An Integrated Photonic Biosensing Platform for Pathogen Detection in Aquaculture
Abstract
:1. Introduction
- Miniaturization of the hybrid biosensor PIC;
- Development of wafer-level processes for hybrid integration of the light source, detector, and temperature sensor on the PIC;
- Development of wafer-level processes for material-selective chemical and biological surface modification of the PIC;
- Scalable processes for integration of the PIC in a microfluidic cartridge;
- Successful biosensing experiments, detecting pathogen-specific DNA using hybrid PICs.
2. Materials and Methods
2.1. Materials
2.2. TriPleXTM PIC
2.3. Hybrid Integration
- Single-mode 850 nm polarization stable VCSEL (Trumpf Photonic Components GmbH, Ulm, Germany);
- 1 × 4 arrays of GaAs PIN PDs (Trumpf Photonic Components GmbH, Ulm, Germany);
- Negative Temperature Coefficient (NTC) thermistor (VH05, Mitsubishi Materials Corporation, Tokyo, Japan).
2.4. PIC Biofunctionalization
2.5. Microfluidic Cartridge
2.5.1. Cartridge Coating
2.5.2. PCB Assembly
2.5.3. Lid Assembly
2.5.4. Cartridge Testing
2.5.5. Bulk Refractive Index Change Testing
2.6. Readout Instrument
2.7. Pathogen Biomarker Discovery
2.8. Pathogen DNA Sample Preparation
2.9. qPCR Assay
2.10. Pathogen DNA Detection with Hybrid PIC System
3. Results and Discussion
3.1. Design and Development
3.1.1. Hybrid PIC Design
3.1.2. Integration of Components on Hybrid PIC
3.1.3. PIC Surface Modification
3.1.4. Microfluidic Cartridge
- Liquid interface—connects to the liquid actuation ports of the instrument, allowing driving fluid to be pumped into the cartridge.
- Blister seats with pre-filled blisters with run buffers and (optional) reagents—connects to the blister squeezers of the instrument. For prototyping, the cartridge lid was fabricated by milling, and the blister seats were 3D printed. For volume production, the lid can be injection molded with the blister seats integrated in the injection molded part, thus reducing the number of parts and assembly steps.
- Pierceable septum—connects to the sample application port of the instrument, through which the user injects the sample using a syringe. After removing the syringe needle, the septum seals the inlet, allowing the sample to be transported to the PIC by the driving fluid. To ensure the proper functioning of the pierceable septum, it was tested on its tightness after being punctured with the syringe needle. After being pierced once, the taped septum can withstand more than 1000 mbar overpressure in the channels.
- Intermediate reservoirs—meandering channels used for temporarily storing and pre-heating the sample (injected by the user) and buffer solutions (from the blisters) before being transported over the PIC by the driving fluid.
- Waste reservoir and liquid stop membrane—after moving liquids over the PIC, all waste is stored on the cartridge. To accommodate for the required volume, this meandering channel has a larger cross section than the other channels. A gas-permeable liquid stop membrane prevents spillage of liquids into the instrument in the case that the waste reservoir is completely filled.
- On-board heater and quick heat zone—using a resistive heater integrated on the PCB, all liquids can be brought to the required temperature before being transported over the PIC.
- Liquid level check—to compensate for differences in sample and blister (filling and recovery) volumes, all liquids are first transported to the end of their respective intermediate reservoir to reach a well-defined ‘starting position’ for being transported over the PIC. When the flow front reaches a predefined position, this is detected by a flow front sensor in the instrument, and the pumping is stopped. When all liquids have reached their starting position, the first buffer is pumped over the PIC, and data acquisition is started.
- Degassing membrane—because the aMZI biosensors detect changes in the refractive index, the presence of air bubbles on the PIC is detrimental for sensor performance and has to be avoided. To prevent gas bubbles from reaching the PIC, the liquids pass a PTFE (polytetrafluoroethylene) degassing membrane just before reaching the PIC, allowing gas to escape. Tests showed that the glued membrane withstands more than 1000 mbar overpressure without losing its function.
- Electrical interface—the 4 × 4 array of contact pads connects with the pogo pins of the spring-loaded electrical connector unit of the instrument. The contacts are used for driving the VCSEL and PIC backside heater and for reading out the photodiodes and NTC thermistor. Two additional contact pads are positioned nearby for driving the on-board PCB heater.
- Hybrid PIC—Figure 2g shows the PIC cavity in the PCB after deposition of electrically conductive glue on the contact pads for the PIC backside heater. Figure 2h shows the situation after placement of the PIC and dispensing and curing of the encapsulation glue. The PIC integration process was optimized such that the PIC surface was flush with the PCB surface, with a height difference between 3 and 10 μm as shown in Figure 4. The precise alignment of the top surfaces of the PIC and the PCB allowed leak-tight sealing of the cartridge by double adhesive tape. Pressure tests of the assembly with a flow rate of 100 μL/min reached burst pressures of at least 500 mbar. In the final step of PCB assembly, wire bond connections were made between the contact pads on the PIC and the contact pads on the PCB.
3.1.5. Readout Instrument
3.2. Measurement Results
3.2.1. Measurement of Bulk Refractive Index Change Using the Hybrid PIC System
3.2.2. Pathogen DNA Detection Using qPCR
3.2.3. Pathogen DNA Detection Using the Hybrid PIC System
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bahadir, E.B.; Sezgintürk, M.K. Applications of Commercial Biosensors in Clinical, Food, Environmental, and Biothreat/Biowarfare Analyses. Anal. Biochem. 2015, 478, 107–120. [Google Scholar] [CrossRef] [PubMed]
- United Nations Sustainable Development Goals (SDGs). Available online: https://sdgs.un.org/goals (accessed on 11 June 2024).
- FAO. The State of World Fisheries and Aquaculture 2022. Towards Blue Transformation; FAO: Rome, Italy, 2022. [Google Scholar]
- Cain, K. The Many Challenges of Disease Management in Aquaculture. J. World Aquac. Soc. 2022, 53, 1080–1083. [Google Scholar] [CrossRef]
- Pincinato, R.B.M.; Asche, F.; Bleie, H.; Skrudland, A.; Stormoen, M. Factors Influencing Production Loss in Salmonid Farming. Aquaculture 2021, 532, 736034. [Google Scholar] [CrossRef]
- Grefsrud, E.S.; Andersen, L.B.; Grøsvik, B.E.; Karlsen, O.; Kvamme, B.O.; Hansen, K.P.; Husa, V.; Sandlund, N.; Stien, L.H.; Solberg, M.F. Risikorapport Norsk Fiskeoppdrett 2023—Produksjonsdødelighet hos Oppdrettsfisk og Miljøeffekter av Norsk Fiskeoppdrett; Havforskningsinstituttet: Bergen, Norway, 2023; Volume 6. [Google Scholar]
- Su, X.; Sutarlie, L.; Loh, X.J. Sensors, Biosensors, and Analytical Technologies for Aquaculture Water Quality. Research 2020, 2020, 8272705. [Google Scholar] [CrossRef]
- Khansili, N.; Rattu, G.; Krishna, P.M. Label-Free Optical Biosensors for Food and Biological Sensor Applications. Sens. Actuators B Chem. 2018, 265, 35–49. [Google Scholar] [CrossRef]
- Yoon, J.Y.; Kim, B. Lab-on-a-Chip Pathogen Sensors for Food Safety. Sensors 2012, 12, 10713–10741. [Google Scholar] [CrossRef] [PubMed]
- Estevez, M.C.; Alvarez, M.; Lechuga, L.M. Integrated Optical Devices for Lab-on-a-Chip Biosensing Applications. Laser Photonics Rev. 2012, 6, 463–487. [Google Scholar] [CrossRef]
- Shekhar, S.; Bogaerts, W.; Chrostowski, L.; Bowers, J.E.; Hochberg, M.; Soref, R.; Shastri, B.J. Roadmapping the next Generation of Silicon Photonics. Nat. Commun. 2024, 15, 751. [Google Scholar] [CrossRef]
- Sahm, A.; Fiebig, C.; Spießberger, S.; Schiemangk, M.; Luvsandamdin, E.; Paschke, K.; Erbert, G.; Tränkle, G. Modular Assembly of Diode Lasers in a Compact and Reliable Setup for a Wide Range of Applications. In Proceedings of the 2012 IEEE 62nd Electronic Components and Technology Conference, San Diego, CA, USA, 29 May–1 June 2012; pp. 1852–1857. [Google Scholar]
- Snyder, B.W.; Tegegne, Z.G.; Nijenhuis, N.; Qian, T.; de Felipe, D.; Nellen, S.; Deumer, M.; Gupta, Y.D.; Baier, M.; Globisch, B.; et al. Assembly of Mobile 5G Transceiver Based on Photonic Motherboard. In Optical Interconnects XXII; SPIE: Bellingham, WA, USA, 2022; Volume 12007, p. 120070K. [Google Scholar]
- Theurer, M.; Moehrle, M.; Sigmund, A.; Velthaus, K.-O.; Oldenbeuving, R.M.; Wevers, L.; Postma, F.M.; Mateman, R.; Schreuder, F.; Geskus, D.; et al. Flip-Chip Integration of InP to SiN Photonic Integrated Circuits. J. Light. Technol. 2020, 38, 2630–2636. [Google Scholar] [CrossRef]
- Chalyan, T.; Guider, R.; Pasquardini, L.; Zanetti, M.; Falke, F.; Schreuder, E.; Heideman, R.G.; Pederzolli, C.; Pavesi, L. Asymmetric Mach-Zehnder Interferometer Based Biosensors for Aflatoxin M1 Detection. Biosensors 2016, 6, 1. [Google Scholar] [CrossRef]
- Chalyan, T.; Pasquardini, L.; Falke, F.H.; Zaneti, M.; Gandolfi, D.; Schreuder, E.; Pederzolli, C.; Heideman, R.G. Biosensors Based on Si3N4 Asymmetric Mach-Zehnder Interferometers. Proc. SPIE 2016, 9899, 9899S. [Google Scholar]
- Besselink, G.; Schütz-Trilling, A.; Veerbeek, J.; Verbruggen, M.; van der Meer, A.; Schonenberg, R.; Dam, H.; Evers, K.; Lindhout, E.; Garritsen, A.; et al. Asymmetric Mach–Zehnder Interferometric Biosensing for Quantitative and Sensitive Multiplex Detection of Anti-SARS-CoV-2 Antibodies in Human Plasma. Biosensors 2022, 12, 553. [Google Scholar] [CrossRef] [PubMed]
- Chatzipetrou, M.; Gounaridis, L.; Tsekenis, G.; Dimadi, M.; Vestering-Stenger, R.; Schreuder, E.F.; Trilling, A.; Besselink, G.; Scheres, L.; van der Meer, A.; et al. A Miniature Bio-Photonics Companion Diagnostics Platform for Reliable Cancer Treatment Monitoring in Blood Fluids. Sensors 2021, 21, 2230. [Google Scholar] [CrossRef] [PubMed]
- Fernández-Gavela, A.; Herranz, S.; Chocarro, B.; Falke, F.; Schreuder, E.; Leeuwis, H.; Heideman, R.G.; Lechuga, L.M. Full Integration of Photonic Nanoimmunosensors in Portable Platforms for On-Line Monitoring of Ocean Pollutants. Sens. Actuators B Chem. 2019, 297, 126758. [Google Scholar] [CrossRef]
- Heideman, R.; Leinse, A.; Geuzebroek, D.; Schreuder, E.; Falke, F.; Zergioti, I.; Van Der Meer, A.; Schuetz-Trilling, A.; Scheres, L.; Vestering-Stenger, R. Ultra-Sensitive Photonic Integrated Circuit-Based Biosensors for Healthcare Applications. In Integrated Optics: Devices, Materials, and Technologies XXIV; SPIE: Bellingham, WA, USA, 2020; pp. 1–5. [Google Scholar]
- Goodwin, M.J.; Besselink, G.A.J.; Falke, F.; Everhardt, A.S.; Cornelissen, J.J.L.M.; Huskens, J. Highly Sensitive Protein Detection by Asymmetric Mach-Zehnder Interferometry for Biosensing Applications. ACS Appl. Bio Mater. 2020, 3, 4566–4572. [Google Scholar] [CrossRef] [PubMed]
- Park, S.Y.; Han, J.E.; Kwon, H.; Park, S.C.; Kim, J.H. Recent Insights into Aeromonas Salmonicida and Its Bacteriophages in Aquaculture: A Comprehensive Review. J. Microbiol. Biotechnol. 2020, 30, 1443–1457. [Google Scholar] [CrossRef] [PubMed]
- Saticioglu, I.B.; Yardimci, B.; Altun, S.; Duman, M. A Comprehensive Perspective on a Vagococcus Salmoninarum Outbreak in Rainbow Trout Broodstock. Aquaculture 2021, 545, 737224. [Google Scholar] [CrossRef]
- Kumar, G.; Menanteau-Ledouble, S.; Saleh, M.; El-Matbouli, M. Yersinia Ruckeri, the Causative Agent of Enteric Redmouth Disease in Fish. Vet. Res. 2015, 46, 103. [Google Scholar] [CrossRef] [PubMed]
- Wörhoff, K.; Heideman, R.G.; Leinse, A.; Hoekman, M. TriPleX: A Versatile Dielectric Photonic Platform. Adv. Opt. Technol. 2015, 4, 189–207. [Google Scholar] [CrossRef]
- Roeloffzen, C.G.H.; Hoekman, M.; Klein, E.J.; Wevers, L.S.; Timens, R.B.; Marchenko, D.; Geskus, D.; Dekker, R.; Alippi, A.; Grootjans, R.; et al. Low-Loss Si3n4 Triplex Optical Waveguides: Technology and Applications Overview. IEEE J. Sel. Top. Quantum Electron. 2018, 24, 4400321. [Google Scholar] [CrossRef]
- Besselink, G.A.J.; Heideman, R.G.; Schreuder, E.; Wevers, L.S.; Falke, F.; Van den Vlekkert, H.H. Performance of Arrayed Microring Resonator Sensors with the TriPleX Platform. J. Biosens. Bioelectron. 2016, 7, 1000209. [Google Scholar] [CrossRef]
- Knoben, W.; Besselink, G.; Roeven, E.; Zuilhof, H.; Schuetz-Trilling, A.; van der Meer, A.; Scheres, L.; Leeuwis, H.; Falke, F.; Schreuder, F.; et al. Highly Sensitive Integrated Optical Biosensing Platform Based on an Asymmetric Mach-Zehnder Interferometer and Material-Selective (Bio)Functionalization. In Proceedings of the 22nd International Conference on Miniaturized Systems for Chemistry and Life Sciences (MicroTAS 2018), Kaohsiung, Taiwan, 11–15 November 2018; pp. 982–985. [Google Scholar]
- Diehl, F.; Grahlmann, S.; Beier, M.; Hoheisel, J.D. Manufacturing DNA Microarrays of High Spot Homogeneity and Reduced Background Signal. Nucleic Acids Res. 2020, 29, e28. [Google Scholar] [CrossRef] [PubMed]
- Maldonado-Miranda, J.J.; Castillo-Pérez, L.J.; Ponce-Hernández, A.; Carranza-Álvarez, C. Summary of Economic Losses Due to Bacterial Pathogens in Aquaculture Industry. In Bacterial Fish Diseases; Dar, G.H., Bhat, R.A., Qadri, H., Al-Ghamdy, K.M., Hakeem, K.R., Eds.; Academic Press: Cambridge, MA, USA, 2022; pp. 399–417. ISBN 978-0-323-85624-9. [Google Scholar]
- Standish, I.; Leis, E.; Erickson, S.; McCann, R.; Puzach, C.; Katona, R.; Lark, E.; Bailey, J.; Kleman, E.; Buening, J.; et al. Vagococcus Salmoninarum II—QPCR, Tropism and Egg-Associated Transmission. J. Fish Dis. 2020, 43, 317–325. [Google Scholar] [CrossRef] [PubMed]
- Chapela, M.-J.; Ferreira, M.; Varela, C.; Arregui, L.; Garrido-Maestu, A. Development of a Multiplex Real-Time PCR Method for Early Diagnosis of Three Bacterial Diseases in Fish: A Real-Case Study in Trout Aquaculture. Aquaculture 2018, 496, 255–261. [Google Scholar] [CrossRef]
- Chu, S.; Cavaignac, S.; Feutrier, J.; Phipps, B.M.; Kostrzynska, M.; Kay, W.W.; Trust, T.J. Structure of the Tetragonal Surface Virulence Array Protein and Gene of Aeromonas Salmonicida. J. Biol. Chem. 1991, 266, 15258–15265. [Google Scholar] [CrossRef] [PubMed]
- Gulla, S.; Lund, V.; Kristoffersen, A.B.; Sørum, H.; Colquhoun, D.J. VapA (A-Layer) Typing Differentiates Aeromonas Salmonicida Subspecies and Identifies a Number of Previously Undescribed Subtypes. J. Fish Dis. 2016, 39, 329–342. [Google Scholar] [CrossRef] [PubMed]
- Walsh, P.S.; Metzger, D.A.; Higuchi, R. Chelex 100 as a Medium for Simple Extraction of DNA for PCR-Based Typing from Forensic Material. Biotechniques 2013, 54, 134–139. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.-T.; Iseli, C.; Venditti, C.A.; Old, L.J.; Simpson, A.J.G.; Jongeneel, C.V. Identification of a New Cancer/Testis Gene Family, CT47, among Expressed Multicopy Genes on the Human X Chromosome. Genes. Chromosomes Cancer 2006, 45, 392–400. [Google Scholar] [CrossRef] [PubMed]
- Lei, W.-S.; Kumar, A.; Yalamanchili, R. Die Singulation Technologies for Advanced Packaging: A Critical Review. J. Vac. Sci. Technol. B Nanotechnol. Microelectron. Mater. Process. Meas. Phenom. 2012, 30, 040801. [Google Scholar] [CrossRef]
- Smith, S.; Sewart, R.; Becker, H.; Roux, P.; Land, K. Blister Pouches for Effective Reagent Storage on Microfluidic Chips for Blood Cell Counting. Microfluid. Nanofluidics 2016, 20, 163. [Google Scholar] [CrossRef]
- Squires, T.M.; Quake, S.R. Microfluidics Fluid Physics at the Nanoliter. Rev. Mod. Phys. 2005, 77, 978–1026. [Google Scholar] [CrossRef]
Pathogen | DSM No. | Target Gene | Primer/Probe 5′-3′ (F: Forward Primer; R: Reverse Primer; P: Probe Sequence) |
---|---|---|---|
Aeromonas salmonicida (A. sal) | 19634 | vapA | F: TTTCTGGCGTAGGCCGTTTA R: CTTCCGAACGTCATTAACTTCACC P:/6-FAM/CTGCTGGTT/Zen/AACCCGAATGATCATGGTAAT/IABkFQ/ |
Vagococcus salmoninarum (V. sal) | 6633 | pheS | F: AGAGCGGGAAATTCGTCTTC R: GGGAAGGCTGTAACGTTTGTA P:/SUN/ACTGAACCT/Zen/TCCGTCGAAGTTGATGT/IABkFQ |
Yersinia Ruckeri (Y. ruc) | 18506 | glnA | F: TCCAGCACCAAATACGAAGGT R: GATCTGCGTTCTGCCATGT P:/HEX/CCCAGTTGA/Zen/TTCCGCGCAAGATCT/IABkFQ/ |
A. sal Assay | Nucleotide Sequence |
---|---|
Target sequence | 3′-GACGACCAATTGGGCTTACTAGTACCATTAT(15)-5′ |
Capture probe | 5′-NH2–iSp9-CTGCTGGTTAACCCGAATGATCATGGTAAT-3′ |
State of the Art | Current Design | |
---|---|---|
Hybrid biosensor PIC | yes | yes |
Chip footprint [mm] | 10.0 × 12.5 | 3.0 × 5.0 |
Chip area [mm2] | 120 | 15 |
Sensing window arrangement | 6 × 2 = 12 | 3 × 4 = 12 |
Cartridge footprint [mm] | 64.0 × 100.0 | 74.0 × 107.0 |
Channel cross section towards sensor [mm] | 1 × 1 | 0.5 × 0.44 |
Including preheating | no | yes |
Implementing degassing | no | yes |
wafer-level hybrid integration of components into PIC | no | yes |
wafer-level anti-fouling coating | no | yes |
bio-functionalization compatible with PIC in cartridge integration | no | yes |
Scalable process for PIC into cartridge integration | semi | yes |
Pre-loading of liquid possible | yes | yes |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Knoben, W.; Graf, S.; Borutta, F.; Tegegne, Z.; Ningler, M.; Blom, A.; Dam, H.; Evers, K.; Schonenberg, R.; Schütz-Trilling, A.; et al. An Integrated Photonic Biosensing Platform for Pathogen Detection in Aquaculture. Sensors 2024, 24, 5241. https://doi.org/10.3390/s24165241
Knoben W, Graf S, Borutta F, Tegegne Z, Ningler M, Blom A, Dam H, Evers K, Schonenberg R, Schütz-Trilling A, et al. An Integrated Photonic Biosensing Platform for Pathogen Detection in Aquaculture. Sensors. 2024; 24(16):5241. https://doi.org/10.3390/s24165241
Chicago/Turabian StyleKnoben, Wout, Siegfried Graf, Florian Borutta, Zerihun Tegegne, Michael Ningler, Arthur Blom, Henk Dam, Kevin Evers, Rens Schonenberg, Anke Schütz-Trilling, and et al. 2024. "An Integrated Photonic Biosensing Platform for Pathogen Detection in Aquaculture" Sensors 24, no. 16: 5241. https://doi.org/10.3390/s24165241
APA StyleKnoben, W., Graf, S., Borutta, F., Tegegne, Z., Ningler, M., Blom, A., Dam, H., Evers, K., Schonenberg, R., Schütz-Trilling, A., Veerbeek, J., Arnet, R., Fretz, M., Revol, V., Valentin, T., Bridges, C. R., Schulz, S. K., van Kerkhof, J., Leenstra, A., ... van Middendorp, H. (2024). An Integrated Photonic Biosensing Platform for Pathogen Detection in Aquaculture. Sensors, 24(16), 5241. https://doi.org/10.3390/s24165241