Indoor Air Contamination by Yeasts in Healthcare Facilities: Risks of Invasive Fungal Infection
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Design
2.2. Indoor Air Sampling
2.3. Isolation and Conservation of Yeasts
2.4. Molecular Identification, Comparison of Sequences and Phylogenetic Analyses
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Blot, S.; Ruppé, E.; Harbarth, S.; Asehnoune, K.; Poulakou, G.; Luyt, C.E.; Rello, E.; Klompas, M.; Depuydt, P.; Eckmann, C.; et al. Healthcare-associated infections in adult intensive care unit patients: Changes in epidemiology, diagnosis, prevention and contributions of new technologies. Intensive Crit. Care Nurs. 2022, 70, 103227. [Google Scholar] [CrossRef] [Scilit]
- Cruz-López, F.; Martínez-Meléndez, A.; Garza-González, E. How Does Hospital Microbiota Contribute to Healthcare-Associated Infections? Microorganisms 2023, 11, 192. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Suleyman, G.; Alangaden, G.J. Nosocomial Fungal Infections. Infect. Dis. Clin. N. Am. 2016, 30, 1023–1052. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Breitkopf, R.; Treml, B.; Simmet, K.; Bukumirić, Z.; Fodor, M.; Senoner, T.; Rajsic, S. Incidence of Invasive Fungal Infections in Liver Transplant Recipients under Targeted Echinocandin Prophylaxis. J. Clin. Med. 2023, 12, 1520. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Presente, S.; Bonnal, C.; Normand, A.C.; Gaudonnet, Y.; Fekkar, A.; Timsit, J.F.; Kernéis, S. Hospital Clonal Outbreak of Fluconazole-Resistant Candida Parapsilosis Harboring the Y132F ERG11p Substitution in a French Intensive Care Unit. Antimicrob. Agents Chemother. 2023, 16, e0113022. [Google Scholar] [CrossRef] [Scilit]
- Singhal, T.; Shah, S.; Thakkar, P.; Ladi, S. Candida auris as the Predominant Species Causing Invasive Candidiasis in Neonates and Children. Indian J. Pediatr. 2023, 90, 946. [Google Scholar] [CrossRef] [Scilit]
- da Silva, C.M.; de Carvalho, A.M.R.; Macêdo, D.P.C.; Jucá, M.B.; Amorim, R.D.J.M.; Neves, R.P. Candidemia in Brazilian neonatal intensive care units: Risk factors, epidemiology, and antifungal resistance. Braz. J. Microbiol. 2023, 54, 817–825. [Google Scholar] [CrossRef] [Scilit]
- Ibrahim, F.; Samsudin, E.Z.; Ishak, A.R.; Sathasivam, J. Hospital indoor air quality and its relationships with building design, building operation, and occupant-related factors: A mini-review. Front. Public Health 2022, 10, 1067764. [Google Scholar] [CrossRef] [Scilit]
- Lampropoulos, A.; Kapoor, N.R.; Kumar, A.; Meena, C.S.; Kumar, A.; Alam, T.; Balam, N.B.; Ghosh, A. A Systematic Review on Indoor Environmental Quality in Naturally Ventilated School Classrooms: A Way Forward. Adv. Civ. Eng. 2021, 2021, 8851685. [Google Scholar]
- Monteiro, A.; Cardoso, J.; Guerra, N.; Ribeiro, E.; Viegas, C.; Cabo Verde, S.; Sousa-Uva, A. Exposure and Health Effects of Bacteria in Healthcare Units: An Overview. Appl. Sci. 2022, 12, 1958. [Google Scholar] [CrossRef] [Scilit]
- Al-Bader, S.M.; Zenfenkey, Z. A Scoping Review on Airborne Fungi in Iraq (1995–2022) and Analysis of Fungal Communities. IOP Conf. Ser. Earth Environ. Sci. 2023, 1215, 012063. [Google Scholar] [CrossRef] [Scilit]
- Tang, J.W.; Marr, L.C.; Tellier, R.; Dancer, S.J. Airborne transmission of respiratory viruses including severe acute respiratory syndrome coronavirus 2. Curr. Opin. Pulm. Med. 2023, 29, 191–196. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nascimento, J.P.M.; Queijeiro-López, A.M.; Araújo, M.A.; Araujo, L.A.; Silva-Filho, E.A. Airborne Fungi in Indoor Hospital Environments. Int. J. Curr. Microbiol. App. Sci. 2019, 5, 627–632. [Google Scholar] [CrossRef] [Scilit]
- Belizario, J.A.; Lopes, L.G.; Pires, R.H. Fungi in the indoor air of critical hospital areas: A review. Aerobiologia 2021, 37, 379–394. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kayta, G.; Manilal, A.; Tadesse, D.; Siraj, M. Indoor air microbial load, antibiotic susceptibility profiles of bacteria, and associated factors in different wards of Arba Minch General Hospital, southern Ethiopia. PLoS ONE 2022, 17, e0271022. [Google Scholar] [CrossRef] [Scilit]
- Brown, C.S.; Guy, R. National Public Health Response to Candida auris in England. J. Fungi 2019, 5, 93. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kenters, N.; Kiernan, M.; Chowdhary, A.; Denning, D.W.; Pemán, J.; Saris, K.; Schelenz, S.; Tartari, E.; Widmer, A.; Meis, J.F.; et al. Control of Candida auris in healthcare institutions: Outcome of an International Society for Antimicrobial Chemotherapy expert meeting. Int. J. Antimicrob. Agents 2019, 54, 400–406. [Google Scholar] [CrossRef] [Scilit]
- Alghamdi, W.; Neamatallah, A.A.; Alshamrani, M.M.; Al Mehmadi, F.; El-Saed, A. Distribution and the trend of airborne particles and bio-aerosol concentration in pediatric intensive care units with different ventilation setting at two hospitals in Riyadh, Saudi Arabia. J. Infect. Public Health 2023, 16, 588–595. [Google Scholar] [CrossRef] [Scilit]
- Górzyńska, A.; Grzech, A.; Mierzwiak, P.; Ussowicz, M.; Biernat, M.; Nawrot, U. Quantitative and Qualitative Airborne Mycobiota Surveillance in High-Risk Hospital Environment. Microorganisms 2023, 11, 1031. [Google Scholar] [CrossRef] [Scilit]
- Wijayawardene, N.N.; Bahram, M.; Sánchez-Castro, I.; Dai, D.-Q.; Ariyawansa, K.G.S.U.; Jayalal, U.; Suwannarach, N.; Tedersoo, L. Current Insight into Culture-Dependent and Culture-Independent Methods in Discovering Ascomycetous Taxa. Fungi 2021, 7, 703. [Google Scholar] [CrossRef] [Scilit]
- Habibi, N.; Uddin, S.; Behbehani, M.; Al Salameen, F.; Razzack, N.A.; Zakir, F.; Shajan, A.; Alam, F. Bacterial and fungal communities in indoor aerosols from two Kuwaiti hospitals. Front. Microbiol. 2022, 13, 955913. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Leung, M.H.Y.; Tong, X.; Lee, P.K.H. Indoor microbiome and airborne pathogens. Compr. Biotechnol. 2019, 6, 96–106. [Google Scholar]
- Carrazana, E.; Ruiz-Gil, T.; Fujiyoshi, S.; Tanaka, D.; Noda, J.; Maruyama, F.; Jorquera, M.A. Potential airborne human pathogens: A relevant inhabitant in built environments but not considered in indoor air quality standards. Sci. Total Environ. 2023, 901, 165879. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Agência Nacional de Vigilância Sanitária. Resolução-RE Nº 09. Ministério da Saúde do Brasil. 2003; pp. 1–14. Available online: http://antigo.anvisa.gov.br/documents/10181/2718376/RE_09_2003_.pdf/8ccafc91-1437-4695-8e3a-2a97deca4e10 (accessed on 25 May 2023).
- Silva-Filho, E.A.; Santos, S.K.B.; Resende, A.M.; Morais, J.O.F.; Morais, M.A.; Simões, D.A. Yeast population dynamics of industrial fuel-ethanol fermentation process assessed by PCR-fingerprinting. Antonie Van Leeuwenhoek 2005, 88, 13–23. [Google Scholar] [CrossRef] [Scilit]
- Hsu, M.; Chen, K.; Lo, H.; Chen, Y.; Liao, M.; Lin, Y.; Li, S. Species identification of medically important fungi by use of real-time LightCycler PCR. J. Med. Microbiol. 2003, 52, 1071–1076. [Google Scholar] [CrossRef] [Scilit]
- Hesham, A.E.; Wambui, V.; Ogola, J.O.H.; Maina, J.M. Phylogenetic analysis of isolated biofuel yeasts based on 5.8S-ITS rDNA and D1/D2 26S rDNA sequences. J. Genet. Eng. Biotechnol. 2014, 12, 37–43. [Google Scholar] [CrossRef] [Scilit]
- Staden, R.; Judge, D.P.; Bonfield, J.K. Analyzing Sequences Using the Staden Package and EMBOSS. In Introduction to Bioinformatics; Krawetz, S.A., Womble, D.D., Eds.; Humana Press: Totowa, NJ, USA, 2003; pp. 393–410. [Google Scholar]
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
- Muhire, B.; Martin, D.P.; Brown, J.K.; Navas-Castillo, J.; Moriones, E.; Zerbini, F.M.; Rivera-Bustamante, R.; Malathi, V.G.; Briddon, R.W.; Varsani, A. A genome-wide pairwise-identity-based proposal for the classification of viruses in the genus Mastrevirus (family Geminiviridae). Arch. Virol. 2013, 158, 1411–1424. [Google Scholar] [CrossRef] [Scilit]
- Tamura, K.; Peterson, D.; Peterson, N.; Stecher, G.; Nei, M.; Kumar, S. MEGA5: Molecular Evolutionary Genetics Analysis Using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Mol. Biol. Evol. 2018, 183, 591–596. [Google Scholar] [CrossRef] [Scilit]
- Veysi, R.; Heibati, B.; Jahangiri, M.; Kumar, P.; Latif, M.T.; Karimi, A. Indoor air quality-induced respiratory symptoms of a hospital staff in Iran. Environ. Monit. Assess. 2019, 191, 1–8. [Google Scholar] [CrossRef] [Scilit]
- Guo, K.; Qian, H.; Ye, J.; Sun, F.; Zhuge, Y.; Wang, S.; Liu, C.; Cao, G.; Zheng, X. Assessment of airborne bacteria and fungi in different-type buildings in Nanjing, a hot summer and cold winter moist Chinese city. Build. Environ. 2021, 205, 108258. [Google Scholar] [CrossRef] [Scilit]
- Adams, R.I.; Bhangar, S.; Pasut, W.; Arens, E.A.; Taylor, J.W.; Lindow, S.E.; Nazaroff, W.W.; Bruns, T.D. Chamber bioaerosol study: Outdoor air and human occupants as sources of indoor airborne microbes. PLoS ONE 2015, 10, e0128022. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zemouri, C.; Volgenant, C.M.C.; Buijs, M.J.; Crielaard, W.; Rosema, N.A.M.; Brandt, B.W.; Laheij, A.M.G.A.; De Soet, J.J. Dental aerosols: Microbial composition and spatial distribution. J. Oral Microbiol. 2020, 12, 1762040. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mirhoseini, S.H.; Koolivand, A.; Bayani, M.; Sarlak, H.; Moradzadeh, R.; Ghamari, F.; Sheykhan, A. Quantitative and qualitative assessment of microbial aerosols in different indoor environments of a dental school clinic. Aerobiologia 2021, 37, 217–224. [Google Scholar] [CrossRef] [Scilit]
- Yamaguchi, M.U.; Rampazzo, R.D.C.P.; Yamada-Ogatta, S.F.; Nakamura, C.V.; Ueda-Nakamura, T.; Dias Filho, B.P.A. Yeasts and filamentous fungi in bottled mineral water and tap water from municipal supplies. Braz. Arch. Biol. Technol. 2007, 50, 1–9. [Google Scholar] [CrossRef] [Scilit]
- Tischner, Z.; Sebők, R.; Kredics, L.; Allaga, H.; Vargha, M.; Sebestyén, Á.; Dobolyi, C.; Kriszt, B.; Magyar, D. Mycological Investigation of Bottled Water Dispensers in Healthcare Facilities. Pathogens 2021, 10, 871. [Google Scholar] [CrossRef] [Scilit]
- Venceslau, E.M.; Martins, R.P.P.; Oliveira, I.D. Frequency of airborne fungus in critical areas at hospital unit of Aracaju, Sergipe, Brazil. RBAC 2012, 44, 26–30. [Google Scholar]
- Pedrosa, K.P.; do Nascimento, J.P.M.; Araújo, M.A.; Silva, M.S.S.; Santos, D.E.; Silva-Filho, E.A. Airborne Fungi in a Neonatal Intensive Care Unit and Operating Theater in a University Hospital. Int. J. Innov. Educ. Res. 2022, 10, 41–55. [Google Scholar] [CrossRef] [Scilit]
- Yamin, D.; Husin, A.; Harun, A. Distribution of candidemia in Malaysian tertiary care hospital revealed predominance of Candida parapsilosis. Trop. Biomed. 2020, 37, 903–910. [Google Scholar]
- Doi, A.M.; Pignatari, A.C.C.; Edmond, M.B.; Marra, A.R.; Camargo, L.F.A.; Siqueira, R.A.; Mota, V.P.; Colombo, A.L. Epidemiology and microbiologic characterization of nosocomial candidemia from a Brazilian national surveillance program. PLoS ONE 2016, 11, e0146909. [Google Scholar] [CrossRef] [Scilit]
- Souza, A.K.P.; Nascimento, J.P.M.; Araújo, M.A.S.; Pedrosa, K.P.S.; Tenorio, B.M.; Pires, L.L.S.; Lima, G.B.C.; Barboza, R.I.S.; Silva-Filho, E.A. Airborne Fungi in Neonatal Intensive Care Unit of a Public Hospital in Brazil. Int. J. Curr. Microbiol. App. Sci. 2019, 8, 1210–1219. [Google Scholar] [CrossRef] [Scilit]
- Sudharsanam, S.; Swaminathan, S.; Ramalingam, A.; Thangavel, G.; Annamalai, R.; Steinberg, R.; Balakrishnan, K.; Srikanth, P. Characterization of indoor bioaerosols from a hospital ward in a tropical setting. Afr. Health Sci. 2012, 12, 217–225. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Diba, K.; Rhaimirad, M.; Makhdoomi, K.; Khorshidvand, Z.A. Identification of Candida species isolated from hospital acquired infections cases and hospital indoor environments. Afr. J. Microbiol. Res. 2012, 6, 4164–4168. [Google Scholar] [CrossRef] [Scilit]
- Kumar, M.R.; Prasad, S.R.; Urhekar, A.D. Incidence of Candida in Air from the Hospital Environment. Int. J. Adv. Microbiol. Health Res. 2017, 1, 29–33. [Google Scholar]
- de Melo, C.C.; de Sousa, B.R.; da Costa, G.L.; Oliveira, M.M.E.; de Lima-Neto, R.G. Colonized patients by Candida auris: Third and largest outbreak in Brazil and impact of biofilm formation. Front. Cell. Infect. Microbiol. 2023, 13, 1033707. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cordeiro, R.A.; Brilhante, R.S.N.; Pantoja, L.D.M.; Moreira-Filho, R.E.; Vieira, P.R.N.; Rocha, M.F.G.; Monteiro, A.J.; Sidrim, J.J.C. Isolation of pathogenic yeasts in the air from hospital environments in the city of Fortaleza, northeast Brazil. Braz. J. Infect. Dis. 2010, 14, 30–34. [Google Scholar] [CrossRef] [Scilit]
- Sanna, C.; Marras, L.; Desogus, A.; Marras, B.; Montero, N.; Bertolino, G.; Schintu, M.; Coroneo, V. Evaluation of Rhodotorula spp. contamination in hospital environments. World J. Pediatr. Congenit. Heart Surg. 2021, 193, 152. [Google Scholar] [CrossRef] [Scilit]
- Nogueira, N.; Júnior, E. Tinea Nigra na cidade de Campos dos Goytacazes, Rio de Janeiro. Rev. Cienfica FMC 2012, 7, 20–24. [Google Scholar] [CrossRef] [Scilit]
- Tap, R.M.; Ramli, N.Y.; Sabaratnam, P.; Hashim, R.; Bakri, A.R.A.; Bee, L.B.; Ginsapu, S.J.; Ahmad, R.; Razak, M.F.A.; Ahmad, N. First Two Cases of Fungal Infections Associated with Multi-drug Resistant Yeast, Fereydounia khargensis. Mycopathologia 2016, 181, 531–537. [Google Scholar] [CrossRef] [Scilit]
- Hunninghake, J.; Schuety, C.; Calvano, T.; Ferraro, D. Disseminated Trichosporon infection. Crit Care Med. 2019, 47, 270. [Google Scholar] [CrossRef] [Scilit]
- Rostami, N.; Alidadi, H.; Zarrinfar, H.; Salehi, P. Assessment of indoor and outdoor airborne fungi in an Educational, Research and Treatment Center. Ital. J. Med. 2017, 11, 52–56. [Google Scholar] [CrossRef] [Scilit]
- Bezerra, G.F.D.B.; Gomes, S.M.; Silva, M.A.C.N.D.; Santos, R.M.D.; Muniz-Filho, W.E.; Viana, G.M.D.C.; Nascimento, M.D.D.S.B. Diversity and dynamics of airborne fungi in São Luis, State of Maranhão, Brazil. Rev. Soc. Bras. Med. Trop. 2014, 47, 69–73. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gonçalves, F.L.T.; Bauer, H.; Cardoso, M.R.A.; Pukinskas, S.; Matos, D.; Melhem, M.; Puxbaum, H. Indoor and outdoor atmospheric fungal spores in the São Paulo metropolitan area (Brazil): Species and numeric concentrations. Int. J. Biometeorol. 2010, 54, 347–355. [Google Scholar] [CrossRef] [Scilit] [PubMed]



| Species | Sequences (5–3) * | Size (pb) |
|---|---|---|
| Candida krusei | CKRU1:GCATCGATGAAGAACGCAGC CKRU2:AAAAGTCTAGTTCGCTCGGGCC | 258 |
| Candida albicans | CALB1:TTTATCAACTTGTCACACCAGA CALB2:ATCCCGCCTTACCACTACCG | 273 |
| Candida parapsilosis | CPA1:GCCAGAGATTAAACTCAACCAA CPA2:CCTATCCATTAGTTTATACTCCGC | 300 |
| Candida tropicalis | CTR1:CAATCCTACCGCCAGAGGTTAT CTR2:TGGCCACTAGCAAAATAAGCGT | 372 |
| Candida glabrata | CGL1:TTATCACACGACTCGACACT CGL2:CCCACATACTGATATGGCCTACAA | 423 |
| Environment | Collection Site | Sample |
|---|---|---|
| Doctor’s office | AYC02 AYC03 | |
| Serology | AYC07 AYC08 | |
| Medical Clinic | Biochemistry laboratory | AYC09 |
| Collection room | AYC10 | |
| Quality control | AYC54 AYC55 | |
| Reception | AYC56 | |
| Operating room | AYH01 AYH32 AYH33 AYH49 AYH50 | |
| Examination room | AYH04 AYH05 AYH21 AYH22 AYH23 | |
| Post-anesthetic care unit | AYH06 | |
| Urgency and Emergency | AYH11 | |
| Reception | AYH12 AYH13 AYH14 AYH28 | |
| Waiting room | AYH15 AYH16 AYH17 AYH18 AYH46 | |
| Ultrasound | AYH19 | |
| ICU | AYH20 | |
| Apartment | AYH24 | |
| Observation room | AYH25 | |
| Operating room reception | AYH26 AYH27 | |
| Hospital | Diagnostic Center | AYH29 AYH30 |
| Hemodialysis | AYH34 AYH35 AYH36 AYH37 | |
| Chemotherapy | AYH38 | |
| ICU | AYH20 | |
| Apartment | AYH24 | |
| Observation room | AYH25 | |
| Operating room reception | AYH26 AYH27 | |
| Diagnostic Center | AYH29 AYH30 | |
| Hemodialysis | AYH34 AYH35 AYH36 AYH37 | |
| Chemotherapy | AYH38 | |
| Doctor’s office | AYH39 AYH40 AYH43 AYH44 AYH45 AYH52 | |
| Social assistance | AYH41 | |
| Application room | AYH42 AYH53 | |
| Clinical screening | AYH47 | |
| Occupational therapy | AYH48 | |
| Sterilization room | AYH51 | |
| Outside area | Outdoor air | AYO01 AYO02 AYO03 AYO04 AYO05 AYO06 AYO07 |
| Sample | Environment/Collection Site | Species | Accession Number |
|---|---|---|---|
| AYH79 | Hospital/Operating room | Candida glabrata | GenBank: MN966855 |
| AYH57 | Hospital/Reception | Candida orthopsilosis | GenBank: MT001254 |
| AYC63 | Medical Clinic/Doctor’s office | Candida parapsilosis | GenBank: MT001241 |
| AYH67 | Hospital/Hemodialysis | Candida parapsilosis | GenBank: MT001243 |
| AYH72 | Hospital/Observation room | Candida parapsilosis | GenBank: MT001244 |
| AYH74 | Hospital/Observation room | Candida parapsilosis | GenBank: MT001245 |
| AYH80 | Hospital/Post-anesthesia care unit | Candida parapsilosis | GenBank: MT001246 |
| AYH87 | Hospital/Pharmacy | Candida parapsilosis | GenBank: MT001248 |
| AYH88 | Hospital/Examination room | Candida parapsilosis | GenBank: MT001250 |
| AYH89 | Hospital/Social assistance | Candida parapsilosis | GenBank: MT001252 |
| AYH94 | Hospital/Observation room | Candida parapsilosis | GenBank: MT001255 |
| AYH95 | Hospital/Doctor’s office | Candida parapsilosis | GenBank: MT001256 |
| AYH98 | Hospital/Application room | Candida parapsilosis | GenBank: MT001257 |
| AYH99 | Hospital/Telephone exchange | Candida parapsilosis | GenBank: MT001261 |
| AYO09 | Outdoor air | Candida parapsilosis | GenBank: MT001265 |
| AYO10 | Outdoor air | Candida parapsilosis | GenBank: MT001266 |
| AYO08 | Outdoor air | Cystobasidium slooffiae | GenBank: MT001284 |
| AYC58 | Medical Clinic/Doctor’s office | Fereydounia khargensis | GenBank: MT001262 |
| AYH60 | Hospital/Operating room | Hortaea werneckii | GenBank: MT001237 |
| AYH61 | Hospital/Operating room | Hortaea werneckii | GenBank: MT001242 |
| AYC70 | Medical Clinic/Fractionation room | Hortaea werneckii | GenBank: MT001253 |
| AYH73 | Hospital/Observation room | Hortaea werneckii | GenBank: MT001258 |
| AYH100 | Hospital/Coordination | Hortaea werneckii | GenBank: MT001259 |
| AYH101 | Hospital/Information technology | Jaminaea lanaiensis | GenBank: MT001264 |
| AYC64 | Medical Clinic/Doctor’s office | Moniliella sp. | GenBank: MT001260 |
| AYC65 | Medical Clinic/Doctor’s office | Moniliella sp. | GenBank: MT001263 |
| AYC69 | Medical Clinic/Storage room | Papiliotrema flavescens | GenBank: MT001249 |
| AYH76 | Hospital/Neonatal ICU | Pseudozyma hubeiensis | GenBank: MT001247 |
| AYH97 | Hospital/Application room | Pseudozyma hubeiensis | GenBank: MT001267 |
| AYC68 | Medical Clinic/Reception | Pseudozyma hubeiensis | GenBank: MT001240 |
| AYH78 | Hospital/Hemodialysis | Pseudozyma siamensis | GenBank: MT001251 |
| AYC59 | Medical Clinic/Doctor’s office | Rhodotorula mucilaginosa | GenBank: MT001268 |
| AYC62 | Medical Clinic/Operating room | Rhodotorula mucilaginosa | GenBank: MT001269 |
| AYH66 | Hospital/Procedures room | Rhodotorula mucilaginosa | GenBank: MT001270 |
| AYC71 | Medical Clinic/Microbiology laboratory | Rhodotorula mucilaginosa | GenBank: MT001271 |
| AYH75 | Hospital/Urgency/Emergency | Rhodotorula mucilaginosa | GenBank: MT001272 |
| AYH77 | Hospital/Apartment | Rhodotorula mucilaginosa | GenBank: MT001273 |
| AYH83 | Hospital/Hemodialysis | Rhodotorula mucilaginosa | GenBank: MT001274 |
| AYH84 | Hospital/Observation room | Rhodotorula mucilaginosa | GenBank: MT001275 |
| AYH85 | Hospital/Waiting room | Rhodotorula mucilaginosa | GenBank: MT001276 |
| AYH86 | Hospital/Nurses station | Rhodotorula mucilaginosa | GenBank: MT001277 |
| AYH90 | Hospital/Macroscopy | Rhodotorula mucilaginosa | GenBank: MT001278 |
| AYH91 | Hospital/Macroscopy | Rhodotorula mucilaginosa | GenBank: MT001279 |
| AYH92 | Hospital/Clinical screening | Rhodotorula mucilaginosa | GenBank: MT001280 |
| AYH93 | Hospital/Occupational therapy | Rhodotorula mucilaginosa | GenBank: MT001257 |
| AYH96 | Hospital/Administrative | Rhodotorula mucilaginosa | GenBank: MT001282 |
| AYH102 | Hospital/Observation room | Rhodotorula mucilaginosa | GenBank: MT001283 |
| AYH82 | Hospital/Audit | Torulaspora delbrueckii | GenBank: MT001238 |
| AYH81 | Hospital/Storage room | Trichosporon mucoides | GenBank: MT001239 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
do Nascimento, J.P.M.; dos Santos, R.; dos Santos Silva, M.S.; de Araújo, M.A.; Anhezini, L.; dos Santos, D.É.; da Silva-Filho, E.A. Indoor Air Contamination by Yeasts in Healthcare Facilities: Risks of Invasive Fungal Infection. Aerobiology 2023, 1, 3-18. https://doi.org/10.3390/aerobiology1010002
do Nascimento JPM, dos Santos R, dos Santos Silva MS, de Araújo MA, Anhezini L, dos Santos DÉ, da Silva-Filho EA. Indoor Air Contamination by Yeasts in Healthcare Facilities: Risks of Invasive Fungal Infection. Aerobiology. 2023; 1(1):3-18. https://doi.org/10.3390/aerobiology1010002
Chicago/Turabian Styledo Nascimento, Jean Phellipe Marques, Raniele dos Santos, Mirna Samile dos Santos Silva, Mykaella Andrade de Araújo, Lucas Anhezini, Daniela Évelin dos Santos, and Eurípedes Alves da Silva-Filho. 2023. "Indoor Air Contamination by Yeasts in Healthcare Facilities: Risks of Invasive Fungal Infection" Aerobiology 1, no. 1: 3-18. https://doi.org/10.3390/aerobiology1010002
APA Styledo Nascimento, J. P. M., dos Santos, R., dos Santos Silva, M. S., de Araújo, M. A., Anhezini, L., dos Santos, D. É., & da Silva-Filho, E. A. (2023). Indoor Air Contamination by Yeasts in Healthcare Facilities: Risks of Invasive Fungal Infection. Aerobiology, 1(1), 3-18. https://doi.org/10.3390/aerobiology1010002

