Ag4CL3 Related to Lignin Synthesis in Apium graveolens L.
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Material and Experimental Design
2.2. Determination of Lignin Content
2.3. Total RNA Extraction and cDNA Synthesis
2.4. Bioinformatics Analysis
2.5. Overexpression Vector Construction and A. thaliana Transformation
2.6. Real-Time Quantitative PCR Analysis
2.7. Statistical Analysis
3. Results
3.1. Changes of Lignin Contents
3.2. Analysis of the Ag4CL3 Sequence
3.3. Ag4CL3 Gene Expression Analysis
3.4. Identification of Transgenic A. thaliana and Overexpression of the Ag4CL3 Upregulated the Lignin Content in Arabidopsis
3.5. Expression of Lignin Biosynthesis Related Genes in A. thaliana Plants
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Fu, N.; Wang, P.Y.; Liu, X.D.; Shen, H.L. Use of EST-SSR markers for evaluating genetic diversity and fingerprinting celery (Apium graveolens L.) cultivars. Molecules 2014, 19, 1939–1955. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hostetler, G.L.; Riedl, K.M.; Schwartz, S.J. Effects of food formulation and thermal processing on flavones in celery and chamomile. Food Chem. 2013, 141, 1406–1411. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, M.Y.; Hou, X.L.; Wang, F.; Tan, G.F.; Xu, Z.S.; Xiong, A.S. Advances in the research of celery, an important Apiaceae vegetable crop. Crit. Rev. Biotechnol. 2018, 38, 172–183. [Google Scholar] [CrossRef] [Scilit]
- Duan, A.Q.; Tao, J.P.; Jia, L.L.; Tan, G.F.; Liu, J.X.; Li, T.; Chen, L.Z.; Su, X.J.; Feng, K.; Xu, Z.S.; et al. AgNAC1, a celery transcription factor, related to regulation on lignin biosynthesis and salt tolerance. Genomics 2020, 112, 5254–5264. [Google Scholar] [CrossRef] [Scilit]
- Feng, K.; Liu, J.X.; Duan, A.Q.; Li, T.; Yang, Q.Q.; Xu, Z.S.; Xiong, A.S. AgMYB2 transcription factor is involved in the regulation of anthocyanin biosynthesis in purple celery (Apium graveolens L.). Planta 2018, 248, 1249–1261. [Google Scholar] [CrossRef] [Scilit]
- Feng, K.; Xing, G.M.; Liu, J.X.; Wang, H.; Tan, G.F.; Wang, G.L.; Xu, Z.S.; Xiong, A.S. AgMYB1, an R2R3-MYB factor, plays a role in anthocyanin production and enhancement of antioxidant capacity in celery. Veg. Res. 2021, 1, 2–12. [Google Scholar] [CrossRef] [Scilit]
- Tan, G.F.; Ma, J.; Zhang, X.Y.; Xu, Z.S.; Xiong, A.S. AgFNS overexpression increase apigenin and decrease anthocyanins in petioles of transgenic celery. Plant Sci. 2017, 263, 31–38. [Google Scholar] [CrossRef] [Scilit]
- Yan, J.; Yu, L.; He, L.; Zhu, L.; Xu, S.; Wan, Y.; Wang, H.; Wang, Y.; Zhu, W. Comparative transcriptome analysis of celery leaf blades identified an R2R3-MYB transcription factor that regulates apigenin metabolism. J. Agric. Food Chem. 2019, 67, 5265–5277. [Google Scholar] [CrossRef] [Scilit]
- Wang, H.; Liu, J.X.; Feng, K.; Li, T.; Duan, A.Q.; Liu, Y.H.; Liu, H.; Xiong, A.S. AgMYB12, a novel R2R3-MYB transcription factor, regulates apigenin biosynthesis by interacting with the AgFNS gene in celery. Plant Cell Rep. 2021, 41, 139–151. [Google Scholar] [CrossRef] [Scilit]
- Dhingra, D.; Michael, M.; Rajput, H.; Patil, R.T. Dietary fibre in foods: A review. J. Food Sci. Tech. 2012, 49, 255–266. [Google Scholar] [CrossRef] [Scilit]
- Liu, Q.Q.; Luo, L.; Zheng, L.Q. Lignins: Biosynthesis and biological functions in plants. Int. J. Mol. Sci. 2018, 19, 335. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Humphreys, J.M.; Chapple, C. Rewriting the lignin roadmap. Curr. Opin. Plant Biol. 2002, 5, 224–229. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Y.X.; Teng, R.M.; Wang, W.L.; Wang, Y.; Shen, W.; Zhuang, J. Identification of genes revealed differential expression profiles and lignin accumulation during leaf and stem development in tea plant (Camellia sinensis (L.) O. Kuntze). Protoplasma 2019, 256, 359–370. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thimm, J.C.; Burritt, D.J.; Sims, I.M.; Newman, R.H.; Ducker, W.A.; Melton, L.D. Celery (Apium graveolens) parenchyma cell walls: Cell walls with minimal xyloglucan. Physiol. Plant 2002, 116, 164–171. [Google Scholar] [CrossRef] [Scilit]
- Wang, D.D.; Bai, H.; Chen, W.Q.; Lu, H.; Jiang, X.N. Identifying a cinnamoyl coenzyme a reductase (CCR) activity with 4-coumaric acid: Coenzyme a ligase (4CL) reaction products in Populus tomentosa. J. Plant Biol. 2009, 52, 482–491. [Google Scholar] [CrossRef] [Scilit]
- Beuerle, T.; Pichersky, E. Enzymatic synthesis and purification of aromatic coenzyme a esters. Anal. Biochem. 2002, 302, 305–312. [Google Scholar] [CrossRef] [Scilit]
- Schneider, K.; Hovel, K.; Witzel, K.; Hamberger, B.; Schomburg, D.; Stuible, H.P. The substrate specificity-determining amino acid code of 4-coumarate: CoA ligase. Proc. Natl. Acad. Sci. USA 2003, 100, 8601–8606. [Google Scholar] [CrossRef] [Scilit]
- Saballos, A.; Sattler, S.E.; Sanchez, E.; Foster, T.P.; Xin, Z.G.; Kang, C.H.; Pedersen, J.F.; Wermerris, W. Brown midrib2 (Bmr2) encodes the major 4-coumarate: Coenzyme A ligase involved in lignin biosynthesis in sorghum (Sorghum bicolor (L.) Moench). Plant J. 2012, 70, 818–830. [Google Scholar] [CrossRef] [Scilit]
- Cukovica, D.; Ehlting, J.; VanZiffle, J.A.; Douglas, C.J. Structure and evolution of 4-coumarate: Coenzyme a ligase (4CL) gene families. Biol. Chem. 2001, 382, 645–654. [Google Scholar] [CrossRef] [Scilit]
- Kajita, S.; Hishiyama, S.; Tomimura, Y.; Katayama, Y.; Omori, S.J. Structural characterization of modified lignin in transgenic tobacco plants in which the activity of 4-coumarate:coenzyme A ligase is depressed. Plant Physiol. 1997, 114, 871–879. [Google Scholar] [CrossRef] [Scilit]
- Wan, C.H.; Yu, J.; Cai, Y.X.; Zhu, P.P.; Liu, C.Y.; Zhao, A.C.; Lv, R.H.; Li, M.J.; Xu, F.X.; Yu, M.D. Characterization and functional analysis of 4-coumarate:coa ligase genes in mulberry. PLoS ONE 2016, 23, e0157414. [Google Scholar]
- Li, Y.; Kim, J.I.; Pysh, L.; Chapple, C. Four isoforms of Arabidopsis 4-coumarate: CoA ligase have overlapping yet distinct roles in phenylpropanoid metabolism. Plant Physiol. 2015, 169, 2409–2421. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Christian, L.; Britta, M.; Judith, F.; Annette, U.; Friedrich, L.; Harald, M.; Jurgen, E. Divergent members of a soybean (Glycine max L.) 4-coumarate:coenzyme A ligase gene family: Primary structures, catalytic properties, and differential expression. Eur. J. Biochem. 2002, 269, 1304–1315. [Google Scholar]
- Gui, J.S.; Shen, J.H.; Li, L.G. Functional characterization of evolutionarily divergent 4-coumarate: Coenzyme a ligases in rice. Plant Physiol. 2011, 157, 574–586. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yun, M.S.; Chen, W.J.; Deng, F.; Yasuhiro, Y. Differential properties of 4-coumarate: CoA ligase related to growth suppression by chalcone in maize and rice. Plant Growth Regul. 2005, 46, 169–176. [Google Scholar] [CrossRef] [Scilit]
- Hu, W.J.; Kawaoka, A.; Tsai, C.J.; Lung, J.; Osakabe, K.; Ebinuma, H.; Chiang, V.L. Compartmentalized expression of two structurally and functionally distinct 4-coumarate: CoA ligase genes in aspen (Populus tremuloides). Proc. Natl. Acad. Sci. USA 1998, 95, 5407–5412. [Google Scholar] [CrossRef] [Scilit]
- Cai, C.; Xu, C.J.; Li, X.; Ferguson, L.; Chen, K.S. Accumulation of lignin in relation to change in activities of lignification enzymes in loquat fruit flesh after harvest. Postharvest Biol. Technol. 2006, 40, 163–169. [Google Scholar] [CrossRef] [Scilit]
- Cervilla, L.M.; Rosales, M.A.; Rubio-Wilhelmi, M.M.; Sánchez-Rodríguez, E.; Blasco, B.; Ríos, J.J.; Romero, L.; Ruiz, J.M. Involvement of lignification and membrane permeability in the tomato root response to boron toxicity. Plant Sci. 2009, 176, 545–552. [Google Scholar] [CrossRef] [Scilit]
- Feng, K.; Hou, X.L.; Li, M.Y.; Jiang, Q.; Xu, Z.S.; Liu, J.X.; Xiong, A.S. CeleryDB: A genomic database for celery. Database 2018, 2018, bay070. [Google Scholar] [CrossRef] [Scilit]
- Li, M.Y.; Feng, K.; Hou, X.L.; Jiang, Q.; Xu, Z.S.; Wang, G.L.; Liu, J.X.; Wang, F.; Xiong, A.S. The genome sequence of celery (Apium graveolens L.), an important leaf vegetable crop rich in apigenin in the Apiaceae family. Hortic. Res. 2020, 7, 9. [Google Scholar] [CrossRef] [Scilit]
- Zhang, X.R.; Henriques, R.; Lin, S.S.; Niu, Q.W.; Chua, N.H. Agrobacterium-mediated transformation of Arabidopsis thaliana using the floral dip method. Nat. Protoc. 2006, 1, 641–646. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, M.Y.; Wang, F.; Jiang, Q.; Wang, G.L.; Tian, C.; Xiong, A.S. Validation and comparison of reference genes for qPCR normalization of celery (Apium graveolens) at different development stages. Front. Plant Sci. 2016, 17, 313. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, Y.Q.; Dong, C.; Li, X.; Du, J.C.; Qian, M.; Sun, X.D.; Yang, Y.P. A novel Ap2/ERF transcription factor from Stipa purpurea leads to enhanced drought tolerance in Arabidopsis thaliana. Plant Cell Rep. 2016, 35, 2227–2239. [Google Scholar] [CrossRef] [Scilit]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, G.L.; Huang, Y.; Zhang, X.Y.; Xu, Z.S.; Wang, F.; Xiong, A.S. Transcriptome-based identification of genes revealed differential expression profiles and lignin accumulation during root development in cultivated and wild carrots. Plant Cell Rep. 2016, 35, 1743–1755. [Google Scholar] [CrossRef] [Scilit]
- Zhao, Q.; Zhong, X.L.; Cai, X.; Zhu, S.H.; Meng, P.H.; Zhang, J.; Tan, G.F. Comparative Physiological analysis of lignification, anthocyanin metabolism and correlated gene expression in red Toona sinensis buds during cold storage. Agronomy 2023, 13, 119. [Google Scholar] [CrossRef] [Scilit]
- Cardinal, A.J.; Lee, M.; Moore, K.J. Genetic mapping and analysis of quantitative trait loci affecting fiber and lignin content in maize. Theor. Appl. Genet. 2003, 106, 866–874. [Google Scholar] [CrossRef] [Scilit]
- Harakava, R. Genes encoding enzymes of the lignin biosynthesis pathway in Eucalyptus. Genet. Mol. Biol. 2005, 28, 601–607. [Google Scholar] [CrossRef] [Scilit]
- Wong, M.M.L.; Cannon, C.H.; Wickneswari, R. Identification of lignin genes and regulatory sequences involved in secondary cell wall formation in Acacia auriculiformis and Acacia mangium via de novo transcriptome sequencing. BMC Genom. 2011, 12, 342. [Google Scholar] [CrossRef] [Scilit]
- Huang, H.H.; Xu, L.L.; Tong, Z.K.; Lin, E.P.; Liu, Q.P.; Cheng, L.J.; Zhu, M.Y. De novo characterization of the Chinese fir (Cunninghamia lanceolata) transcriptome and analysis of candidate genes involved in cellulose and lignin biosynthesis. BMC Genom. 2012, 13, 648. [Google Scholar] [CrossRef] [Scilit]
- Riboulet, C.; Guillaumie, S.; Méchin, V.; Bosio, M.; Pichon, M.; Goffner, D.; Lapierre, C.; Pollet, B.; Lefevre, B.; Martinant, J.P.; et al. Kinetics of phenylpropanoid gene expression in maize growing internodes: Relationships with cell wall deposition. Crop Sci. 2009, 49, 211–223. [Google Scholar] [CrossRef] [Scilit]
- Vanholme, R.; Cesarino, I.; Rataj, K.; Xiao, Y.G.; Sundin, L.; Goeminne, G.; Kim, H.; Cross, J.; Morreel, K.; Araujo, P.; et al. Caffeoyl shikimate esterase (CSE) is an enzyme in the lignin biosynthetic pathway in Arabidopsis. Science 2013, 341, 1103–1106. [Google Scholar] [CrossRef] [Scilit]
- Vanholme, R.; Demedts, B.; Morreel, K.; Ralph, J.; Boerjan, W. Lignin biosynthesis and structure. Plant Physiol. 2010, 153, 895–905. [Google Scholar] [CrossRef] [Scilit]
- Chowdhury, M.E.K.; Choi, B.; Cho, B.K.; Kim, J.B.; Park, S.U.; Natarajan, s.; Lim, H.S.; Bae, H. Regulation of 4CL, encoding 4-coumarate: Coenzyme A ligase, expression in kenaf under diverse stress conditions. Plant Omics 2013, 6, 254–262. [Google Scholar]
- Silber, M.V.; Meimberg, H.; Ebel, J. Identification of a 4-coumarate: CoA ligase gene family in the moss. Physcomitrella Patens Phytochem. 2008, 69, 2449–2456. [Google Scholar] [CrossRef] [Scilit]
- Sun, H.Y.; Li, Y.; Feng, S.Q.; Zou, W.H.; Guo, K.; Fan, C.F.; Si, S.L.; Peng, L.C. Analysis of five rice 4-coumarate:coenzyme A ligase enzyme activity and stress response for potential roles in lignin and flavonoid biosynthesis in rice. Biochem. Biophys. Res. Commun. 2013, 430, 1151–1156. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Y.Y.; Guo, L.H.; Zhao, Y.J.; Zhao, X.Q.; Yuan, Z.H. Systematic analysis and expression profiles of the 4-Coumarate: CoA Ligase (4CL) gene family in pomegranate (Punica granatum L.). Int. J. Mol. Sci. 2022, 23, 3509. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mitsuda, N.; Seki, M.; Shinozaki, K.; Ohme-Takagi, M. The NAC transcription factors NST1 and NST2 of Arabidopsis regulate secondary wall thickenings and are required for anther dehiscence. Plant Cell 2005, 17, 2993–3006. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, X.H.; Su, W.L.; Zhang, H.; Zhan, Y.G.; Zeng, F.S. Fraxinus mandshurica 4-coumarate-CoA ligase 2 enhances drought and osmotic stress tolerance of tobacco by increasing coniferyl alcohol content. Plant Physiol. Biochem. 2020, 155, 697–708. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, S.C.; Xiong, X.P.; Zhang, X.L.; Feng, H.J.; Zhu, Q.H.; Sun, J.; Li, Y.J. Characterization of the Gh4CL gene family reveals a role of Gh4CL7 in drought tolerance. Plant Biol. 2020, 20, 125. [Google Scholar] [CrossRef] [Scilit]
- Ali, M.B.; McNear, D.H., Jr. Induced transcriptional profiling of phenylpropanoid pathway genes increased flavonoid and lignin content in Arabidopsis leaves in response to microbial products. BMC Plant Biol. 2014, 14, 84. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, G.L.; Que, F.; Xu, Z.S.; Wang, F.; Xiong, A.S. Exogenous gibberellin enhances secondary xylem development and lignification in carrot taproot. Protoplasma 2017, 254, 839–848. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, X.; Zang, C.; Ge, H.; Zhang, J.; Grierson, D.; Yin, X.R.; Chen, K.S. Involvement of PAL, C4H, and 4CL in chilling injury-induced flesh lignification of loquat fruit. HortScience 2017, 52, 127–131. [Google Scholar] [CrossRef] [Scilit]
- Laskar, D.D.; Jourdes, M.; Patten, A.M.; Helms, G.L.; Davin, L.B.; Lewis, N.G. The Arabidopsis cinnamoyl CoA reductase irx4 mutant has a delayed but coherent (normal) program of lignification. Plant J. 2006, 48, 674–686. [Google Scholar] [CrossRef] [Scilit]
- Chabannes, M.; Ruel, K.; Yoshinaga, A.; Chabbert, B.; Jauneau, A.; Joseleau, J.P.; Boudet, A.M. In situ analysis of lignins in transgenic tobacco reveals a differential impact of individual transformations on the spatial patterns of lignin deposition at the cellular and subcellular levels. Plant J. 2001, 28, 271–282. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- O’Connell, A.; Holt, K.; Piquemal, J.; Grima-Pettenati, J.; Boudet, A.; Pollet, B.; Lapierre, C.; PetitConil, M.; Schuch, W.G.; Halpin, C. Improved paper pulp from plants with suppressed cinnamoyl-coa reductase or cinnamyl alcohol dehydrogenase. Transgenic Res. 2002, 11, 495–503. [Google Scholar] [CrossRef] [Scilit]
- Lapierre, C.; Pollet, B.; Petitconil, M.; Toval, G.; Romero, J.; Pilate, G.; Leple´, J.C.; Boerjan, W.; Ferret, V.; Nadai, V.D.; et al. Structural alterations of lignins in transgenic poplars with depressed cinnamyl alcohol dehydrogenase or caffeic acid o-methyltransferase activity have an opposite impact on the efficiency of industrial kraft pulping. Plant Physiol. 1999, 119, 153–163. [Google Scholar] [CrossRef] [Scilit]
- Halpin, C.; Knight, M.E.; Foxon, G.A.; Campbell, M.M.; Boudet, A.M.; Boon, J.J.; Chabbert, B.; Tollier, M.T.; Schuch, W.G. Manipulation of lignin quality by downregulation of cinnamyl alcohol dehydrogenase. Plant J. 1994, 6, 339–350. [Google Scholar] [CrossRef] [Scilit]
- Chabannes, M.; Barakate, A.; Lapierre, C.; Marita, J.M.; Ralph, J.; Pean, M.; Danoun, S.; Halpin, C.; GrimaPettenati, J.; Boudet, A.M. Strong decrease in lignin content without significant alteration of plant development is induced by simultaneous down-regulation of cinnamoyl CoA reductase (CCR) and cinnamyl alcohol dehydrogenase (CAD) in tobacco plants. Plant J. 2001, 28, 257–270. [Google Scholar] [CrossRef] [Scilit]
- Franke, R.; Mcmichael, C.M.; Meyer, K.; Shirley, A.M.; Cusumano, J.C.; Chapple, C. Modified lignin in tobacco and poplar plants over-expressing the Arabidopsis gene encoding ferulate 5-hydroxylase. Plant J. 2000, 22, 223–234. [Google Scholar] [CrossRef] [Scilit]
- Sibout, R.; Baucher, M.; Gatineau, M.; Van Doorsselaere, J.; Mila, I.; Pollet, B.; Maba, B.; Pilate, G.; Lapierre, C.; Boerjan, W.; et al. Expression of a poplar cDNA encoding a ferulate-5-hydroxylase/coniferaldehyde 5-hydroxylase increases S lignin deposition in Arabidopsis thaliana. Plant Physiol. Biochem. 2002, 40, 1087–1096. [Google Scholar] [CrossRef] [Scilit]
- Huntley, S.K.; Ellis, D.; Gilbert, M.; Chapple, C.; Mansfield, S.D. Significant increases in pulping efficiency in C4H-F5H-transformed poplars: Improved chemical savings and reduced environmental toxins. J. Agric. Food Chem. 2003, 51, 6178–6183. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guo, D.J.; Chen, F.; Inoue, K.; Blount, J.W.; Dixon, R.A. Downregulation of caffeic acid 3-O-methyltransferase and caffeoyl coa 3-O-methyltransferase in transgenic alfalfa: Impacts on lignin structure and implications for the biosynthesis of G and S lignin. Plant Cell 2001, 13, 73–88. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Komori, T. Functions of BMPs, Runx2, and osterix in the development of bone and cartilage. Nihon Rinsho 2005, 63, 1671–1677. [Google Scholar]
- Zhong, R.Q.; Herbert Morrison, W.S.; Himmelsbach, D.; Poole, F.L.; Ye, Z.H. Essential role of caffeoyl coenzyme A O-methyltransferase in lignin biosynthesis in woody poplar plants. Plant Physiol. 2000, 124, 563–577. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ralph, J.; Akiyama, T.; Kim, H.; Lu, F.; Schatz, P.F.; Marita, J.M.; Ralph, S.A.; Reddy, M.S.; Chen, F.; Dixon, R.A. Effects of coumarate 3-hydroxylase down-regulation on lignin structure. J. Biol. Chem. 2006, 281, 8843–8853. [Google Scholar] [CrossRef] [Scilit]
- Reddy, M.S.; Chen, F.; Shadle, G.; Jackson, L.; Aljoe, H.; Dixon, R.A. Targeted down-regulation of cytochrome P450 enzymes for forage quality improvement in alfalfa (Medicago sativa L.). Proc. Natl. Acad. Sci. USA 2005, 102, 16573–16578. [Google Scholar] [CrossRef] [Scilit]
- Besseau, S.; Hoffmann, L.; Geoffroy, P.; Lapierre, C.; Pollet, B.; Legrand, M. Flavonoid accumulation in Arabidopsis repressed in lignin synthesis affects auxin transport and plant growth. Plant Cell 2007, 19, 148–162. [Google Scholar] [CrossRef] [Scilit]
- Lee, D.; Douglas, C.J. Two divergent members of a tobacco 4-coumarate: Coenzyme A ligase (4CL) gene family (cDNA structure, gene inheritance and expression, and properties of recombinant proteins). Plant Physiol. 1996, 112, 193–205. [Google Scholar] [CrossRef] [Scilit]






| Gene | GenBank No. | Forward Primer (5′→3′) | Reverse Primer (5′→3′) |
|---|---|---|---|
| AtActin | NM_112764.4 | TCGCTGACCGTATGAGCAAAG | TGTGAACGATTCCTGGACCTG |
| AtPAL | NM_120505.4 | CGAGTAGTGACTGGGTGATGGA | AGGAGGGTGTTTACACGGATG |
| AtC4H | AM887619.1 | ACGGCGAGCATTGGAGGAAGA | TCTCCATAGTTATACTCAAAGC |
| At4CL | NM_104046.3 | CCGAATCTTTATTTCCACAG | CACCGTCACTTTACACCTCT |
| AtCCR | NM_001332191.1 | GTGCAAAGCAGATCTTCAGG | GCCGCAGCATTAATTACAAA |
| AtCAD | NM_119587.4 | TTGGCTGATTCGTTGGATTA | ATCACTTTCCTCCCAAGCAT |
| AtHCT | NM_124270.4 | GCCTGCACCAAGTATGAAGA | GACAGTGTTCCCATCCTCCT |
| AtC3′H | NM_128601.3 | GTTGGACTTGACCGGATCTT | ATTAGAGGCGTTGGAGGAT |
| AtF5H | NM_119790.3 | CTTCAACGTAGCGGATTTCA | AGATCATTACGGGCCTTCAC |
| AtCCOAOMT | NM_001342249.1 | CTCAGGGAAGTGACAGCAAA | GTGGCGAGAAGAGAGTAGCC |
| AtCOMT | NM_124796.4 | TTCCATTGCTGCTCTTTGTC | CATGGTGATTGTGGAATGGT |
| AtPER | NM_001344315.1 | CGGCGGTGTTGAAAGCGGT | GACATTATCCGCGAAACCATC |
| AtLAC | NM_125395.3 | GACCATACGTCACAGGTCAA | TGGTGTTATAAGGTAGAACC |
| Day after Sowing (d) | Plant Height (cm) | Stem Thick (cm) |
|---|---|---|
| 30 (seedling stage) | 13.45 ± 0.24 c | 1.64 ± 0.05 c |
| 50 (vigorous growth period) | 18.64 ± 0.27 b | 2.37 ± 0.10 b |
| 70 (commercial stage) | 26.33 ± 0.99 a | 3.06 ± 0.09 a |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhong, X.-L.; Zhu, S.-H.; Zhao, Q.; Luo, Q.; Wang, K.; Chen, Z.-F.; Tan, G.-F. Ag4CL3 Related to Lignin Synthesis in Apium graveolens L. Agronomy 2023, 13, 2025. https://doi.org/10.3390/agronomy13082025
Zhong X-L, Zhu S-H, Zhao Q, Luo Q, Wang K, Chen Z-F, Tan G-F. Ag4CL3 Related to Lignin Synthesis in Apium graveolens L. Agronomy. 2023; 13(8):2025. https://doi.org/10.3390/agronomy13082025
Chicago/Turabian StyleZhong, Xiu-Lai, Shun-Hua Zhu, Qian Zhao, Qing Luo, Kun Wang, Zhi-Feng Chen, and Guo-Fei Tan. 2023. "Ag4CL3 Related to Lignin Synthesis in Apium graveolens L." Agronomy 13, no. 8: 2025. https://doi.org/10.3390/agronomy13082025
APA StyleZhong, X.-L., Zhu, S.-H., Zhao, Q., Luo, Q., Wang, K., Chen, Z.-F., & Tan, G.-F. (2023). Ag4CL3 Related to Lignin Synthesis in Apium graveolens L. Agronomy, 13(8), 2025. https://doi.org/10.3390/agronomy13082025

