Lancho, L.; Alfaro, A.; Ponce, R.; Schwarz, L.J.; Torres, L.; Ayudant, M.; Pinto, J.A.; Fajardo, W. Helicobacter pylori: History and facts in Peru. Crit. Rev. Oncol. Hematol. 2019, 134, 22–30. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Castaneda, C.A.; Castillo, M.; Chavez, I.; Barreda, F.; Suarez, N.; Nieves, J.; Bernabe, L.A.; Valdivia, D.; Ruiz, E.; Dias-Neto, E.; et al. Prevalence of Helicobacter pylori Infection, Its Virulent Genotypes, and Epstein-Barr Virus in Peruvian Patients with Chronic Gastritis and Gastric Cancer. J. Glob. Oncol. 2019, 5, 1–9. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Correa, P.; Piazuelo, M.B. Natural history of Helicobacter pylori infection. Dig. Liver Dis. 2008, 40, 490–496. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Correa, P.; Piazuelo, M.B. The gastric precancerous cascade. J. Dig. Dis. 2012, 13, 2–9. [Google Scholar] [CrossRef] [Scilit]
- Rugge, M.; Capelle, L.G.; Cappellesso, R.; Nitti, D.; Kuipers, E.J. Precancerous lesions in the stomach: From biology to clinical patient management. Best. Pract. Res. Clin. Gastroenterol. 2013, 27, 205–223. [Google Scholar] [CrossRef] [Scilit]
- Mladenova, I. Clinical Relevance of Helicobacter pylori Infection. J. Clin. Med. 2021, 10, 3473. [Google Scholar] [CrossRef] [Scilit]
- van Doorn, L.J.; Figueiredo, C.; Rossau, R.; Jannes, G.; van Asbroek, M.; Sousa, J.C.; Carneiro, F.; Quint, W.G. Typing of Helicobacter pylori vacA gene and detection of cagA gene by PCR and reverse hybridization. J. Clin. Microbiol. 1998, 36, 1271–1276. [Google Scholar] [CrossRef] [Scilit]
- Pormohammad, A.; Ghotaslou, R.; Leylabadlo, H.E.; Nasiri, M.J.; Dabiri, H.; Hashemi, A. Risk of gastric cancer in association with Helicobacter pylori different virulence factors: A systematic review and meta-analysis. Microb. Pathog. 2018, 118, 214–219. [Google Scholar] [CrossRef] [Scilit]
- Kabamba, E.T.; Tuan, V.P.; Yamaoka, Y. Genetic populations and virulence factors of Helicobacter pylori. Infect. Genet. Evol. 2018, 60, 109–116. [Google Scholar] [CrossRef] [Scilit]
- Huang, X.; Deng, Z.; Zhang, Q.; Li, W.; Wang, B.; Li, M. Relationship between the iceA gene of Helicobacter pylori and clinical outcomes. Ther. Clin. Risk Manag. 2016, 12, 1085–1092. [Google Scholar] [CrossRef] [Scilit]
- Ansari, S.; Yamaoka, Y. Helicobacter pylori babA in adaptation for gastric colonization. World J. Gastroenterol. 2017, 23, 4158–4169. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shiota, S.; Watada, M.; Matsunari, O.; Iwatani, S.; Suzuki, R.; Yamaoka, Y. Helicobacter pylori iceA, clinical outcomes, and correlation with cagA: A meta-analysis. PLoS ONE 2012, 7, e30354. [Google Scholar] [CrossRef] [Scilit]
- Boehnke, K.F.; Valdivieso, M.; Bussalleu, A.; Sexton, R.; Thompson, K.C.; Osorio, S.; Novoa Reyes, I.; Crowley, J.J.; Baker, L.H.; Xi, C. Antibiotic resistance among Helicobacter pylori clinical isolates in Lima, Peru. Infect. Drug Resist. 2017, 10, 85–90. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gutierrez-Escobar, A.J.; Velapatino, B.; Borda, V.; Rabkin, C.S.; Tarazona-Santos, E.; Cabrera, L.; Cok, J.; Hooper, C.C.; Jahuira-Arias, H.; Herrera, P.; et al. Identification of New Helicobacter pylori Subpopulations in Native Americans and Mestizos From Peru. Front. Microbiol. 2020, 11, 601839. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Malfertheiner, P.; Megraud, F.; Rokkas, T.; Gisbert, J.P.; Liou, J.M.; Schulz, C.; Gasbarrini, A.; Hunt, R.H.; Leja, M.; O’Morain, C.; et al. Management of Helicobacter pylori infection: The Maastricht VI/Florence consensus report. Gut 2022, 71, 1724–1762. [Google Scholar] [CrossRef] [Scilit]
- Stolte, M.; Meining, A. The updated Sydney system: Classification and grading of gastritis as the basis of diagnosis and treatment. Can. J. Gastroenterol. 2001, 15, 591–598. [Google Scholar] [CrossRef] [Scilit]
- Guzman, J.; Castillo, D.; Ojeda, M.; Sauvain, M. Antimicrobial susceptibility and mutations in the 23S rRNA gen of Helicobacter pylori in dyspeptic patients. Rev. Peru. Med. Exp. Salud Publica 2019, 36, 270–274. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lehours, P.; Megraud, F. Culture-Based Antimicrobial Susceptibility Testing for Helicobacter pylori. Methods Mol. Biol. 2021, 2283, 45–50. [Google Scholar] [CrossRef] [Scilit]
- Van Doorn, L.J.; Figueiredo, C.; Sanna, R.; Plaisier, A.; Schneeberger, P.; Boer, W.; Quint, W. Clinical relevance of the cagA, vacA, and iceA status of Helicobacter pylori. Gastroenterology 1998, 115, 58–66. [Google Scholar] [CrossRef] [Scilit]
- Rodriguez Gomez, E.R.; Otero Regino, W.; Monterrey, P.A.; Trespalacios Rangel, A.A. cagA gene EPIYA motif genetic characterization from Colombian Helicobacter pylori isolates: Standardization of a molecular test for rapid clinical laboratory detection. PLoS ONE 2020, 15, e0227275. [Google Scholar] [CrossRef] [Scilit]
- Atherton, J.C.; Cao, P.; Peek, R.M., Jr.; Tummuru, M.K.; Blaser, M.J.; Cover, T.L. Mosaicism in vacuolating cytotoxin alleles of Helicobacter pylori. Association of specific vacA types with cytotoxin production and peptic ulceration. J. Biol. Chem. 1995, 270, 17771–17777. [Google Scholar] [CrossRef] [Scilit]
- Erzin, Y.; Koksal, V.; Altun, S.; Dobrucali, A.; Aslan, M.; Erdamar, S.; Dirican, A.; Kocazeybek, B. Prevalence of Helicobacter pylori vacA, cagA, cagE, iceA, babA2 genotypes and correlation with clinical outcome in Turkish patients with dyspepsia. Helicobacter 2006, 11, 574–580. [Google Scholar] [CrossRef] [Scilit]
- Atherton, J.C.; Cover, T.L.; Twells, R.J.; Morales, M.R.; Hawkey, C.J.; Blaser, M.J. Simple and accurate PCR-based system for typing vacuolating cytotoxin alleles of Helicobacter pylori. J. Clin. Microbiol. 1999, 37, 2979–2982. [Google Scholar] [CrossRef] [Scilit]
- Melo-Narváez, M.C.; Rojas-Rengifo, D.F.; Jiménez-Soto, L.F.; Delgado, M.d.P.; Mendoza de Molano, B.; Vera-Chamorro, J.F.; Jaramillo, C. Genotipificación de cagA y de la región intermedia de vacA en cepas de Helicobacter pylori aisladas de pacientes adultos colombianos y su asociación con enfermedades gástricas. Rev. Colomb. Gastroenterol. 2018, 33, 103–110. [Google Scholar] [CrossRef] [Scilit]
- Latifi-Navid, S.; Mohammadi, S.; Maleki, P.; Zahri, S.; Yazdanbod, A.; Siavoshi, F.; Massarrat, S. Helicobacter pylori vacA d1/-i1 genotypes and geographic differentiation between high and low incidence areas of gastric cancer in Iran. Arch. Iran. Med. 2013, 16, 330–337. [Google Scholar]
- Rhead, J.L.; Letley, D.P.; Mohammadi, M.; Hussein, N.; Mohagheghi, M.A.; Eshagh Hosseini, M.; Atherton, J.C. A new Helicobacter pylori vacuolating cytotoxin determinant, the intermediate region, is associated with gastric cancer. Gastroenterology 2007, 133, 926–936. [Google Scholar] [CrossRef] [Scilit]
- Ogiwara, H.; Sugimoto, M.; Ohno, T.; Vilaichone, R.K.; Mahachai, V.; Graham, D.Y.; Yamaoka, Y. Role of deletion located between the intermediate and middle regions of the Helicobacter pylori vacA gene in cases of gastroduodenal diseases. J. Clin. Microbiol. 2009, 47, 3493–3500. [Google Scholar] [CrossRef] [Scilit]
- Chomvarin, C.; Namwat, W.; Chaicumpar, K.; Mairiang, P.; Sangchan, A.; Sripa, B.; Tor-Udom, S.; Vilaichone, R.K. Prevalence of Helicobacter pylori vacA, cagA, cagE, iceA and babA2 genotypes in Thai dyspeptic patients. Int. J. Infect. Dis. 2008, 12, 30–36. [Google Scholar] [CrossRef] [Scilit]
- Mizushima, T.; Sugiyama, T.; Komatsu, Y.; Ishizuka, J.; Kato, M.; Asaka, M. Clinical relevance of the babA2 genotype of Helicobacter pylori in Japanese clinical isolates. J. Clin. Microbiol. 2001, 39, 2463–2465. [Google Scholar] [CrossRef] [Scilit]
- Kinoshita, H.; Hayakawa, Y.; Koike, K. Metaplasia in the Stomach-Precursor of Gastric Cancer? Int. J. Mol. Sci. 2017, 18, 2063. [Google Scholar] [CrossRef] [Scilit]
- Toyoshima, O.; Nishizawa, T.; Koike, K. Endoscopic Kyoto classification of Helicobacter pylori infection and gastric cancer risk diagnosis. World J. Gastroenterol. 2020, 26, 466–477. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Piazuelo, M.B.; Bravo, L.E.; Mera, R.M.; Camargo, M.C.; Bravo, J.C.; Delgado, A.G.; Washington, M.K.; Rosero, A.; Garcia, L.S.; Realpe, J.L.; et al. The Colombian Chemoprevention Trial: 20-Year Follow-Up of a Cohort of Patients With Gastric Precancerous Lesions. Gastroenterology 2021, 160, 1106–1117. [Google Scholar] [CrossRef] [Scilit]
- Shichijo, S.; Uedo, N.; Michida, T. Detection of Early Gastric Cancer after Helicobacter pylori Eradication. Digestion 2022, 103, 54–61. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kodama, M.; Murakami, K.; Okimoto, T.; Abe, H.; Sato, R.; Ogawa, R.; Mizukami, K.; Shiota, S.; Nakagawa, Y.; Soma, W.; et al. Histological characteristics of gastric mucosa prior to Helicobacter pylori eradication may predict gastric cancer. Scand. J. Gastroenterol. 2013, 48, 1249–1256. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Atherton, J.C. H. pylori virulence factors. Br. Med. Bull. 1998, 54, 105–120. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ferreira, R.M.; Machado, J.C.; Figueiredo, C. Clinical relevance of Helicobacter pylori vacA and cagA genotypes in gastric carcinoma. Best. Pract. Res. Clin. Gastroenterol. 2014, 28, 1003–1015. [Google Scholar] [CrossRef] [Scilit]
- Huang, J.Q.; Zheng, G.F.; Sumanac, K.; Irvine, E.J.; Hunt, R.H. Meta-analysis of the relationship between cagA seropositivity and gastric cancer. Gastroenterology 2003, 125, 1636–1644. [Google Scholar] [CrossRef] [Scilit]
- Matos, J.I.; de Sousa, H.A.; Marcos-Pinto, R.; Dinis-Ribeiro, M. Helicobacter pylori cagA and vacA genotypes and gastric phenotype: A meta-analysis. Eur. J. Gastroenterol. Hepatol. 2013, 25, 1431–1441. [Google Scholar] [CrossRef] [Scilit]
- Nogueira, C.; Figueiredo, C.; Carneiro, F.; Gomes, A.T.; Barreira, R.; Figueira, P.; Salgado, C.; Belo, L.; Peixoto, A.; Bravo, J.C.; et al. Helicobacter pylori genotypes may determine gastric histopathology. Am. J. Pathol. 2001, 158, 647–654. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Basso, D.; Zambon, C.F.; Letley, D.P.; Stranges, A.; Marchet, A.; Rhead, J.L.; Schiavon, S.; Guariso, G.; Ceroti, M.; Nitti, D.; et al. Clinical relevance of Helicobacter pylori cagA and vacA gene polymorphisms. Gastroenterology 2008, 135, 91–99. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ferreira, R.M.; Machado, J.C.; Leite, M.; Carneiro, F.; Figueiredo, C. The number of Helicobacter pylori cagA EPIYA C tyrosine phosphorylation motifs influences the pattern of gastritis and the development of gastric carcinoma. Histopathology 2012, 60, 992–998. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Beltran-Anaya, F.O.; Poblete, T.M.; Roman-Roman, A.; Reyes, S.; de Sampedro, J.; Peralta-Zaragoza, O.; Rodriguez, M.A.; del Moral-Hernandez, O.; Illades-Aguiar, B.; Fernandez-Tilapa, G. The EPIYA-ABCC motif pattern in cagA of Helicobacter pylori is associated with peptic ulcer and gastric cancer in Mexican population. BMC Gastroenterol. 2014, 14, 223. [Google Scholar] [CrossRef] [Scilit]
- Vianna, J.S.; Ramis, I.B.; Halicki, P.C.; Gastal, O.L.; Silva, R.A.; Junior, J.S.; Dos Santos, D.M.; Chaves, A.L.; Juliano, C.R.; Jannke, H.A.; et al. Detection of Helicobacter pylori cagA EPIYA in gastric biopsy specimens and its relation to gastric diseases. Diagn. Microbiol. Infect. Dis. 2015, 83, 89–92. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Higashi, H.; Tsutsumi, R.; Fujita, A.; Yamazaki, S.; Asaka, M.; Azuma, T.; Hatakeyama, M. Biological activity of the Helicobacter pylori virulence factor cagA is determined by variation in the tyrosine phosphorylation sites. Proc. Natl. Acad. Sci. USA 2002, 99, 14428–14433. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yamaoka, Y.; Kodama, T.; Gutierrez, O.; Kim, J.G.; Kashima, K.; Graham, D.Y. Relationship between Helicobacter pylori iceA, cagA, and vacA status and clinical outcome: Studies in four different countries. J. Clin. Microbiol. 1999, 37, 2274–2279. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Boyanova, L.; Boyanova, L.; Hadzhiyski, P.; Kandilarov, N.; Yordanov, D.; Gergova, R.; Markovska, R. Mixed (multiple-genotype) Helicobacter pylori infections in Bulgarian patients. Diagn. Microbiol. Infect. Dis. 2023, 107, 116073. [Google Scholar] [CrossRef] [Scilit]
- Sugimoto, M.; Yamaoka, Y. The association of vacA genotype and Helicobacter pylori-related disease in Latin American and African populations. Clin. Microbiol. Infect. 2009, 15, 835–842. [Google Scholar] [CrossRef] [Scilit]
- El Khadir, M.; Boukhris Alaoui, S.; Benajah, D.A.; Ibrahimi, S.A.; Chbani, L.; El Abkari, M.; Bennani, B. vacA genotypes and cagA-EPIYA-C motifs of Helicobacter pylori and gastric histopathological lesions. Int. J. Cancer 2020, 147, 3206–3214. [Google Scholar] [CrossRef] [Scilit]
- Bakhti, S.Z.; Latifi-Navid, S.; Mohammadi, S.; Zahri, S.; Bakhti, F.S.; Feizi, F.; Yazdanbod, A.; Siavoshi, F. Relevance of Helicobacter pylori vacA 3’-end Region Polymorphism to Gastric Cancer. Helicobacter 2016, 21, 305–316. [Google Scholar] [CrossRef] [Scilit]
- Peek, R.M., Jr.; Thompson, S.A.; Donahue, J.P.; Tham, K.T.; Atherton, J.C.; Blaser, M.J.; Miller, G.G. Adherence to gastric epithelial cells induces expression of a Helicobacter pylori gene, iceA, that is associated with clinical outcome. Proc. Assoc. Am. Physicians 1998, 110, 531–544. [Google Scholar]
- Arevalo-Galvis, A.; Trespalacios-Rangell, A.A.; Otero, W.; Mercado-Reyes, M.M.; Poutou-Pinales, R.A. Prevalence of cagA, vacA, babA2 and iceA genes in H. pylori strains isolated from Colombian patients with functional dyspepsia. Pol. J. Microbiol. 2012, 61, 33–40. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Figueiredo, C.; Van Doorn, L.J.; Nogueira, C.; Soares, J.M.; Pinho, C.; Figueira, P.; Quint, W.G.; Carneiro, F. Helicobacter pylori genotypes are associated with clinical outcome in Portuguese patients and show a high prevalence of infections with multiple strains. Scand. J. Gastroenterol. 2001, 36, 128–135. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gonzalez-Vazquez, R.; Herrera-Gonzalez, S.; Cordova-Espinoza, M.G.; Zuniga, G.; Giono-Cerezo, S.; Hernandez-Hernandez, J.M.; Leon-Avila, G. Helicobacter pylori: Detection of iceA1 and iceA2 genes in the same strain in Mexican isolates. Arch. Med. Res. 2012, 43, 339–346. [Google Scholar] [CrossRef] [Scilit]
- Gatti, L.L.; Modena, J.L.; Payao, S.L.; Smith Mde, A.; Fukuhara, Y.; Modena, J.L.; de Oliveira, R.B.; Brocchi, M. Prevalence of Helicobacter pylori cagA, iceA and babA2 alleles in Brazilian patients with upper gastrointestinal diseases. Acta Trop. 2006, 100, 232–240. [Google Scholar] [CrossRef] [Scilit]
- Paniagua, G.L.; Monroy, E.; Rodriguez, R.; Arroniz, S.; Rodriguez, C.; Cortes, J.L.; Camacho, A.; Negrete, E.; Vaca, S. Frequency of vacA, cagA and babA2 virulence markers in Helicobacter pylori strains isolated from Mexican patients with chronic gastritis. Ann. Clin. Microbiol. Antimicrob. 2009, 8, 14. [Google Scholar] [CrossRef] [Scilit]
- Torres, L.E.; Melian, K.; Moreno, A.; Alonso, J.; Sabatier, C.A.; Hernandez, M.; Bermudez, L.; Rodriguez, B.L. Prevalence of vacA, cagA and babA2 genes in Cuban Helicobacter pylori isolates. World J. Gastroenterol. 2009, 15, 204–210. [Google Scholar] [CrossRef] [Scilit]
- Boren, T.; Falk, P.; Roth, K.A.; Larson, G.; Normark, S. Attachment of Helicobacter pylori to human gastric epithelium mediated by blood group antigens. Science 1993, 262, 1892–1895. [Google Scholar] [CrossRef] [Scilit]
- Chen, M.Y.; He, C.Y.; Meng, X.; Yuan, Y. Association of Helicobacter pylori babA2 with peptic ulcer disease and gastric cancer. World J. Gastroenterol. 2013, 19, 4242–4251. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kpoghomou, M.A.; Wang, J.; Wang, T.; Jin, G. Association of Helicobacter pylori babA2 gene and gastric cancer risk: A meta-analysis. BMC Cancer 2020, 20, 465. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gonzalez, C.A.; Figueiredo, C.; Lic, C.B.; Ferreira, R.M.; Pardo, M.L.; Ruiz Liso, J.M.; Alonso, P.; Sala, N.; Capella, G.; Sanz-Anquela, J.M. Helicobacter pylori cagA and vacA genotypes as predictors of progression of gastric preneoplastic lesions: A long-term follow-up in a high-risk area in Spain. Am. J. Gastroenterol. 2011, 106, 867–874. [Google Scholar] [CrossRef] [Scilit]
- Sterbenc, A.; Jarc, E.; Poljak, M.; Homan, M. Helicobacter pylori virulence genes. World J. Gastroenterol. 2019, 25, 4870–4884. [Google Scholar] [CrossRef] [Scilit]
- Chmiela, M.; Karwowska, Z.; Gonciarz, W.; Allushi, B.; Staczek, P. Host pathogen interactions in Helicobacter pylori related gastric cancer. World J. Gastroenterol. 2017, 23, 1521–1540. [Google Scholar] [CrossRef] [Scilit]
- Hanafiah, A.; Lopes, B.S. Genetic diversity and virulence characteristics of Helicobacter pylori isolates in different human ethnic groups. Infect. Genet. Evol. 2020, 78, 104135. [Google Scholar] [CrossRef] [Scilit]
| Gene | Region or Allele | Primers (5′–3′) | Amplified Product (bp) | PCR Protocol |
|---|---|---|---|---|
| cagA | Constant 5′ | F: TTGACC AACAACCACAAACCGAAG R: CTTCCCTTAATTGCGAGATTCC | 183 | 1 cycle of 95 °C for 9 min, 40 cycles of 95 °C for 30 s, 50 °C for 45 s and 72 °C for 45 s, and 1 cycle of 72 °C for 5 min [23] |
| Variable 3′ | F: ACCCTAGTCGGTAATGGG R: GCTTTAGCTTCTGAYACYGC | 400 (AB) 500 (ABC) 600 (ABCC) 700 (ABCCC) | 1 cycle of 95 °C for 10 min, 39 cycles of 95 °C for 30 s, 52.3 °C for 30 s and 72 °C for 36 s, and 1 cycle of 72 °C for 5 min [24] | |
| vacA | Signal | F: ATGGAAATACAACAAACACAC R: CTGCTTGAATGCGCCAAAC | 259 (s1) 286 (s2) | 1 cycle of 95 °C for 2 min, 40 cycles of 95 °C for 30 s, 52 °C for 30 s and 72 °C for 30 s, and 1 cycle of 72 °C for 5 min [25,26] |
| Signal (sub) | Fs1a: GTCAGCATCACACCGCAAC Fs1b: AGCGCCATACCGCAAGAG Fs1c: TTAGTTTCTCTCGCTTTAGTRGGGYT R: CTGCTTGAATGCGCCAAAC | 190 (s1a) 187 (s1b) 220 (s1c) | 1 cycle of 95 °C for 2 min, 35 cycles of 95 °C for 60 s, 52 °C for 60 s and 72 °C for 60 s, and 1 cycle of 72 °C for 5 min [25,26] | |
| Middle | F: CCATCTGTCCAATCAAGCGAG R: GCGTCTAAATAATTCCAAGG | 570 (m1) 645 (m2) | 1 cycle of 95 °C for 9 min, 40 cycles of 95 °C for 30 s, 52 °C for 30 s and 72 °C for 30 s, and 1 cycle of 72 °C for 5 min [27] | |
| Intermediate (i1) | F: GTTGGGATTGGGGGAATGCCCG R: TTAATTTAACGCTGTTTGAAG | 426 | 1 cycle of 95 °C for 4 min, 35 cycles of 95 °C for 30 s, 55 °C for 60 s and 72 °C for 30 s, and 1 cycle of 72 °C for 5 min [28,29,30] | |
| Intermediate (i2) | F: GTTGGGATTGGGGGAATGCCG R: GATCAACGCTCTGATTTGA | 432 | 1 cycle of 95 °C for 4 min, 35 cycles of 95 °C for 30 s, 55 °C for 60 s and 72 °C for 30 s, and 1 cycle of 72 °C for 5 min [28,29,30] | |
| Deletion 81bp | F: ACTAATATTGGCACACTGGATTTG R: CTCGCTTGATTGGACAGATTG | 367–379 (d1) 298 (d2) | 1 cycle of 95 °C for 2 min, 35 cycles of 95 °C for 30 s, 53 °C for 60 s and 72 °C for 30 s, and 1 cycle of 72 °C for 5 min [31] | |
| iceA | iceA1 | F: GTGTTTTTAACCAAAGTATC R: CTATAGCCASTYTCTTTGCA | 247 (A1) | 1 cycle of 95 °C for 2 min, 40 cycles of 94 °C for 30 s, 50 °C for 30 s and 72 °C for 30 s, and 1 cycle of 72 °C for 5 min [23,32] |
| iceA2 | F: GTTGGGTATATCACAATTTAT R: TTRCCCTATTTTCTAGTAGGT | 229 (A2) | 1 cycle of 95 °C for 2 min, 40 cycles of 94 °C for 30 s, 50 °C for 30 s and 72 °C for 30 s, and 1 cycle of 72 °C for 5 min [23,32] | |
| babA | babA2 | F: AATCCAAAAAGGAGAAAAAGTATGAAA R: TGTTAGTGATTTCGGTGTAGGACA | 832 | 1 cycle of 95 °C for 5 min, 35 cycles of 92 °C for 60 s, 52 °C for 60 s and 72 °C for 60 s, and 1 cycle of 72 °C for 5 min [26,33] |
| N (%) | Bivariate Analysis | Regression Model 1 | ||||||
|---|---|---|---|---|---|---|---|---|
| CNAG (n = 97, 61.4%) N (%) | IM (n = 61, 38.6%) N (%) | p Value | RP | 95% CI | p Value | |||
| Sex | Female | 111 (70.3) | 73 (65.7) | 38 (34.3) | 0.086 | Ref. | ||
| Male | 47 (29.7) | 24 (51.1) | 23 (48.9) | 1.42 | 0.97–2.11 | 0.073 | ||
| <35 years | 19 (12.1) | 15 (78.9) | 4 (21.1) | Ref. | ||||
| Age | 35–50 years | 46 (29.1) | 36 (78.3) | 10 (21.7) | 0.001 | 1.03 | 0.36–2.89 | 0.951 |
| >50 years | 93 (58.8) | 46 (49.5) | 47 (50.5) | 2.40 | 0.97–5.88 | 0.056 | ||
| Genotype | N (%) | Bivariate Analysis | Regression Model 3 | |||||
|---|---|---|---|---|---|---|---|---|
| CNAG (n = 97, 61.4%) N (%) | IM (n = 61, 38.6%) N (%) | p Value | RP | 95% CI | p Value | |||
| 1.000 | Ref. | |||||||
| CagA | CagA positive | 158 (100.0) | 97 (61.4) | 61 (38.6) | - | - | - | |
| 0.206 2 | ||||||||
| EPIYA motifs | ABC | 108 (68.4) | 71 (65.7) | 37 (34.3) | Ref. | |||
| AB | 6 (3.8) | 4 (83.3) | 1 (16.7) | 0.48 | 0.07–2.98 | 0.436 | ||
| AB/ABC | 5 (3.2) | 3 (60.0) | 2 (40.0) | 1.16 | 0.38–3.53 | 0.784 | ||
| ABC/ABCC | 28 (17.7) | 13 (46.4) | 15 (53.6) | 1.56 | 1.02–2.41 | 0.043 | ||
| ABC/ABCC/ABCCC | 11 (6.9) | 5 (45.5) | 6 (54.5) | 1.59 | 0.87–2.91 | 0.130 | ||
| 0.120 2 | ||||||||
| vacAs | vacAs2 | 8 (5.1) | 7 (87.5) | 1 (12.5) | Ref. | |||
| vacAs1 | 150 (94.9) | 90 (60.0) | 60 (40.0) | 3.19 | 0.51–20.34 | 0.218 | ||
| 0.036 | ||||||||
| vacAs1 | vacAs1a | 76 (48.1) | 43 (56.6) | 33 (43.4) | Ref. | |||
| vacAs1a/s1b | 34 (21.5) | 28 (82.4) | 6 (17.6) | 0.40 | 0.18–0.88 | 0.022 | ||
| vacAs1a/s1c | 24 (15.2) | 13 (54.2) | 11 (45.8) | 1.05 | 0.63–1.75 | 0.834 | ||
| vacAs1a/s1b/s1c | 24 (15.2) | 13 (54.2) | 11 (54.2) | 1.05 | 0.63–1.75 | 0.834 | ||
| 0.009 | ||||||||
| vacAm | vacAm2 | 29 (18.3) | 24 (82.7) | 5 (17.3) | Ref. | |||
| vacAm1 | 129 (81.7) | 73 (56.6) | 56 (43.4) | 2.52 | 1.11–5.74 | 0.028 | ||
| 0.007 | ||||||||
| vacAi | vacAi2 | 44 (27.9) | 35 (79.6) | 9 (20.4) | Ref. | |||
| vacAi1 | 101 (63.9) | 53 (52.5) | 48 (47.5) | 2.32 | 1.25–4.32 | 0.008 | ||
| vacAi1/i2 | 13 (8.2) | 9 (69.2) | 4 (30.8) | 1.50 | 0.55–4.11 | 0.426 | ||
| 0.785 | ||||||||
| vacAd | vacAd2 | 46 (29.1) | 29 (63.1) | 17 (36.9) | Ref. | |||
| vacAd1 | 112 (70.9) | 68 (60.7) | 44 (39.3) | 1.06 | 0.68–1.65 | 0.787 | ||
| 0.007 | ||||||||
| iceA | iceA2 | 15 (9.5) | 5 (33.3) | 10 (66.7) | Ref. | |||
| iceA1 | 33 (20.9) | 16 (48.5) | 17 (51.5) | 0.77 | 0.47–1.26 | 0.301 | ||
| iceA1/iceA2 | 110 (69.6) | 76 (69.1) | 34 (30.9) | 0.46 | 0.29–0.73 | 0.001 | ||
| 0.522 | ||||||||
| babA2 | babA2 negative | 75 (47.5) | 48 (64.1) | 27 (35.9) | Ref. | |||
| babA2 positive | 83 (52.5) | 49 (59.1) | 34 (40.9) | 1.13 | 0.76–1.69 | 0.525 | ||
| 0.007 | ||||||||
| cagA+/vacAs1m1 | Other genotypes 1 | 33 (20.9) | 27 (81.2) | 6 (18.2) | Ref. | |||
| cagA+/vacAs1m1 | 125 (79.1) | 70 (56.0) | 55 (44.0) | 2.42 | 1.14–5.13 | 0.021 | ||
| 0.010 | ||||||||
| cagA+/vacAs1am1 | Other genotypes 1 | 100 (63.3) | 69 (69.0) | 31 (31.0) | Ref. | |||
| cagA+/vacAs1am1 | 58 (36.7) | 28 (48.3) | 30 (51.7) | 1.67 | 1.13–2.45 | 0.009 | ||
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Guzmán, J.; Castillo, D.; González-Siccha, A.D.; Bussalleu, A.; Trespalacios-Rangel, A.A.; Lescano, A.G.; Sauvain, M. Helicobacter pylori cagA, vacA, iceA and babA Genotypes from Peruvian Patients with Gastric Intestinal Metaplasia. Cancers 2024, 16, 1476. https://doi.org/10.3390/cancers16081476
Guzmán J, Castillo D, González-Siccha AD, Bussalleu A, Trespalacios-Rangel AA, Lescano AG, Sauvain M. Helicobacter pylori cagA, vacA, iceA and babA Genotypes from Peruvian Patients with Gastric Intestinal Metaplasia. Cancers. 2024; 16(8):1476. https://doi.org/10.3390/cancers16081476
Chicago/Turabian StyleGuzmán, Jesús, Denis Castillo, Anabel D. González-Siccha, Alejandro Bussalleu, Alba A. Trespalacios-Rangel, Andres G. Lescano, and Michel Sauvain. 2024. "Helicobacter pylori cagA, vacA, iceA and babA Genotypes from Peruvian Patients with Gastric Intestinal Metaplasia" Cancers 16, no. 8: 1476. https://doi.org/10.3390/cancers16081476
APA StyleGuzmán, J., Castillo, D., González-Siccha, A. D., Bussalleu, A., Trespalacios-Rangel, A. A., Lescano, A. G., & Sauvain, M. (2024). Helicobacter pylori cagA, vacA, iceA and babA Genotypes from Peruvian Patients with Gastric Intestinal Metaplasia. Cancers, 16(8), 1476. https://doi.org/10.3390/cancers16081476

