A New Proposed Symbiotic Plant–Herbivore Relationship between Burkea africana Trees, Cirina forda Caterpillars and Their Associated Fungi Pleurostomophora richardsiae and Aspergillus nomius
Abstract
1. Introduction
2. Materials and Methods
2.1. Collection of Leaf and Caterpillar Sample
2.2. Genomic DNA PCR and Sequencing
2.3. Soil Analysis
3. Results
3.1. Higher Order Classification of the Microorganisms in the Caterpillars
3.1.1. Family Classification of Ascomycota in the Caterpillars
3.1.2. Species Classification
3.2. Classification of the Microorganisms in the Leaves
3.2.1. Phylum Classification
3.2.2. Family Classification of the Ascomycota in the Leaves
3.2.3. Species Classification
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Coates Palgrave, K. Trees of Southern Africa; Struik: Cape Town, South Africa, 1997. [Google Scholar]
- Fichtler, E.; Trouet, V.; Beeckman, H.M.; Coppin, P.; Worbes, M. Climatic signals in tree rings of Burkea africana and Pterocarpus angolensis from semiarid forests in Namibia. J. Tree Sci. 2004, 18, 422–451. [Google Scholar] [CrossRef] [Scilit]
- Storrs, A.E.G. Know Your Trees, Some of the Common Trees Found in Zambia; Registration of Soil Conversation Unit: Zambia, 1995. [Google Scholar]
- Nemadodzi, L.E.; Vervoort, J.J.; Prinsloo, G. NMR-Based Metabolomic Analysis and Microbial Composition of Soil Supporting Burkea africana growth. Metabolites 2020, 10, 402. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chakona, A.; Jordaan, M.; Kadye, W.T. Distribution and summer habitat associations of three narrow-range endemic fishes in an intermittent southern temperate Mediterranean river system. Fundam. Appl. Limnol. 2019, 193, 65–77. [Google Scholar] [CrossRef] [Scilit]
- Kusia, E.S.; Borgemeister, C.; Khamis, F.M.; Copeland, R.S.; Tanga, C.M.; Ombura, F.L.; Subramanian, S. Diversity, host plants and potential distribution of edible saturniid caterpillars in Kenya. Insects 2021, 12, 600. [Google Scholar] [CrossRef] [Scilit]
- Badanaro, F.; Amevoin, K.; Lamboni, C.; Amouzou, K.S. Edible Cirina forda (Westwood, 1849) (Lepidoptera: Saturniidae) caterpillar among Moba people of the Savannah Region in North Togo: From collector to consumer. Asian J. Appl. Sci. Eng. 2014, 3, 13–24. [Google Scholar] [CrossRef] [Scilit]
- Belluco, S.; Losasso, C.; Maggioletti, M.; Alonzi, C.C.; Paoletti, M.G.; Ricci, A. Edible insects in a food safety and nutritional perspective: A critical review. Compr. Rev. Food Sci. Food Saf. 2013, 12, 296–313. [Google Scholar] [CrossRef] [Scilit]
- Tao, J.; Yao, O.L. Edible insects as a means to address global malnutrition and food insecurity issues. Food Qual. Saf. 2018, 2, 17–26. [Google Scholar] [CrossRef] [Scilit]
- Rumpold, B.A.; Langen, N. Potential of enhancing consumer acceptance of edible insects via information. J. Insects Food Feed 2019, 5, 45–53. [Google Scholar] [CrossRef] [Scilit]
- Uberti-Foppa, C.; Fumagalli, L.; Gianotti, N.; Viviani, A.M.; Vaiani, R.; Guého, E. First case of osteomyelitis due to Phialophora richardisiae in a patient with HIV infection. AIDS 1995, 9, 975–997. [Google Scholar]
- Ikai, K.; Tomono, H.; Watanabe, S. Phaeohyphomyco- sis caused by Phialophora richardsiae. J. Am. Acad. Dermatol. 1988, 19, 478–481. [Google Scholar] [CrossRef] [Scilit]
- Pitrak, D.L.; Koneman, E.W.; Estupinan, R.C.; Jackson, J. Phialophora richardsiae infection in human. Rev. Infect. Dis. 1988, 10, 1195–1203. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- De Hoog, G.S.; Guarro, J.; Gené, J.; Figueras, M.J. Atlas of Clinical Fungi; Centraalbureau voor Schimmelcultures: Utrecht, The Netherlands, 2000. [Google Scholar]
- Guého, E.; Bonnefoy, A.; Luboinski, J.; Petit, J.C.; de Hoog, G.S. Subcutaneous granuloma caused by Phialophora richardsiae: Case report and review of the literature. Mycoses 1989, 32, 219–223. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vijaykrishna, D.; Mostert, L.; Jeewon, R.; Gams, W.; Hyde, K.D.; Crous, P.W. Pleurostomophora an anamorph of Pleurostoma (Calosphaeriales), a new anamorph genus morphologically similar to Phialophora. Stud. Mycol. 2004, 50, 387–395. [Google Scholar]
- Mhmoud, N.A.; Ahmed, S.A.; Fahal, A.H.; de Hoog, G.S.; van den Ende, A.H.G.G.; van de Sande, W.W.J. Pleurostomophora ochracea, a novel agent of human eumycetoma with yellow grains. J. Clin. Microbiol. 2012, 50, 2987–2994. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kurtzman, C.P.; Horn, B.W.; Hesseltine, C.W. Aspergillus nomius, a new aflatoxin-producing species related to Aspergillus flavus and Aspergillus tamarii. Antonie Leeuwenhoek 1987, 53, 147–158. [Google Scholar] [CrossRef] [Scilit]
- Pitt, J.I.; Hocking, A.D.; Bhudasamai, K.; Miscamble, B.F.; Wheeler, K.A.; Tanboon-Ek, P. The normal macroflora of commodities from Thailand. I. nuts and oilseed. Int. J. Food Microbiol. 1993, 20, 211–226. [Google Scholar] [CrossRef] [Scilit]
- Feibelman, T.P.; Cotty, P.J.; Doster, M.A.; Michailides, T.J. A morphological distinct strain of Aspergillus nomius. Mycologia 1998, 90, 618–623. [Google Scholar] [CrossRef] [Scilit]
- Egel, D.S.; Cotty, P.J.; Elias, K.S. Relationship among isolates of Aspergillus sect. Flavi that vary in aflatoxin production. Pathology 1998, 84, 906–912. [Google Scholar]
- Razzaghi-Abyaneh, M.; Shams-Ghahfarokhi, M.; Allameh, A.; KazEroon-Shiri, A.; Ranjbar-Bahadori, S.; Mirzahoseini, H.; Rezaee, M.B. A survey on distribution of Aspergillus section Flavi in corn field soils in Iran: Population patterns based on aflatoxin, cyclopiazonic acid and sclerotia production. Mycopathologia 2006, 161, 183–192. [Google Scholar] [CrossRef] [Scilit]
- Ehrlich, K.C.; Kobbeman, k.; Montalbano, B.G.; Cotty, P.J. Aflatoxin-producing Aspergillus species from Thailand. Int. J. Food Microbiol. 2007, 114, 153–159. [Google Scholar] [CrossRef] [Scilit]
- Mucina, L.; Rutherford, M.C. The Vegetation of South Africa, Lesotho and Swaziland; Strelitzia 19; SANBI: Pretoria, South Africa, 2006; Volume 16. [Google Scholar]
- Brown, L.R.; Magagula, I.P.; Barrett, A.S. A vegetation classification and description of Telperion Nature Reserve, Mpumalanga, South Africa. Veg. Classif. Surv. 2022, 3, 199–219. [Google Scholar] [CrossRef] [Scilit]
- Kress, W.J.; Wurdack, K.J.; Zimmer, E.A.; Weigt, L.A.; Janzen, D.H. Use of DNA barcodes to identify flowering plants. Proc. Natl. Acad. Sci. USA 2005, 102, 8369. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Carlucci, A.; Raimondo, M.L.; Cibelli, F.; Phillips, A.J.; Lops, F. Pleurostomophora richardsiae, Neofusicoccum parvum and Phaeoacremonium aleophilum associated with a decline of olives in southern Italy. Phytopathol. Mediterr. 2013, 52, 517–527. [Google Scholar]
- Houbraken, J.; Samson, R.A. Phylogeny of Penicillium and the segregation of Trichocomaceae into three families. Stud. Mycol. 2011, 7, 1–51. [Google Scholar] [CrossRef] [Scilit]
- Crous, P.W.; Braun, U.; Groenewald, J.Z. Mycosphaerella is polyphyletic. Stud. Mycol. 2007, 58, 1–32. [Google Scholar] [CrossRef] [Scilit]
- Pitt, J.I.; Taylor, J.W. Aspergillus and the ICN. J. Mycol. 2014; in press. [CrossRef] [Scilit]
- Houbraken, J.; de Vries, R.P.; Robert, A.; Samson, R.A. Modern Taxonomy of Biotechnologically Important Aspergillus and Penicillium Species. Adv. Appl. Microbiol. 2014, 86, 199–249. [Google Scholar]
- Visagie, C.M.; Houbraken, J.; Frisvad, J.C. Identification and Nomenclature of the genus Penicillium. Stud. Mycol. 2014, 78, 343–371. [Google Scholar] [CrossRef] [Scilit]
- Visagie, C.M.; Varga, J.; Houbraken, J. Ochratoxin production and taxonomy of the yellow aspergilli (Aspergillus section Circumdati). Stud. Mycol. 2014, 78, 1–61. [Google Scholar] [CrossRef] [Scilit]
- Rolshausen, P.E.; Úrbez-Torres, J.R.; Rooney-Latham, S.; Eskalen, A.; Smith, R.J.; Gubler, W.D. Evaluation of pruning wound susceptibility and protection against fungi associated with grapevine trunk diseases. Am. J. Enol. Vitic. 2010, 61, 113–119. [Google Scholar] [CrossRef] [Scilit]
- Halleen, F.; Mostert, L.; Crous, P.W. Pathogenecity testing of lesser-known vascular fungi of grapevines. Australas. Plant Path. 2007, 36, 277–285. [Google Scholar] [CrossRef] [Scilit]
- St-Germain, G.; Summerbell, R. Identifying Fungi: A Clinical Laboratory Handbook, 2nd ed.; Star Publishing Company: Buffalo, NY, USA, 2011; p. 212. [Google Scholar]
- Schwartz, I.S.; Emmons, W.W. Subcutaneous cystic granuloma caused by a fungus of wood pulp (Phialophora richardsiae). Am. J. Clin. Pathol. 1968, 49, 500–505. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Levenstadt, J.S.; Potanenm, S.M.; Mohan, S.; Zhang, S.; Silverman, M. Pleurostomophora richardsiae -an insidious fungus presenting in a man 44 years after initial inoculation: A case report and review of the literature. Can. J. Infect. Dis. Med. Microbiol. 2012, 23, 110–113. [Google Scholar] [CrossRef] [Scilit]
- Olmo, D.; Armengol, J.; Leon, M.; Gramaje, D. Pathogenicity testing of lesser-known fungal trunk pathogens associated with wood decay of almond trees. Eur. J. Plant Pathol. 2015, 143, 607–611. [Google Scholar] [CrossRef] [Scilit]
- Vannette, R.L.; Rasmann, S. Arbuscular mycorrhizal fungi mediate below-ground plant–herbivore interactions: A phylogenetic study. Funct. Ecol. 2012, 26, 1033–1042. [Google Scholar] [CrossRef] [Scilit]
- Ballhorn, D.J.; Schädler, M.; Elias, J.D.; Millar, J.A.; Kautz, S. Friend or foe—Light availability determines the relationship between mycorrhizal fungi, rhizobia and lima bean (Phaseolus lunatus L.). PLoS ONE 2016, 11, e0154116. [Google Scholar] [CrossRef] [Scilit]
- Rasmussen, P.U.; Amin, T.; Bennett, A.E.; Karlsson Green, K.; Timonen, S.; Van Nouhuys, S.; Tack, A.J. Plant and insect genetic variation mediate the impact of arbuscular mycorrhizal fungi on a natural plant–herbivore interaction. Ecol. Entomol. 2017, 42, 793–802. [Google Scholar] [CrossRef] [Scilit]
- Locke, H.; Crawford, K.M. Arbuscular mycorrhizal fungi mediate how plant herbivory history influences herbivore performance. Ecol. Entomol. 2022, 47, 590–600. [Google Scholar] [CrossRef] [Scilit]
- Fontaine, F.; Gramaje, D.; Armengol, J.; Smart, R.; Nagy, Z.A.; Borgo, M.; Rego, C.; Corio-Costet, M.F. Grapevine Trunk Diseases. A Review, 1st ed.; OIV Publications: Paris, France, 2016. [Google Scholar]
- Banjo, A.D.; Lawal, A.O.; Songonuga, E.A. The nutritional value of fourteen species of edible insects in the southwestern Nigeria. Afr. J. Biotechnol. 2002, 5, 298–301. [Google Scholar]
- Nemadodzi, L.E. Determining Factors That Contribute to the Propagation, Growth and Establishment of Burkea africana Trees. Ph.D. Thesis, University of South Africa, Pretoria, South Africa, 2018. [Google Scholar]
- Dyer, P.S.; O’Gorman, C.M. Sexual development and cryptic sexuality in fungi: Insights from Aspergillus species. FEMS Microbiol. Rev. 2012, 36, 165–192. [Google Scholar] [CrossRef] [Scilit]
- Wang, D. Genetic Diversity, and Antifungal Susceptibility of Aspergillus spp. Isolates from Avian Farms in Guangxi, China. Ph.D. Thesis, Université de Guangxi, Nanning, China, 2012. [Google Scholar]
- Chang, P.K.; Scharfenstein, L.L.; Solorzano, C.D.; Abbas, H.K.; Hua, S.S.T.; Jones, W.A.; Zablotowicz, R.M. High sequence variations in the region containing genes encoding a cellular morphogenesis protein and the repressor of sexual development help to reveal origins of Aspergillus oryzae. Int. J. Food Microbiol. 2015, 200, 66–71. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Carvajal-Campos, A. Characterization of Aspergillus Section Flavi: Molecular Markers as Tools to Unmask Cryptic Species. Ph.D. Thesis, Université Paul Sabatier-Toulouse III, Toulouse, France, 2018. [Google Scholar]
- Chu, R.; Li, S.; Zhu, L.; Yin, Z.; Hu, D.; Liu, C.; Mo, F. A review on co-cultivation of microalgae with filamentous fungi: Efficient harvesting, wastewater treatment and biofuel production. Renew. Sustain. Energy Rev. 2021, 139, 110689. [Google Scholar] [CrossRef] [Scilit]
- Adhikari, B.N.; Callicott, K.A.; Cotty, P.J. Conservation and Loss of a Putative Iron Utilization Gene Cluster among Genotypes of Aspergillus flavus. Microorganisms 2021, 9, 137. [Google Scholar] [CrossRef] [Scilit]
- Caira, M.; Posteraro, B.; Sanguinetti, M.; de Carolis, E.; Leone, G.; Pagano, L. First case of breakthrough pneumonia due to Aspergillus nomius in a patient with acute myeloid leukemia. Med. Mycol. 2012, 50, 746–750. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Perez, L.; Messina, F.; Negroni, R.; Arechavala, A.; Bustamante, J.; Oleastro, M.; Migaud, M.; Casanova, J.L.; Puel, A.; Santiso, G. Inherited CARD9 deficiency in a patient with both Exophiala spinifera and Aspergillus nomius severe infections. J. Clin. Immunol. 2020, 40, 359–366. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, Y.B.; Li, D.M.; Houbraken, J.; Sun, T.T.; de Hoog, G.S. Fatal rhino facial mycosis due to Aspergillus nomiae: Case report and review of published literature. Front. Microbiol. 2020, 11, 595375. [Google Scholar] [CrossRef] [Scilit]
- Rahman, M.; Sobur, M.; Islam, M.; Ievy, S.; Hossain, M.; El Zowalaty, M.E.; Ashour, H.M. Zoonotic diseases: Etiology, impact, and control. Microorganisms 2020, 8, 1405. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tong, D.Q.; Baklanov, A.; Barker, B.M.; Castillo, J.; Gassó, S.; Gaston, C.; Gill, T.E.; Raysoni, A.U. Health and Safety Effects of Airborne Soil Dust in the Americas and Beyond. Rev. Geophys. 2021, 61, GH23A-07. [Google Scholar] [CrossRef] [Scilit]
- Dudhatra, G.B.; Mody, S.K.; Awale, M.M.; Patel, H.B.; Modi, C.M.; Kumar, A.; Chauhan, B.N. A comprehensive review on pharmacotherapeutics of herbal bioenhancers. Sci. World J. 2012, 2012, 637953. [Google Scholar] [CrossRef] [Scilit]
- Kheng, G.Y.; Yuong, C.K.; Jiat, T.H.; Keng, G.Y.; Chee, W.W.; Yan, C.Z.; Joo, G.K. Soil microbial population of healthy and Ganoderma boninense infected (Mounded and unmounded) palms (Elaeis guineensis). In Proceedings of the Conference: Malaysian Soil Science Society (MSSS)-SOILS, Serdang, Selangor, 16–18 April 2013. [Google Scholar]
- Foley, K.; Fazio, G.; Jensen, A.B.; Hughes, W.O. The distribution of Aspergillus spp. opportunistic parasites in hives and their pathogenicity to honeybees. Vet. Microbiol. 2014, 169, 203–210. [Google Scholar] [CrossRef] [Scilit]
- David, O.M.; Owolabi, A.R.; Olawale, A.K. Molecular Detection of Putative Virulence Factors (Fungalysin and Subtilisin) in Aspergillus tamarii Isolated from Human Skin. Jordan J. Biol. Sci. 2018, 11, 3. [Google Scholar]
- García-Fraile, P. Roles of bacteria in the bark beetle holobiont—How do they shape this forest pest? Ann. Appl. Biol. 2018, 172, 111–125. [Google Scholar] [CrossRef] [Scilit]
- Kimura, H.; Mitsuto, I.; Taguchi, R.; Anzawa, K.; Mochizuki, T. Primary cutaneous aspergillosis caused by Aspergillus tamarii in a premature infant with extremely low birthweight: A case report with short review. J. Dermato. 2018, 45, 622–625. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sobolev, V.S.; Walk, T.E.; Arias, R.S.; Massa, A.N.; Orner, V.A.; Lamb, M.C. Transformation of Major Peanut (Arachis hypogaea) Stilbenoid Phytoalexins Caused by Selected Microorganisms. J. Agric. Food Chem. 2022, 70, 1101–1110. [Google Scholar] [CrossRef] [Scilit]
- Amaike, S.; Keller, N.P. Aspergillus flavus. Annu. Rev. Phytopathol. 2011, 49, 107–133. [Google Scholar] [CrossRef] [Scilit]
- Baranyi, N. Current trends in aflatoxin research. Acta Biol. Szeged. 2013, 57, 95–107. [Google Scholar]
- Gurav, N.P.; Medhe, S. Analysis of Aflatoxins B1, B2, G1 and G2 in peanuts: Validation study. Anal. Chem. Ind. J. 2018, 17, 126. [Google Scholar]
- Lebar, M.D.; Mack, B.M.; Carter-Wientjes, C.H.; Gilbert, M.K. The aspergillic acid biosynthetic gene cluster predicts neoaspergillic acid production in Aspergillus section Circumdati. World Mycotoxin J. 2019, 12, 213–222. [Google Scholar] [CrossRef] [Scilit]
- Chandra, P. Aflatoxins: Food Safety, Human Health Hazards and Their Prevention. In Aflatoxins-Occurrence, Detoxification, Determination and Health Risks; Intech Open: London, UK, 2021. [Google Scholar]
- Dirican, S. A review of effects of aflatoxins in aquaculture. Appl. Res. J. 2015, 1, 1191–1196. [Google Scholar]
- Stollof, L.; van Egmond, H.P.; Park, D.L. Rationales for the establishment of limits and regulations for mycotoxins. Food Addit. Contam. 1991, 8, 213–222. [Google Scholar] [CrossRef] [Scilit]
- Horn, B.W.; Moore, G.G.; Ignazio, C. Sexual reproduction in aflatoxin-producing Aspergillus nomius. Mycologia 2011, 103, 174–183. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Leal, S.M., Jr.; Pearlman, E. The role of cytokines and pathogen recognition molecules in fungal keratitis–insights from human disease and animal models. Cytokine 2012, 58, 107–111. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Homa, M.; Manikandan, P.; Szekeres, A.; Kiss, N.; Kocsubé, S.; Kredics, L.; Papp, T. Characterization of Aspergillus tamarii strains from human keratomycoses: Molecular identification, antifungal susceptibility patterns and cyclopiazonic acid producing abilities. Front. Microbiol. 2019, 10, 2249. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lizárraga-Paulín, E.G.; Moreno-Martínez, E.; Miranda-Castro, S.P. Aflatoxins and their impact on human and animal health: An emerging problem. Aflatoxins-Biochem. Mol. Biol. 2011, 13, 255–262. [Google Scholar]
- Perrone, G.; Gallo, A. Aspergillus species and their associated mycotoxins. Mycotoxin J. 2017, 33–49. [Google Scholar]
- Kumar, P.; Mahato, D.K.; Kamle, M.; Mohanta, T.K.; Kang, S.G. Aflatoxins: A global concern for food safety, human health and their management. Front. Microbiol. 2017, 7, 2170. [Google Scholar] [CrossRef] [Scilit]
- Mutegi, C.K.; Cotty, P.J.; Bandyopadhyay, R. Prevalence and mitigation of aflatoxins in Kenya (1960-to date). World Mycotoxin J. 2018, 11, 341. [Google Scholar] [CrossRef] [Scilit]
- Owino, A.E. Efficacy of Maxim XL 035 FS® as a Seed Dresser in the Management of Aspergillus Species and Aflatoxin Contamination of Maize. Ph.D. Thesis, University of Nairobi, Nairobi, Kenya, 2014. [Google Scholar]
- Kozakiewicz, L.; Phuah, J.; Flynn, J.; Chan, J. The role of B cells and humoral immunity in Mycobacterium tuberculosis infection. New Paradig. Immun. Tuberc. 2013, 225–250. [Google Scholar]
- Gonçalves, J.S.; Ferracin, L.M.; Carneiro Vieira, M.L.; Iamanaka, B.T.; Taniwaki, M.H.; Pelegrinelli Fungaro, M.H. Molecular analysis of Aspergillus section Flavi isolated from Brazil nuts. World J. Microbiol. 2012, 28, 817–1825. [Google Scholar] [CrossRef] [Scilit]
- Calderari, T.O.; Iamanaka, B.T.; Frisvad, J.C.; Pitt, J.I.; Sartori, D.; Pereira, J.L.; Fungaro, M.H.P.; Taniwaki, M.H. The biodiversity of Aspergillus section Flavi in Brazil nuts: From rainforest to consumer. Int. J. Food Microbiol. 2013, 160, 267–272. [Google Scholar] [CrossRef] [Scilit]
- Massi, F.P.; Vieira, M.L.C.; Sartori, D.; Penha, R.E.S.; de Freitas Munhoz, C.; Ferreira, J.M.; Fungaro, M.H.P. Brazil nuts are subject to infection with B and G aflatoxin-producing fungus, Aspergillus pseudonomius. Int. J. Food Microbiol. 2014, 186, 14–21. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Taniwaki, M.H.; Pitt, J.I.; Magan, N. Aspergillus species and mycotoxins: Occurrence and importance in major food commodities. Curr. Opin. Food Sci. 2018, 23, 38–43. [Google Scholar] [CrossRef] [Scilit]
- Kluczkovski, A.M. Fungal and mycotoxin problems in the nut industry. Curr. Opin. Food Sci. 2019, 29, 56–63. [Google Scholar] [CrossRef] [Scilit]
- Iamanaka, B.T.; de Souza Lopes, A.; Martins, L.M.; Frisvad, J.C.; Medina, A.; Magan, N.; Sartori, D.; Massi, F.P.; Fungaro, M.H.P.; Taniwaki, M.H. Aspergillus section Flavi diversity and the role of A. novoparasiticus in aflatoxin contamination in the sugarcane production chain. Int. J. Food Microbiol. 2019, 293, 17–23. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Silva, J.J.; Iamanaka, B.T.; Fungaro, M.H.P.; Taniwaki, M.H. Aflatoxins in sugarcane production chain: What could be the source? Curr. Opin. Food Sci. 2019, 29, 94–98. [Google Scholar] [CrossRef] [Scilit]
- Kushiro, M.; Hatabayashi, H.; Nakagawa, H.; Yabe, K. Detection of Aspergillus novoparasiticus from Japanese sugarcane field by the dichlorvos-ammonia (DV-AM) method with single colony AM assay. JSM Mycotoxins 2020, 70, 51–56. [Google Scholar] [CrossRef] [Scilit]
- Sijinamanoj, V.; Muthukumar, T.; Muthuraja, R.; Rayappan, K.; Karmegam, N.; Saminathan, K.; Govarthanan, M.; Kathireswari, P. Ligninolytic valorization of agricultural residues by Aspergillus nomius and Trichoderma harzianum isolated from gut and comb of Odontotermes obesus (Termitidae). Chemosphere 2021, 284, 131384. [Google Scholar] [CrossRef] [Scilit]
- Varga, J.; Frisvad, J.C.; Samson, R. Two new aflatoxin producing species, and an overview of Aspergillus section Flavi. Stud. Mycol. 2011, 69, 57–80. [Google Scholar] [CrossRef] [Scilit]
- Guchi, E. Implication of aflatoxin contamination in agricultural products. J. Food Nutr. Res. 2015, 3, 12–20. [Google Scholar]
- Khan, R.; Ghazali, F.M.; Mahyudin, N.A.; Samsudin, N.I.P. Biocontrol of aflatoxins using non-aflatoxigenic Aspergillus flavus: A literature review. J. Fungi 2021, 7, 381. [Google Scholar] [CrossRef] [Scilit]
- Seyedmousavi, S.; Bosco, S.D.M.; De Hoog, S.; Ebel, F.; Elad, D.; Gomes, R.R.; Jacobsen, I.D.; Jensen, H.E.; Martel, A.; Mignon, B.; et al. Fungal infections in animals: A patchwork of different situations. Med. Mycol. J. 2018, 56, S165–S187. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mevers, E.; Chouvenc, T.; Su, N.Y.; Clardy, J. Chemical interaction among termite-associated microbes. J. Chem. Ecol. 2017, 43, 1078–1085. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jaber, S.; Mercier, A.; Knio, K.; Brun, S.; Kambris, Z. Isolation of fungi from dead arthropods and identification of a new mosquito natural pathogen. Parasit. Vectors 2016, 9, 1–10. [Google Scholar] [CrossRef] [Scilit]
- Lin, W.J.; Chiu, M.C.; Lin, C.C.; Chung, Y.K.; Chou, J.Y. Efficacy of Entomopathogenic fungus Aspergillus nomius against Dolichoderus thoracicus. BioControl 2021, 66, 463–473. [Google Scholar] [CrossRef] [Scilit]
- Horn, B.W. Biodiversity of Aspergillus section Flavi in the United States: A review. Food Addit. Contam. 2007, 24, 1088–1102. [Google Scholar] [CrossRef] [Scilit]









| Primers | Sequences (3–5) |
|---|---|
| Truseq ITS 1F | TGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTTGGTCATTTAGAGGAAGTAA |
| Truseq ITS 4 | ACACTCTTTCCCCACACGACGCTCTTCCGATCTTCCTCCGCTTATTGATATGC |
| Organism/HIT | Cluster Size | Percentage | Genbank Accession # |
|---|---|---|---|
| Pleurostomophora richardsiae | 16,413 | 60.07 | KC341983.1 |
| Aspergillus nomius | 8993 | 32.91 | KR905619.1 |
| Fungal endophyte | 771 | 2.82 | HM537034.1 |
| Fungal sp. | 489 | 1.79 | KC506340.1 |
| uncultured fungus | 252 | 0.92 | KP167637.1 |
| Asteromella pistaciarum | 111 | 0.41 | FR681903.1 |
| uncultured marine | 95 | 0.35 | JX269272.1 |
| Paraconiothyrium hawaiiense | 75 | 0.27 | KJ737370.1 |
| uncultured ascomycota | 48 | 0.18 | KF060196.1 |
| Cladosporium cladosporioides | 34 | 0.12 | KR012925.1 |
| Rhodosporidium babjevae | 8 | 0.03 | KP732492.1 |
| Cytospora austromontana | 5 | 0.02 | JN693510.1 |
| Coriolopsis caperata | 5 | 0.02 | AB158316.1 |
| uncultured bacterium | 4 | 0.01 | AB948531.1 |
| Pleurostoma ootheca | 3 | 0.01 | AY725469.1 |
| Pestalotiopsis sp. | 3 | 0.01 | KR012893.1 |
| Aspergillus oryzae | 2 | 0.01 | KP794148.1 |
| Stachybotrys nephrospora | 2 | 0.01 | AF081476.2 |
| Malassezia restricta | 1 | 0.00 | JQ088233.1 |
| Chroococcidiopsis cubana | 1 | 0.00 | HM630151.1 |
| uncultured eukaryote | 1 | 0.00 | FJ176550.1 |
| Pestalotiopsis citrina | 1 | 0.00 | KR065415.1 |
| uncultured bacteria | 1 | 0.00 | HE611543.1 |
| Dothideomycetes sp. | 1 | 0.00 | KM519276.1 |
| Aspergillus sp. | 1 | 0.00 | KP686465.1 |
| uncultured gamma | 1 | 0.00 | AY770726.1 |
| Chroococcidiopsis thermalis | 1 | 0.00 | NR_102464.1 |
| No hits | 0 | 0.00 |
| Feature ID | Taxonomy | Confidence |
|---|---|---|
| OTU_1 | k__Fungi;p__Ascomycota;c__Sordariomycetes;o__Calosphaeriales;f__Pleurostomataceae;g__Pleurostoma;s__Pleurostoma_ootheca | 0.9999509156065854 |
| OTU_2 | k__Fungi;p__Ascomycota;c__Eurotiomycetes;o__Eurotiales;f__Aspergillaceae;g__Aspergillus | 0.9985353361019444 |
| OTU_3 | k__Fungi;p__Ascomycota;c__Sordariomycetes;o__Calosphaeriales;f__Pleurostomataceae;g__Pleurostoma;s__Pleurostoma_ootheca | 0.9999969482027593 |
| OTU_4 | k__Fungi;p__Ascomycota;c__Sordariomycetes;o__Diaporthales;f__Valsaceae;g__Cytospora | 0.854358736229371 |
| OTU_5 | k__Fungi;p__Ascomycota;c__Sordariomycetes;o__Diaporthales;f__Diaporthaceae;g__Diaporthe | 0.8335552129523334 |
| OTU_6 | k__Fungi;p__Ascomycota;c__Sordariomycetes;o__Diaporthales;f__Diaporthaceae;g__Diaporthe;s__Diaporthe_pterocarpi | 0.795273430121415 |
| OTU_7 | k__Fungi;p__Ascomycota;c__Sordariomycetes;o__Diaporthales | 0.9999795871372799 |
| OTU_8 | k__Fungi;p__Ascomycota;c__Sordariomycetes;o__Xylariales;f__Xylariales_fam_Incertae_sedis;g__Liberomyces;s__Liberomyces_pistaciae | 0.9182666027194447 |
| OTU_9 | k__Fungi;p__Ascomycota;c__Dothideomycetes;o__Pleosporales;f__Didymosphaeriaceae;g__Paraconiothyrium;s__Paraconiothyrium_archidendri | 0.7832631665096351 |
| OTU_10 | k__Fungi;p__Ascomycota;c__Dothideomycetes;o__Capnodiales | 0.9779387227439547 |
| OTU_11 | k__Fungi;p__Ascomycota;c__Eurotiomycetes;o__Eurotiales;f__Aspergillaceae;g__Aspergillus | 0.9974969716266882 |
| OTU_12 | k__Fungi | 0.999999999999996 |
| OTU_13 | k__Fungi;p__Ascomycota | 0.7497696576994625 |
| OTU_14 | k__Fungi;p__Ascomycota;c__Dothideomycetes;o__Capnodiales;f__unidentified;g__unidentified;s__unidentified | 0.8589742569616887 |
| OTU_15 | k__Fungi | 1.0000000000000056 |
| OTU_16 | k__Fungi;p__Ascomycota;c__Sordariomycetes;o__Diaporthales;f__Diaporthaceae;g__Diaporthe;s__Diaporthe_pterocarpi | 0.8165937605648326 |
| OTU_17 | k__Fungi | 1.0000000000000115 |
| OTU_18 | k__Fungi | 1.0000000000000049 |
| OTU_19 | k__Fungi | 0.9999999999999927 |
| OTU_20 | k__Fungi;p__Ascomycota;c__Dothideomycetes;o__Capnodiales;f__Teratosphaeriaceae | 0.8506001202469622 |
| OTU_21 | k__Fungi | 0.9999999999999925 |
| OTU_22 | k__Fungi;p__Ascomycota;c__Dothideomycetes;o__Pleosporales;f__Didymellaceae | 0.9192106392585596 |
| OTU_23 | k__Fungi | 1.0000000000000016 |
| OTU_24 | k__Fungi | 0.9999999999999964 |
| OTU_25 | k__Fungi;p__Ascomycota;c__Dothideomycetes;o__Pleosporales;f__Pleosporaceae;g__Alternaria | 0.999990897152982 |
| OTU_26 | k__Fungi | 0.9999999999999876 |
| OTU_27 | k__Fungi;p__Ascomycota;c__Dothideomycetes;o__Pleosporales;f__Didymellaceae | 0.998632976176477 |
| OTU_28 | k__Fungi;p__Basidiomycota | 0.7726061895145415 |
| OTU_29 | k__Fungi;p__Ascomycota;c__Dothideomycetes;o__Capnodiales;f__Cladosporiaceae;g__Toxicocladosporium | 0.9999991617301468 |
| OTU_30 | k__Fungi;p__Ascomycota;c__Sordariomycetes;o__Hypocreales;f__Stachybotryaceae;g__Stachybotrys;s__Stachybotrys_aloeticola | 0.9911876600078486 |
| OTU_31 | k__Fungi | 0.9999999999999845 |
| OTU_32 | k__Fungi;p__Ascomycota;c__Sordariomycetes;o__Hypocreales;f__Nectriaceae;g__Fusarium;s__Fusarium_lacertarum | 0.9385539330711409 |
| OTU_33 | k__Fungi;p__Ascomycota;c__Dothideomycetes;o__Capnodiales;f__Mycosphaerellaceae | 0.9992143068624603 |
| OTU_34 | k__Fungi;p__Ascomycota;c__Eurotiomycetes;o__Chaetothyriales;f__Herpotrichiellaceae;g__Exophiala;s__Exophiala_sideris | 0.9988522177150717 |
| OTU_35 | k__Fungi;p__Ascomycota | 0.8032801838524619 |
| OTU_36 | k__Fungi;p__Ascomycota;c__Sordariomycetes;o__Xylariales;f__Diatrypaceae;g__Diatrype;s__Diatrype_brunneospora | 0.9999959405293852 |
| OTU_37 | k__Fungi;p__Basidiomycota;c__Microbotryomycetes;o__Sporidiobolales;f__Sporidiobolaceae;g__Rhodotorula;s__Rhodotorula_graminis | 0.9826119507998325 |
| OTU_38 | k__Fungi | 0.9999999999999927 |
| OTU_39 | k__Fungi;p__Ascomycota;c__Dothideomycetes;o__Pleosporales;f__Pleosporales_fam_Incertae_sedis;g__Parapyrenochaeta;s__Parapyrenochaeta_acaciae | 0.9998214149691789 |
| OTU_40 | k__Fungi;p__Ascomycota;c__Sordariomycetes;o__Togniniales;f__Togniniaceae;g__Phaeoacremonium;s__Phaeoacremonium_rubrigenum | 0.8511770103314499 |
| OTU_41 | k__Fungi;p__Ascomycota;c__Sordariomycetes;o__Xylariales;f__Sporocadaceae;g__Heterotruncatella | 0.8372277516833296 |
| OTU_42 | k__Fungi | 0.999999999999982 |
| OTU_43 | k__Fungi;p__Basidiomycota;c__Agaricomycetes;o__Polyporales;f__Polyporaceae;g__Coriolopsis;s__Coriolopsis_caperata | 0.7238326239885736 |
| OTU_44 | k__Fungi;p__Ascomycota;c__Dothideomycetes;o__Capnodiales | 0.9999999997314887 |
| OTU_45 | k__Fungi;p__Ascomycota;c__Eurotiomycetes;o__Phaeomoniellales;f__Phaeomoniellaceae;g__Phaeomoniella;s__Phaeomoniella_chlamydospora | 0.8528244306902385 |
| OTU_46 | k__Fungi;p__Ascomycota;c__Sordariomycetes;o__Calosphaeriales;f__Calosphaeriaceae;g__Jattaea;s__Jattaea_algeriensis | 0.8490981193860933 |
| OTU_47 | k__Fungi | 1.0000000000000087 |
| OTU_48 | k__Fungi;p__Ascomycota;c__Eurotiomycetes;o__Chaetothyriales;f__Herpotrichiellaceae | 0.9057961832384308 |
| Organism/HIT | Cluster Size | Percentage | Accession # |
|---|---|---|---|
| Pleurostomophora richardsiae | 55,201 | 72.73 | KC341983.1 |
| Phaeoacremonium scolyti | 11,363 | 14.97 | KC166687.1 |
| Coriolopsis caperata | 4594 | 6.05 | AB158316.1 |
| Exophiala oligosperma | 2240 | 2.95 | KT323978.1 |
| Rhytidhysteron rufulum | 1010 | 1.33 | KJ787018.1 |
| Cladophialophora sp. | 511 | 0.67 | AB986422.1 |
| uncultured fungus | 321 | 0.42 | AB615469.1 |
| uncultured cryptodiscus | 225 | 0.30 | KP323396.1 |
| Fungal endophyte | 126 | 0.17 | KP335506.1 |
| Exophiala sp. | 96 | 0.13 | HQ452316.1 |
| Pleurostoma ootheca | 76 | 0.10 | AY725469.1 |
| Fusarium equiseti | 45 | 0.06 | JN596252.1 |
| Dothideomycetes sp. | 40 | 0.05 | AB986427.1 |
| Chaetomium aureum | 28 | 0.04 | KC215131.1 |
| Pseudolachnella complanata | 7 | 0.01 | AB934078.1 |
| Polyporales sp. | 6 | 0.01 | JQ312175.1 |
| Coriolopsis sp. | 2 | 0.00 | KJ612041.1 |
| Alternaria sp. | 1 | 0.00 | KT186141.1 |
| Phaeothecoidea melaleuca | 1 | 0.00 | HQ599594.1 |
| Aspergillus brasiliensis | 1 | 0.00 | KM491891.1 |
| Predicted: mesocricetus | 1 | 0.00 | XM_013111494.1 |
| Sporobolomyces griseoflavus | 1 | 0.00 | AB038105.1 |
| Readeriella eucalypti | 1 | 0.00 | GQ852781.1 |
| No hits | o | 0.00 | None |
| Feature ID | Taxonomy | Confidence |
|---|---|---|
| OTU_1 | k__Fungi;p__Ascomycota;c__Sordariomycetes;o__Calosphaeriales;f__Pleurostomataceae;g__Pleurostoma;s__Pleurostoma_ootheca | 0.9999969482027593 |
| OTU_2 | k__Fungi;p__Ascomycota;c__Sordariomycetes;o__Togniniales;f__Togniniaceae;g__Phaeoacremonium;s__Phaeoacremonium_rubrigenum | 0.8511770103314499 |
| OTU_3 | k__Fungi;p__Basidiomycota;c__Agaricomycetes;o__Polyporales;f__Polyporaceae;g__Coriolopsis;s__Coriolopsis_caperata | 0.7238326239885736 |
| OTU_4 | k__Fungi;p__Ascomycota;c__Eurotiomycetes;o__Chaetothyriales;f__Herpotrichiellaceae | 0.9057961832384308 |
| OTU_5 | k__Fungi;p__Ascomycota;c__Sordariomycetes;o__Calosphaeriales;f__Pleurostomataceae;g__Pleurostoma;s__Pleurostoma_ootheca | 0.9999509156065854 |
| OTU_6 | k__Fungi;p__Ascomycota;c__Dothideomycetes;o__Hysteriales;f__Hysteriaceae;g__Rhytidhysteron;s__Rhytidhysteron_rufulum | 0.8900994594938357 |
| OTU_7 | k__Fungi;p__Ascomycota;c__Dothideomycetes;o__Capnodiales;f__Mycosphaerellaceae;g__Xenomycosphaerella;s__Xenomycosphaerella_elongata | 0.9001828297722754 |
| OTU_8 | k__Fungi;p__Ascomycota;c__Lecanoromycetes;o__Ostropales;f__Stictidaceae;g__Cryptodiscus;s__unidentified | 0.9998687556318772 |
| OTU_9 | k__Fungi;p__Ascomycota;c__Dothideomycetes;o__Hysteriales;f__Hysteriaceae | 0.9996172473675551 |
| OTU_10 | k__Fungi;p__Ascomycota | 0.8535115882460728 |
| OTU_11 | k__Fungi;p__Ascomycota;c__Sordariomycetes;o__Xylariales;f__Xylariaceae;g__Arthroxylaria;s__unidentified | 0.7298461518721538 |
| OTU_12 | k__Fungi;p__Ascomycota;c__Dothideomycetes;o__Capnodiales;f__Dissoconiaceae;g__Ramichloridium | 0.999999545156917 |
| OTU_13 | k__Fungi;p__Basidiomycota | 0.8619031783651352 |
| OTU_14 | k__Fungi;p__Ascomycota | 0.9143642096803432 |
| OTU_15 | k__Fungi;p__Ascomycota;c__Sordariomycetes | 0.7838726000734728 |
| OTU_16 | k__Fungi;p__Ascomycota;c__Sordariomycetes;o__Hypocreales;f__Nectriaceae;g__Fusarium;s__Fusarium_oxysporum | 0.98492272949497 |
| OTU_17 | k__Fungi;p__Ascomycota;c__Sordariomycetes;o__Calosphaeriales;f__Pleurostomataceae;g__Pleurostoma;s__Pleurostoma_ootheca | 0.9999851012858587 |
| OTU_18 | k__Fungi;p__Ascomycota;c__Sordariomycetes;o__Sordariales;f__Chaetomiaceae;g__Chaetomium;s__Chaetomium_aureum | 0.9574886918513182 |
| OTU_19 | k__Fungi;p__Ascomycota;c__Dothideomycetes;o__Pleosporales;f__Pleosporales_fam_Incertae_sedis;g__Parapyrenochaeta;s__unidentified | 0.9991075911643039 |
| OTU_20 | k__Fungi;p__Ascomycota;c__Sordariomycetes;o__Diaporthales | 0.9999795871372799 |
| OTU_21 | k__Fungi;p__Ascomycota;c__Sordariomycetes;o__Xylariales;f__Xylariales_fam_Incertae_sedis;g__Liberomyces;s__Liberomyces_pistaciae | 0.9182666027194447 |
| OTU_22 | k__Fungi;p__Ascomycota;c__Sordariomycetes | 0.7313138037550708 |
| OTU_23 | k__Fungi;p__Ascomycota;c__Eurotiomycetes;o__Eurotiales;f__Aspergillaceae;g__Aspergillus | 0.999191894043742 |
| OTU_24 | k__Fungi;p__Ascomycota;c__Dothideomycetes;o__Pleosporales;f__Cucurbitariaceae;g__Curreya;s__unidentified | 0.8751371838086929 |
| OTU_25 | k__Fungi;p__Ascomycota;c__Dothideomycetes;o__Pleosporales;f__Pleosporaceae;g__Alternaria | 0.999990897152982 |
| OTU_26 | k__Fungi;p__Ascomycota;c__Dothideomycetes;o__Pleosporales;f__Didymellaceae | 0.9192106392585596 |
| OTU_27 | k__Fungi;p__Ascomycota;c__Sordariomycetes;o__Diaporthales;f__Valsaceae;g__Cytospora;s__Cytospora_fraxinigena | 0.934738163030393 |
| OTU_28 | k__Fungi;p__Ascomycota;c__Dothideomycetes;o__Pleosporales;f__Didymosphaeriaceae;g__Pseudocamarosporium;s__Pseudocamarosporium_brabeji | 0.9445141771039463 |
| OTU_29 | k__Fungi;p__Ascomycota;c__Eurotiomycetes;o__Eurotiales;f__Aspergillaceae;g__Penicillium | 0.998645369895211 |
| OTU_30 | k__Fungi;p__Basidiomycota | 0.9219400198746588 |
| OTU_31 | k__Fungi;p__Ascomycota;c__Dothideomycetes | 0.7100930622298849 |
| OTU_32 | k__Fungi;p__Ascomycota;c__Dothideomycetes;o__Pleosporales;f__Sporormiaceae;g__Sporormiella;s__unidentified | 0.9652105615605318 |
| OTU_33 | k__Fungi;p__Ascomycota;c__Dothideomycetes;o__Botryosphaeriales;f__Aplosporellaceae;g__Aplosporella;s__Aplosporella_papillata | 0.9079093067255156 |
| OTU_34 | k__Fungi;p__Ascomycota;c__Sordariomycetes;o__Calosphaeriales;f__Calosphaeriaceae;g__Jattaea;s__Jattaea_algeriensis | 0.8490981193860933 |
| OTU_35 | k__Fungi;p__Basidiomycota;c__Agaricomycetes | 0.9999999479732182 |
| OTU_36 | k__Fungi;p__Ascomycota;c__Dothideomycetes;o__Pleosporales | 0.9907212343471081 |
| OTU_37 | k__Fungi;p__Ascomycota;c__Dothideomycetes;o__Pleosporales;f__Teichosporaceae;g__Teichospora;s__Teichospora_trabicola | 0.9919360368035886 |
| OTU_38 | k__Fungi;p__Ascomycota;c__Dothideomycetes;o__Capnodiales;f__Mycosphaerellaceae | 0.833939977809027 |
| OTU_39 | k__Fungi;p__Ascomycota;c__Eurotiomycetes;o__Chaetothyriales | 0.9604725349305658 |
| OTU_40 | k__Fungi;p__Ascomycota;c__Eurotiomycetes;o__Eurotiales;f__Aspergillaceae;g__Penicillium | 0.9941781575522258 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nemadodzi, L.E.; Prinsloo, G. A New Proposed Symbiotic Plant–Herbivore Relationship between Burkea africana Trees, Cirina forda Caterpillars and Their Associated Fungi Pleurostomophora richardsiae and Aspergillus nomius. Microorganisms 2023, 11, 1864. https://doi.org/10.3390/microorganisms11071864
Nemadodzi LE, Prinsloo G. A New Proposed Symbiotic Plant–Herbivore Relationship between Burkea africana Trees, Cirina forda Caterpillars and Their Associated Fungi Pleurostomophora richardsiae and Aspergillus nomius. Microorganisms. 2023; 11(7):1864. https://doi.org/10.3390/microorganisms11071864
Chicago/Turabian StyleNemadodzi, Lufuno Ethel, and Gerhard Prinsloo. 2023. "A New Proposed Symbiotic Plant–Herbivore Relationship between Burkea africana Trees, Cirina forda Caterpillars and Their Associated Fungi Pleurostomophora richardsiae and Aspergillus nomius" Microorganisms 11, no. 7: 1864. https://doi.org/10.3390/microorganisms11071864
APA StyleNemadodzi, L. E., & Prinsloo, G. (2023). A New Proposed Symbiotic Plant–Herbivore Relationship between Burkea africana Trees, Cirina forda Caterpillars and Their Associated Fungi Pleurostomophora richardsiae and Aspergillus nomius. Microorganisms, 11(7), 1864. https://doi.org/10.3390/microorganisms11071864

