IL17A Suppresses IGFBP1 in Human Endometrial Stromal Cells
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethical Statement
2.2. Decidualization of Human EnSCs
2.3. Human EnSC Cell Line KC02-44D and Treatment
2.4. Quantitative Polymerase Chain Reaction (qPCR)
2.5. Western Blotting
2.6. Immunocytochemistry
2.7. Statistical Analyses
3. Results
3.1. Elevations in IL1B, IL23A, and IL17D in Decidualized EnSCs
3.2. Cytokines in KC02-44D Cells
3.3. Responsiveness of EnSCs to γδ17T and ILC3-Derived Cytokines
3.4. IL17A Treatment of KC02-44D Cells
3.5. Effect of IL17A on Decidualization Markers in KC02-44D Cells
3.6. Effect of IL17A on FOXO1 Localization in KC02-44D Cells
3.7. Mechanism of IL17A-Dependent FOXO1 Migration
4. Discussion
Limitations
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Murata, H.; Tanaka, S.; Tsuzuki-Nakao, T.; Kido, T.; Kakita-Kobayashi, M.; Kida, N.; Hisamatsu, Y.; Tsubokura, H.; Hashimoto, Y.; Kitada, M.; et al. The transcription factor hand2 up-regulates transcription of the il15 gene in human endometrial stromal cells. J. Biol. Chem. 2020, 295, 9596–9605. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, C.; Zhao, W.; Huang, X.; Jiang, Z.; Liu, L.; Cui, L.; Li, X.; Li, D.; Du, M. Torc2/3-mediated dusp1 upregulation is essential for human decidualization. Reproduction 2021, 161, 573–580. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Murata, H.; Tanaka, S.; Okada, H. The regulators of human endometrial stromal cell decidualization. Biomolecules 2022, 12, 1275. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shi, J.W.; Lai, Z.Z.; Yang, H.L.; Zhou, W.J.; Zhao, X.Y.; Xie, F.; Liu, S.P.; Chen, W.D.; Zhang, T.; Ye, J.F.; et al. An igf1-expressing endometrial stromal cell population is associated with human decidualization. BMC Biol. 2022, 20, 276. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vento-Tormo, R.; Efremova, M.; Botting, R.A.; Turco, M.Y.; Vento-Tormo, M.; Meyer, K.B.; Park, J.E.; Stephenson, E.; Polanski, K.; Goncalves, A.; et al. Single-cell reconstruction of the early maternal-fetal interface in humans. Nature 2018, 563, 347–353. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, W.J.; Chao, F.; Yi, L.; Yin, G.J.; Bao, S.H.; Qiu, L.H.; Lin, Q.D. Increased prevalence of t helper 17 (th17) cells in peripheral blood and decidua in unexplained recurrent spontaneous abortion patients. J. Reprod. Immunol. 2010, 84, 164–170. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Santner-Nanan, B.; Peek, M.J.; Khanam, R.; Richarts, L.; Zhu, E.; de St Groth, B.F.; Nanan, R. Systemic increase in the ratio between foxp3+ and il-17-producing cd4+ t cells in healthy pregnancy but not in preeclampsia. J. Immunol. 2009, 183, 7023–7030. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ito, M.; Nakashima, A.; Hidaka, T.; Okabe, M.; Bac, N.D.; Ina, S.; Yoneda, S.; Shiozaki, A.; Sumi, S.; Tsuneyama, K.; et al. A role for il-17 in induction of an inflammation at the fetomaternal interface in preterm labour. J. Reprod. Immunol. 2010, 84, 75–85. [Google Scholar] [CrossRef] [Scilit]
- Chang, S.H.; Dong, C. Signaling of interleukin-17 family cytokines in immunity and inflammation. Cell Signal. 2011, 23, 1069–1075. [Google Scholar] [CrossRef] [Scilit]
- Iwakura, Y.; Ishigame, H.; Saijo, S.; Nakae, S. Functional specialization of interleukin-17 family members. Immunity 2011, 34, 149–162. [Google Scholar] [CrossRef] [Scilit]
- Bastid, J.; Dejou, C.; Docquier, A.; Bonnefoy, N. The emerging role of the il-17b/il-17rb pathway in cancer. Front. Immunol. 2020, 11, 718. [Google Scholar] [CrossRef] [Scilit]
- Chang, S.H.; Reynolds, J.M.; Pappu, B.P.; Chen, G.; Martinez, G.J.; Dong, C. Interleukin-17c promotes th17 cell responses and autoimmune disease via interleukin-17 receptore. Immunity 2011, 35, 611–621. [Google Scholar] [CrossRef] [Scilit]
- Reynolds, J.M.; Martinez, G.J.; Nallaparaju, K.C.; Chang, S.H.; Wang, Y.H.; Dong, C. Cutting edge: Regulation of intestinal inflammation and barrier function by il-17c. J. Immunol. 2012, 189, 4226–4230. [Google Scholar] [CrossRef] [Scilit]
- Brembilla, N.C.; Boehncke, W.H. Revisiting the interleukin 17 family of cytokines in psoriasis: Pathogenesis and potential targets for innovative therapies. Front. Immunol. 2023, 14, 1186455. [Google Scholar] [CrossRef] [Scilit]
- Huang, J.; Lee, H.Y.; Zhao, X.; Han, J.; Su, Y.; Sun, Q.; Shao, J.; Ge, J.; Zhao, Y.; Bai, X.; et al. Interleukin-17d regulates group 3 innate lymphoid cell function through its receptor cd93. Immunity 2021, 54, 673–686.e4. [Google Scholar] [CrossRef] [Scilit]
- Barlow, J.L.; McKenzie, A.N. Il-25: A key requirement for the regulation of type-2 immunity. Biofactors 2009, 35, 178–182. [Google Scholar] [CrossRef] [Scilit]
- Morita, H.; Moro, K.; Koyasu, S. Innate lymphoid cells in allergic and nonallergic inflammation. J. Allergy Clin. Immunol. 2016, 138, 1253–1264. [Google Scholar] [CrossRef] [Scilit]
- von Moltke, J.; Ji, M.; Liang, H.E.; Locksley, R.M. Tuft-cell-derived il-25 regulates an intestinal ilc2-epithelial response circuit. Nature 2016, 529, 221–225. [Google Scholar] [CrossRef] [Scilit]
- Wang, W.J.; Zhang, H.; Chen, Z.Q.; Zhang, W.; Liu, X.M.; Fang, J.Y.; Liu, F.J.; Kwak-Kim, J. Endometrial tgf-beta, il-10, il-17 and autophagy are dysregulated in women with recurrent implantation failure with chronic endometritis. Reprod. Biol. Endocrinol. 2019, 17, 2. [Google Scholar] [CrossRef] [Scilit]
- Crosby, D.A.; LGlover, E.; Brennan, E.P.; Kelly, P.; Cormican, P.; Moran, B.; Giangrazi, F.; Downey, P.; Mooney, E.E.; Loftus, B.J.; et al. Dysregulation of the interleukin-17a pathway in endometrial tissue from women with unexplained infertility affects pregnancy outcome following assisted reproductive treatment. Hum. Reprod. 2020, 35, 1875–1888. [Google Scholar] [CrossRef] [Scilit]
- Farshchi, M.; Abdollahi, E.; Saghafi, N.; Hosseini, A.; Fallahi, S.; Rostami, S.; Rostami, P.; Rafatpanah, H.; Habibagahi, M. Evaluation of th17 and treg cytokines in patients with unexplained recurrent pregnancy loss. J. Clin. Transl. Res. 2022, 8, 256–265. [Google Scholar] [PubMed]
- Moura, G.A.; Rocha, Y.M.; Moura, F.L.D.; Freitas, J.O.; Rodrigues, J.P.V.; Goncalves, V.P.; Nicolete, R. Immune system cells modulation in patients with reproductive issues: A systematic review approach. JBRA Assist. Reprod. 2024, 28, 78–89. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kang, S.; Wu, Q.; Huang, J.; Yang, B.; Liang, C.; Chi, P.; Wu, C. Tissue resident memory gammadeltat cells in murine uterus expressed high levels of il-17 promoting the invasion of trophocytes. Front. Immunol. 2020, 11, 588227. [Google Scholar] [CrossRef] [Scilit]
- You, Y.; Stelzl, P.; Joseph, D.N.; Aldo, P.B.; Maxwell, A.J.; Dekel, N.; Liao, A.; Whirledge, S.; Mor, G. Tnf-alpha regulated endometrial stroma secretome promotes trophoblast invasion. Front. Immunol. 2021, 12, 737401. [Google Scholar] [CrossRef] [Scilit]
- Wu, H.X.; Jin, L.P.; Xu, B.; Liang, S.S.; Li, D.J. Decidual stromal cells recruit th17 cells into decidua to promote proliferation and invasion of human trophoblast cells by secreting il-17. Cell. Mol. Immunol. 2014, 11, 253–262. [Google Scholar] [CrossRef] [Scilit]
- Sumaria; Roediger, B.; Ng, L.G.; Qin, J.; Pinto, R.; Cavanagh, L.L.; Shklovskaya, E.; de St Groth, B.F.; Triccas, J.A.; Weninger, W. Cutaneous immunosurveillance by self-renewing dermal gammadelta t cells. J. Exp. Med. 2011, 208, 505–518. [Google Scholar]
- Pinget, G.V.; Corpuz, T.M.; Stolp, J.; Lousberg, E.L.; Diener, K.R.; Robertson, S.A.; Sprent, J.; Webster, K.E. The majority of murine gammadelta t cells at the maternal-fetal interface in pregnancy produce il-17. Immunol. Cell Biol. 2016, 94, 623–630. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kohlgruber, A.C.; Gal-Oz, S.T.; LaMarche, N.M.; Shimazaki, M.; Duquette, D.; Koay, H.F.; Nguyen, H.N.; Mina, A.I.; Paras, T.; Tavakkoli, A.; et al. Gammadelta t cells producing interleukin-17a regulate adipose regulatory t cell homeostasis and thermogenesis. Nat. Immunol. 2018, 19, 464–474. [Google Scholar] [CrossRef] [Scilit]
- Male, V.; Hughes, T.; McClory, S.; Colucci, F.; Caligiuri, M.A.; Moffett, A. Immature nk cells, capable of producing il-22, are present in human uterine mucosa. J. Immunol. 2010, 185, 3913–3918. [Google Scholar] [CrossRef] [Scilit]
- Doisne, J.M.; Balmas, E.; Boulenouar, S.; Gaynor, L.M.; Kieckbusch, J.; Gardner, L.; Hawkes, D.A.; Barbara, C.F.; Sharkey, A.M.; Brady, H.J.; et al. Composition, development, and function of uterine innate lymphoid cells. J. Immunol. 2015, 195, 3937–3945. [Google Scholar] [CrossRef] [Scilit]
- Montaldo, E.; Vacca, P.; Chiossone, L.; Croxatto, D.; Loiacono, F.; Martini, S.; Ferrero, S.; Walzer, T.; Moretta, L.; Mingari, M.C. Unique eomes(+) nk cell subsets are present in uterus and decidua during early pregnancy. Front. Immunol. 2015, 6, 646. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huhn, O.; Zhao, X.; Esposito, L.; Moffett, A.; Colucci, F.; Sharkey, A.M. How do uterine natural killer and innate lymphoid cells contribute to successful pregnancy? Front. Immunol. 2021, 12, 607669. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vacca, P.; EMontaldo; Croxatto, D.; Loiacono, F.; Canegallo, F.; Venturini, P.L.; Moretta, L.; Mingari, M.C. Identification of diverse innate lymphoid cells in human decidua. Mucosal. Immunol. 2015, 8, 254–264. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, Y.; Romero, R.; Miller, D.; Silva, P.; Panaitescu, B.; Theis, K.R.; Arif, A.; Hassan, S.S.; Gomez-Lopez, N. Innate lymphoid cells at the human maternal-fetal interface in spontaneous preterm labor. Am. J. Reprod. Immunol. 2018, 79, e12820. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vacca, P.; Vitale, C.; Munari, E.; Cassatella, M.A.; Mingari, M.C.; Moretta, L. Human innate lymphoid cells: Their functional and cellular interactions in decidua. Front. Immunol. 2018, 9, 1897. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xie, J.; Gu, A.; He, H.; Zhao, Q.; Yu, Y.; Chen, J.; Cheng, Z.; Zhou, P.; Zhou, Q.; Jin, M. Autoimmune thyroid disease disrupts immune homeostasis in the endometrium of unexplained infertility women-a single-cell rna transcriptome study during the implantation window. Front. Endocrinol. 2023, 14, 1185147. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vacca, P.; Chiossone, L.; Mingari, M.C.; Moretta, L. Heterogeneity of nk cells and other innate lymphoid cells in human and murine decidua. Front. Immunol. 2019, 10, 170. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sutton, C.E.; Lalor, S.J.; Sweeney, C.M.; Brereton, C.F.; Lavelle, E.C.; Mills, K.H. Interleukin-1 and il-23 induce innate il-17 production from gammadelta t cells, amplifying th17 responses and autoimmunity. Immunity 2009, 31, 331–341. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Papotto, P.H.; Goncalves-Sousa, N.; Schmolka, N.; Iseppon, A.; Mensurado, S.; Stockinger, B.; Ribot, J.C.; Silva-Santos, B. Il-23 drives differentiation of peripheral gammadelta17 t cells from adult bone marrow-derived precursors. EMBO Rep. 2017, 18, 1957–1967. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Papotto, P.H.; Reinhardt, A.; Prinz, I.; Silva-Santos, B. Innately versatile: Gammadelta17 t cells in inflammatory and autoimmune diseases. J. Autoimmun. 2018, 87, 26–37. [Google Scholar] [CrossRef] [Scilit]
- Bernink, J.H.; Krabbendam, L.; Germar, K.; de Jong, E.; Gronke, K.; Kofoed-Nielsen, M.; Munneke, J.M.; Hazenberg, M.D.; Villaudy, J.; Buskens, C.J.; et al. Interleukin-12 and -23 control plasticity of cd127(+) group 1 and group 3 innate lymphoid cells in the intestinal lamina propria. Immunity 2015, 43, 146–160. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Okada, H.; Nakajima, T.; Yoshimura, T.; Yasuda, K.; Kanzaki, H. The inhibitory effect of dienogest, a synthetic steroid, on the growth of human endometrial stromal cells in vitro. Mol. Hum. Reprod. 2001, 7, 341–347. [Google Scholar] [CrossRef] [Scilit]
- Murata, H.; Tsuzuki, T.; Kido, T.; Kakita-Kobayashi, M.; Kida, N.; Hisamatsu, Y.; Okada, H. Progestin-induced heart and neural crest derivatives-expressed transcript 2 inhibits angiopoietin 2 via fibroblast growth factor 9 in human endometrial stromal cells. Reprod. Biol. 2019, 19, 14–21. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhu, H.H.; Huang, J.R.; Mazella, J.; Rosenberg, M.; Tseng, L. Differential effects of progestin and relaxin on the synthesis and secretion of immunoreactive prolactin in long term culture of human endometrial stromal cells. J. Clin. Endocrinol. Metab. 1990, 71, 889–899. [Google Scholar] [CrossRef] [Scilit]
- Yuhki, M.; Kajitani, T.; Mizuno, T.; Aoki, Y.; Maruyama, T. Establishment of an immortalized human endometrial stromal cell line with functional responses to ovarian stimuli. Reprod. Biol. Endocrinol. 2011, 9, 104. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kakita-Kobayashi, M.; Murata, H.; Nishigaki, A.; Hashimoto, Y.; Komiya, S.; Tsubokura, H.; Kido, T.; Kida, N.; Tsuzuki-Nakao, T.; Matsuo, Y.; et al. Thyroid hormone facilitates in vitro decidualization of human endometrial stromal cells via thyroid hormone receptors. Endocrinology 2020, 161, bqaa049. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rao, X.; Huang, X.; Zhou, Z.; Lin, X. An improvement of the 2^(-delta delta ct) method for quantitative real-time polymerase chain reaction data analysis. Biostat. Bioinform. Biomath. 2013, 3, 71–85. [Google Scholar]
- Wright, J.F.; Bennett, F.; Li, B.; Brooks, J.; Luxenberg, D.P.; Whitters, M.J.; Tomkinson, K.N.; Fitz, L.J.; Wolfman, N.M.; Collins, M.; et al. The human il-17f/il-17a heterodimeric cytokine signals through the il-17ra/il-17rc receptor complex. J. Immunol. 2008, 181, 2799–2805. [Google Scholar] [CrossRef] [Scilit]
- Wu, L.; Zepp, J.; Li, X. Function of act1 in il-17 family signaling and autoimmunity. Adv. Exp. Med. Biol. 2012, 946, 223–235. [Google Scholar]
- Weng, H.Y.; Hsu, M.J.; Wang, C.C.; Chen, B.C.; Hong, C.Y.; Chen, M.C.; Chiu, W.T.; Lin, C.H. Zerumbone suppresses ikkalpha, akt, and foxo1 activation, resulting in apoptosis of gbm 8401 cells. J. Biomed. Sci. 2012, 19, 86. [Google Scholar] [CrossRef] [Scilit]
- Tanaka, S.; Honda, Y.; Sawachika, M.; Futani, K.; Yoshida, N.; Kodama, T. Degradation of stk16 via kctd17 with ubiquitin–proteasome system in relation to sleep–wake cycle. Kinases Phosphatases 2023, 1, 14–22. [Google Scholar] [CrossRef] [Scilit]
- Guilloteau, K.; Paris, I.; Pedretti, N.; Boniface, K.; Juchaux, F.; Huguier, V.; Guillet, G.; Bernard, F.X.; Lecron, J.C.; Morel, F. Skin inflammation induced by the synergistic action of il-17a, il-22, oncostatin m, il-1alpha, and tnf-alpha recapitulates some features of psoriasis. J. Immunol. 2010, 184, 5263–5270. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Murata, H.; Tanaka, S.; Okada, H. Immune tolerance of the human decidua. J. Clin. Med. 2021, 10, 351. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Obsil, T.; Obsilova, V. Structural basis for DNA recognition by foxo proteins. Biochim. Biophys. Acta 2011, 1813, 1946–1953. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tamura, I.; Jozaki, K.; Sato, S.; Shirafuta, Y.; Shinagawa, M.; Maekawa, R.; Taketani, T.; Asada, H.; Tamura, H.; Sugino, N. The distal upstream region of insulin-like growth factor-binding protein-1 enhances its expression in endometrial stromal cells during decidualization. J. Biol. Chem. 2018, 293, 5270–5280. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Murata, H.; Tanaka, S.; Hisamatsu, Y.; Tsubokura, H.; Hashimoto, Y.; Kitada, M.; Okada, H. Transcriptional regulation of lgals9 by hand2 and foxo1 in human endometrial stromal cells in women with regular cycles. Mol. Hum. Reprod. 2021, 27, gaab063. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vivier, E.; van de Pavert, S.A.; Cooper, M.D.; Belz, G.T. The evolution of innate lymphoid cells. Nat. Immunol. 2016, 17, 790–794. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Einenkel, R.; Ehrhardt, J.; Zygmunt, M.; Muzzio, D.O. Oxygen regulates ilc3 antigen presentation potential and pregnancy-related hormone actions. Reprod. Biol. Endocrinol. 2022, 20, 109. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nakamura, M.; Takakura, M.; Fujii, R.; Maida, Y.; Bono, Y.; Mizumoto, Y.; Zhang, X.; Kiyono, T.; Kyo, S. The prb-dependent foxo1/igfbp-1 axis is essential for progestin to inhibit endometrial epithelial growth. Cancer Lett. 2013, 336, 68–75. [Google Scholar] [CrossRef] [Scilit]
- McGeachy, M.J.; Cua, D.J.; Gaffen, S.L. The il-17 family of cytokines in health and disease. Immunity 2019, 50, 892–906. [Google Scholar] [CrossRef] [Scilit]
- Amarilyo, G.; Lourenco, E.V.; Shi, F.D.; La Cava, A. Il-17 promotes murine lupus. J. Immunol. 2014, 193, 540–543. [Google Scholar] [CrossRef] [Scilit]
- Lee, J.S.; Tato, C.M.; Joyce-Shaikh, B.; Gulen, M.F.; Cayatte, C.; Chen, Y.; Blumenschein, W.M.; Judo, M.; Ayanoglu, G.; McClanahan, T.K.; et al. Interleukin-23-independent il-17 production regulates intestinal epithelial permeability. Immunity 2015, 43, 727–738. [Google Scholar] [CrossRef] [Scilit]
- Crossey, P.A.; Pillai, C.C.; Miell, J.P. Altered placental development and intrauterine growth restriction in igf binding protein-1 transgenic mice. J. Clin. Investig. 2002, 110, 411–418. [Google Scholar] [CrossRef]
- Vivier, E.; Artis, D.; Colonna, M.; Diefenbach, A.; Di Santo, J.P.; Eberl, G.; Koyasu, S.; Locksley, R.M.; McKenzie, A.N.J.; Mebius, R.E.; et al. Innate lymphoid cells: 10 years on. Cell 2018, 174, 1054–1066. [Google Scholar] [CrossRef] [Scilit]
- Lim, A.I.; Li, Y.; Lopez-Lastra, S.; Stadhouders, R.; Paul, F.; Casrouge, A.; Serafini, N.; Puel, A.; Bustamante, J.; Surace, L.; et al. Systemic human ilc precursors provide a substrate for tissue ilc differentiation. Cell 2017, 168, 1086–1100.e10. [Google Scholar] [CrossRef] [Scilit]
- Haliloglu, Y.; Ozcan, A.; Erdem, S.; Azizoglu, Z.B.; Bicer, A.; Ozarslan, O.Y.; Kilic, O.; Okus, F.Z.; Demir, F.; Canatan, H.; et al. Characterization of cord blood cd3(+) tcrvalpha7.2(+) cd161(high) t and innate lymphoid cells in the pregnancies with gestational diabetes, morbidly adherent placenta, and pregnancy hypertension diseases. Am. J. Reprod. Immunol. 2022, 88, e13555. [Google Scholar] [CrossRef] [Scilit]
- Pearson, C.; Thornton, E.E.; McKenzie, B.; Schaupp, A.L.; Huskens, N.; Griseri, T.; West, N.; Tung, S.; Seddon, B.P.; Uhlig, H.H.; et al. Ilc3 gm-csf production and mobilisation orchestrate acute intestinal inflammation. eLife 2016, 5, e10066. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huhn, O.; Ivarsson, M.A.; Gardner, L.; Hollinshead, M.; Stinchcombe, J.C.; Chen, P.; Shreeve, N.; Chazara, O.; Farrell, L.E.; Theorell, J.; et al. Distinctive phenotypes and functions of innate lymphoid cells in human decidua during early pregnancy. Nat. Commun. 2020, 11, 381. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kang, S.; Wu, Q.; Yang, B.; Wu, C. Estrogen enhanced the expression of il-17 by tissue-resident memory gammadeltat cells from uterus via interferon regulatory factor 4. FASEB J. 2022, 36, e22166. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sugahara, T.; Tanaka, Y.; Hamaguchi, M.; Fujii, M.; Shimura, K.; Ogawa, K.; Mori, T.; Kusuki, I.; Fukui, M.; Kitawaki, J. Reduced innate lymphoid cells in the endometrium of women with endometriosis. Am. J. Reprod. Immunol. 2022, 87, e13502. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Allan, D.S.; Kirkham, C.L.; Aguilar, O.A.; Qu, L.C.; Chen, P.; Fine, J.H.; Serra, P.; Awong, G.; Gommerman, J.L.; Zuniga-Pflucker, J.C.; et al. An in vitro model of innate lymphoid cell function and differentiation. Mucosal. Immunol. 2015, 8, 340–351. [Google Scholar] [CrossRef] [Scilit]
- Zhou, J.; Yue, J.; Yao, Y.; Hou, P.; Zhang, T.; Zhang, Q.; Yi, L.; Mi, M. Dihydromyricetin protects intestinal barrier integrity by promoting il-22 expression in ilc3s through the ampk/sirt3/stat3 signaling pathway. Nutrients 2023, 15, 355. [Google Scholar] [CrossRef] [Scilit]
- Liu, X.; Sun, S.; Liu, D. Il-17d: A less studied cytokine of il-17 family. Int. Arch. Allergy Immunol. 2020, 181, 618–623. [Google Scholar] [CrossRef] [Scilit]
- Starnes, T.; Broxmeyer, H.E.; Robertson, M.J.; Hromas, R. Cutting edge: Il-17d, a novel member of the il-17 family, stimulates cytokine production and inhibits hemopoiesis. J. Immunol. 2002, 169, 642–646. [Google Scholar] [CrossRef] [Scilit]






| Sample No. | Materials | Methods | Age, Years | Menstrual Cycle Phase at the Time of Collection | |
|---|---|---|---|---|---|
| 1 | Primary culture EnSCs | Treated with E2 + MPA for 12 days | RT-qPCR | 50 | Proliferative |
| 2 | Primary culture EnSCs | Treated with E2 + MPA for 12 days | RT-qPCR | 45 | Mid-secretory |
| 3 | Primary culture EnSCs | Treated with E2 + MPA for 12 days | RT-qPCR | 48 | Late secretory |
| 4 | Primary culture EnSCs | Treated with E2 + MPA for 12 days | RT-qPCR | 50 | Mid-secretory |
| 5 | Primary culture EnSCs | Treated with E2 + MPA for 12 days | RT-qPCR | 44 | Late secretory |
| 6 | Primary culture EnSCs | Treated with E2 + MPA for 12 days | RT-qPCR | 49 | Proliferative |
| Gene Symbol | Definition | Primer Name | Sequence (5′-3′) |
|---|---|---|---|
| HPRT1 | Hypoxanthine Phosphoribosyltransferase 1 | 895F | CTAGTTCTGTGGCCATCTGCTTAG |
| 1034R | GGGAACTGATAGTCTATAGGCTCATAGTG | ||
| PRL | Prolactin | 374F | ATTCGATAAACGGTATACCCATGGC |
| 623R | TTGCTCCTCAATCTCTACAGCTTTG | ||
| IGFBP1 | Insulin-like Growth Factor Binding Protein 1 | 636F | CTATGATGGCTCGAAGGCTC |
| 791R | TTCTTGTTGCAGTTTGGCAG | ||
| HAND2 | Heart and Neural Crest Derivatives expressed 2 | 1479F | AGAGGAAGAAGGAGCTGAACGA |
| 1552R | CGTCCGGCCTTTGGTTTT | ||
| IL15 | Interleukin 15 | 165F | GTTCACCCCAGTTGCAAAGT |
| 351R | CCTCCAGTTCCTCACATTC | ||
| IL1B | Interleukin 1 beta | 162F | AGCTGATGGCCCTAAACAGATG |
| 305R | TTGTCCATGGCCACAACAAC | ||
| IL23A | Interleukin23, alpha subunit p19 | 71F | ATCAGGCTCAAAGCAAGTGG |
| 196R | AGCAACAGCAGCATTACAGC | ||
| IL17A | Interleukin 17A | 1685F | TCTCTTCCTCAAGCAACACTCC |
| 1777R | AAAGTTCGTTCTGCCCCATC | ||
| IL17B | Interleukin 17B | 594F | GCACCTGCATCTTCTGAATCAC |
| 667R | ACAAAGGTGCAAGGAGGATG | ||
| IL17C | Interleukin 17C | 883F | TGCAGAAAAGGTGTCACACG |
| 1012R | AAACAGGGGTACTTCCAAGGAG | ||
| IL17D | Interleukin 17D | 1791F | TGGAACGTGACATCTTTGCC |
| 1925R | AAGCCTCCAGATTGATCTCTGC | ||
| IL17E (IL25) | Interleukin 17E | 736F | AGGCTGTACCGTGTTTCCTTAG |
| 862R | CCTTCATGGCAAGTGGTTGTAC | ||
| IL17F | Interleukin 17F | 259F | ATGAAAACCAGCGCGTTTCC |
| 398R | ATTGATGCAGCCCAAGTTCC | ||
| IL17RA | Interleukin 17 Receptor A | 793F | TGACCAGTTTTCCGCACATG |
| 923R | ACAGCACCCTTTAAGGTTGC | ||
| IL17RC | Interleukin 17 Receptor C | 877F | TGCAGTTTGGTCAGTCTGTG |
| 1000R | TGCTGTGTGTGGTTGAGTTC | ||
| IL22RA1 | Interleukin 22 Receptor Subunit Alpha 1 | 652F | TGGCACCATCATGATTTGCG |
| 780R | AAGCCCATGGAGAACAGGAAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tanaka, S.; Sawachika, M.; Yoshida, N.; Futani, K.; Murata, H.; Okada, H. IL17A Suppresses IGFBP1 in Human Endometrial Stromal Cells. Reprod. Med. 2024, 5, 43-56. https://doi.org/10.3390/reprodmed5020006
Tanaka S, Sawachika M, Yoshida N, Futani K, Murata H, Okada H. IL17A Suppresses IGFBP1 in Human Endometrial Stromal Cells. Reproductive Medicine. 2024; 5(2):43-56. https://doi.org/10.3390/reprodmed5020006
Chicago/Turabian StyleTanaka, Susumu, Misa Sawachika, Namika Yoshida, Kensuke Futani, Hiromi Murata, and Hidetaka Okada. 2024. "IL17A Suppresses IGFBP1 in Human Endometrial Stromal Cells" Reproductive Medicine 5, no. 2: 43-56. https://doi.org/10.3390/reprodmed5020006
APA StyleTanaka, S., Sawachika, M., Yoshida, N., Futani, K., Murata, H., & Okada, H. (2024). IL17A Suppresses IGFBP1 in Human Endometrial Stromal Cells. Reproductive Medicine, 5(2), 43-56. https://doi.org/10.3390/reprodmed5020006

