Echinochrome A Increases Mitochondrial Mass and Function by Modulating Mitochondrial Biogenesis Regulatory Genes
Abstract
:1. Introduction
2. Results and Discussion
2.1. Echinochrome A Reduced ROS Generation, but Did Not Interfere with Cellular Viability
2.2. Echinochrome A Enhanced Mitochondrial Biogenesis Function
2.3. Echinochrome A Upregulated Mitochondrial Biogenesis Related Genes
3. Experimental Section
3.1. Chemicals
3.2. Cell Culture
3.3. Measurement Cell Viability
3.4. Measurement of Cytotoxicity
3.5. Measurement of Mitochondrial Membrane Potential
3.6. Measurement of ROS
3.7. Measurement of Mitochondrial ATP Level
3.8. Measurement of Oxygen Consumption Rate (OCR)
3.9. Measurement of Mitochondrial Mass
3.10. Reverse Transcription Polymerase Chain Reaction (RT-PCR) and Real-Time PCR
Gene | Forward Primer | Reverse Primer |
---|---|---|
NFR-1 | ATTATTCTGCTGTGGCTGATG | CGTCGTCTGGATGGTCAT |
PGC-1α | CACCGTATTTGAGGACAGCA | GAAGTTCTTCCGGGTAGCTG |
TFAM | AGAGTTGTCATTGGGATTGG | CATTCAGTGGGCAGAAGTC |
TFB2M | GCATTGATTTGGGCAGAC | AACTGGCATTGAACTGGT |
PLMRT | AGAGTGCCAACCTCATCTCT | CAGGGAGTGGATGAAGTTGG |
SSBP | GGGCTCGTATATTTGTGGAA | GCTATGATTGTTGTTGCTTGC |
TUFM | CCCTTTCTGCTCCCTGTA | CAACTCACACTCATCTCCTT |
β-Tubulin | GTTTTGGGAGGTCATCAGTG | CCAGTTATTTCCTGCACCAC |
d-Loop(mtDNA) | ATCCTCCGTGAAATCAACAA | CAGGACTTTGTGCTGACCTT |
B2M(chDNA) | CCCAACTTCCTCAACTGCTA | GCTCCTTCAGAGATGACGTGT |
3.11. Quantitative PCR for Mitochondrial DNA
3.12. Western Blot Analysis
3.13. Data Analysis
4. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Thomson, R.H. Naturally Occurring Quinones, 2nd ed.; Academic Press: London, UK & New York, NY, USA, 1971; pp. 257–272. [Google Scholar]
- Anderson, H.A.; Mathieson, J.W.; Thomson, R.H. Distribution of spinochrome pigments in echinoids. Comp. Biochem. Physiol. 1969, 28, 333–345. [Google Scholar]
- Cannan, R.K. Echinochrome. Biochem. J. 1927, 21, 184–189. [Google Scholar]
- Lebedev, A.V.; Ivanova, M.V.; Levitsky, D.O. Echinochrome, a naturally occurring iron chelator and free radical scavenger in artificial and natural membrane systems. Life Sci. 2005, 76, 863–875. [Google Scholar] [CrossRef]
- Boguslavskaya, L.V.; Khrapova, N.G.; Maksimov, O.B. Polyhydroxynaphthoquinones—A new class of natural antioxidants. Bull. Acad. Sci. USSR Div. Chem. Sci. 1985, 34, 1345–1350. [Google Scholar]
- Lebedev, A.V.; Ivanova, M.V.; Levitsky, D.O. Iron chelators and free radical scavengers in naturally occurring polyhydroxylated 1,4-naphthoquinones. Hemoglobin 2008, 32, 165–179. [Google Scholar] [CrossRef]
- Lebedev, A.V.; Boguslavskaia, L.V.; Levitskii, D.O.; Maksimov, O.B. Mechanisms of the inhibition of Fe2+-induced oxidation of phosphatidylcholine by polyhydroxynaphthoquinones. Biokhimiia 1988, 53, 598–603. [Google Scholar]
- Mischenko, N.P.; Fedoreev, S.A.; Zapara, T.A.; Ratushnyak, A.S. Effects of histochrom and emoxypin on biophysical properties of electroexitable cells. Bull. Exp. Biol. Med. 2009, 147, 196–200. [Google Scholar]
- Gerasimenko, A.V.; Fedoreyev, S.A.; Mischenko, N.P. Molecular and Crystal Structure of the Echinochrome Complex with Dioxane. Crystallogr. Rep. 2006, 51, 48–52. [Google Scholar]
- Mishchenko, N.P.; Fedoreev, S.A.; Bagirova, V.L. Histochrome: A new original domestic drug. Pharm. Chem. J. 2003, 37, 48–52. [Google Scholar]
- Elyakov, G.B.; Maksimov, O.B.; Mishchenko, N.P.; Koltsova, E.A.; Fedoreev, S.A.; Glebko, L.I.; Krasovskaja, N.P.; Artjukov, A.A. Medicinal Drug “Histokhrom” for Treatment of Patients with Acute Myocardium Infarction and Heart Ischemic Disease. Russian Patent 2,137,472, 20 September 1999. [Google Scholar]
- Elyakov, G.B.; Maksimov, O.B.; Mishchenko, N.P.; Koltsova, E.A.; Fedoreev, S.A.; Glebko, L.I.; Krasovskaja, N.P.; Artjukov, A.A. Preparation “Histokhrom” for Treatment of Eye Retina and Cornea Inflammatory Sicknesses. Russian Patent 2,134,107, 20 August 1999. [Google Scholar]
- Vinokurov, A.A.; Alabovskii, V.V.; Shul’zhenko, V.S.; Ivanova, M.V.; Lebedev, A.V. Effect of antioxidant histochrome preparation on the contractile function and metabolism of the isolated rat heart under conditions of “calcium paradox”, ischemia, and reperfusion. Vopr. Med. Khimii 2001, 47, 483–490. [Google Scholar]
- Egorov, E.A.; Alekhina, V.A.; Volobueva, T.M.; Fedoreev, S.A.; Mishchenko, N.P.; Kol’tsova, E.A. Histochrome, a new antioxidant, in the treatment of ocular diseases. Vestn. Oftalmol. 1999, 115, 34–35. [Google Scholar]
- Warda, M.; Kim, H.K.; Kim, N.; Ko, K.S.; Rhee, B.D.; Han, J. A matter of life, death and diseases: mitochondria from a proteomic perspective. Expert Rev. Proteomics 2013, 10, 97–111. [Google Scholar] [CrossRef]
- Handy, D.E.; Loscalzo, J. Redox regulation of mitochondrial function. Antioxid. Redox Signal. 2012, 16, 1323–1367. [Google Scholar] [CrossRef]
- Senese, R.; Valli, V.; Moreno, M.; Lombardi, A.; Busiello, R.A.; Cioffi, F.; Silvestri, E.; Goglia, F.; Lanni, A.; de Lange, P. Uncoupling protein 3 expression levels influence insulin sensitivity, fatty acid oxidation, and related signaling pathways. Pflugers Arch. 2011, 461, 153–164. [Google Scholar] [CrossRef]
- Groschner, L.N.; Waldeck-Weiermair, M.; Malli, R.; Graier, W.F. Endothelial mitochondria–less respiration, more integration. Pflugers Arch. 2012, 464, 63–76. [Google Scholar] [CrossRef]
- Park, K.S.; Wiederkehr, A.; Wollheim, C.B. Defective mitochondrial function and motility due to mitofusin 1 overexpression in insulin secreting cells. Korean J. Physiol. Pharmacol. 2012, 16, 71–77. [Google Scholar]
- Khalil, A.A.; Aziz, F.A.; Hall, J.C. Reperfusion injury. Plast Reconstr. Surg. 2006, 117, 1024–1033. [Google Scholar] [CrossRef]
- Kim, N.H.; Kang, P.M. Apoptosis in cardiovascular diseases: Mechanism and clinical implications. Korean Circ. J. 2010, 40, 299–305. [Google Scholar] [CrossRef]
- Honda, H.M.; Korge, P.; Weiss, J.N. Mitochondria and ischemia/reperfusion injury. Ann. N. Y. Acad. Sci. 2005, 1047, 248–258. [Google Scholar]
- Shoag, J.; Arany, Z. Regulation of hypoxia-inducible genes by PGC-1 alpha. Arterioscler. Thromb. Vasc. Biol. 2010, 30, 662–666. [Google Scholar] [CrossRef]
- Yang, C.M.; Yang, T.L.; Huang, W.T.; Chen, C.H.; Hung, S.H.; Cheng, C.M.; Cheng, M.H. A novel design and evaluation of wearable digital sensor for monitoring posture. In Proceedings of the 30th Annual International Conference of the IEEE Engineering in Medicine and Biology Society, Vancouver, BC, Canada, 20–25 August 2008; pp. 1304–1307.
- Kim, H.K.; Song, I.S.; Lee, S.Y.; Jeong, S.H.; Lee, S.R.; Heo, H.J.; Thu, V.T.; Kim, N.; Ko, K.S.; Rhee, B.D.; et al. B7-H4 downregulation induces mitochondrial dysfunction and enhances doxorubicin sensitivity via the cAMP/CREB/PGC1-α signaling pathway in HeLa cells. Pflugers Arch. 2014. [Google Scholar] [CrossRef]
- Johnson, R.F.; Witzel, I.I.; Perkins, N.D. p53-Dependent regulation of mitochondrial energy production by the RelA subunit of NF-κB. Cancer Res. 2011, 71, 5588–5597. [Google Scholar] [CrossRef]
- Komen, J.C.; Thorburn, D.R. Turn up the power—Pharmacological activation of mitochondrial biogenesis in mouse models. Br. J. Pharmacol. 2014, 171, 1818–1836. [Google Scholar]
- Kim, S.K.; Joe, Y.; Zheng, M.; Kim, H.J.; Yu, J.K.; Cho, G.J.; Chang, K.C.; Kim, H.K.; Han, J.; Ryter, S.W.; et al. Resveratrol Induces Hepatic Mitochondrial Biogenesis through the Sequential Activation of Nitric Oxide and Carbon Monoxide Production. Antioxid. Redox Signal. 2014, 20, 2589–2605. [Google Scholar] [CrossRef]
- Li, Y.G.; Zhu, W.; Tao, J.P.; Xin, P.; Liu, M.Y.; Li, J.B.; Wei, M. Resveratrol protects cardiomyocytes from oxidative stress through SIRT1 and mitochondrial biogenesis signaling pathways. Biochem. Biophys. Res. Commun. 2013, 438, 270–276. [Google Scholar] [CrossRef]
- Higashida, K.; Kim, S.H.; Jung, S.R.; Asaka, M.; Holloszy, J.O.; Han, D.H. Effects of resveratrol and SIRT1 on PGC-1α activity and mitochondrial biogenesis: A reevaluation. PLoS Biol. 2013, 11. [Google Scholar] [CrossRef]
- Chen, S.; Fan, Q.; Li, A.; Liao, D.; Ge, J.; Laties, A.M.; Zhang, X. Dynamic mobilization of PGC-1alpha mediates mitochondrial biogenesis for the protection of RGC-5 cells by resveratrol during serum deprivation. Apoptosis 2013, 18, 786–799. [Google Scholar] [CrossRef]
- Lebedev, A.V.; Ivanova, M.V.; Krasnovid, N.I. Interaction of natural polyhydroxy-1, 4-naphthoquinones with superoxide anion-radical. Biochemistry 1999, 64, 1273–1278. [Google Scholar]
- Markov, V.A.; Buymov, G.A.; Maximov, I.V.; Perchatkin, V.A.; Repin, A.N.; Lusta, I.V.; Varvarenko, V.I. Effect of a novel water soluble bioantioxidant histochrome on reperfusion injury after thrombolysis in patients with acute myocardial infarction. Kardiologiya 1999, 39, 20–23. [Google Scholar]
- Jeong, S.H.; Kim, H.K.; Song, I.S.; Lee, S.J.; Ko, K.S.; Rhee, B.D.; Kim, N.; Mishchenko, N.P.; Fedoryev, S.A.; Stonik, V.A.; et al. Echinochrome A protects mitochondrial function in cardiomyocytes against cardiotoxic drugs. Mar. Drugs 2014, 12, 2922–2936. [Google Scholar] [CrossRef]
- Hock, M.B.; Kralli, A. Transcriptional control of mitochondrial biogenesis and function. Annu. Rev. Physiol. 2009, 71, 177–203. [Google Scholar] [CrossRef]
- Marton, O.; Koltai, E.; Takeda, M.; Koch, L.G.; Britton, S.L.; Davies, K.J.; Boldogh, I.; Radak, Z. Mitochondrial biogenesis-associated factors underlie the magnitude of response to aerobic endurance training in rats. Pflugers Arch. 2014. [Google Scholar] [CrossRef]
- Lanza, I. R.; Nair, K. S. Mitochondrial function as a determinant of life span. Pflugers Arch. 2010, 459, 277–289. [Google Scholar] [CrossRef]
- Scarpulla, R.C. Transcriptional paradigms in mammalian mitochondrial biogenesis and function. Physiol. Rev. 2008, 88, 611–638. [Google Scholar] [CrossRef]
- Johar, K.; Priya, A.; Dhar, S.; Liu, Q.; Wong-Riley, M.T. Neuron-specific specificity protein 4 bigenomically regulates the transcription of all mitochondria- and nucleus-encoded cytochrome c oxidase subunit genes in neurons. J. Neurochem. 2013, 127, 496–508. [Google Scholar] [CrossRef]
- Bestwick, M.L.; Shadel, G.S. Accessorizing the human mitochondrial transcription machinery. Trends Biochem. Sci. 2013, 38, 283–291. [Google Scholar] [CrossRef]
- Thomas, R.R.; Khan, S.M.; Smigrodzki, R.M.; Onyango, I.G.; Dennis, J.; Khan, O.M.; Portelli, F.R.; Bennett, J.P., Jr. RhTFAM treatment stimulates mitochondrial oxidative metabolism and improves memory in aged mice. Aging 2012, 4, 620–635. [Google Scholar]
- Wu, Z.; Huang, X.; Feng, Y.; Handschin, C.; Gullicksen, P.S.; Bare, O.; Labow, M.; Spiegelman, B.; Stevenson, S.C. Transducer of regulated CREB-binding proteins (TORCs) induce PGC-1α transcription and mitochondrial biogenesis in muscle cells. Proc. Natl. Acad. Sci. USA 2006, 103, 14379–14384. [Google Scholar] [CrossRef]
- Mischenko, N.P.; Fedoreyev, S.A.; Pokhilo, N.D.; Anufriev, V.P.; Denisenko, V.A.; Glazunov, V.P. Echinamines A and B, first aminated hydroxynaphthazarins from the sea urchin Scaphechinus mirabilis. J. Nat. Prod. 2005, 68, 1390–1393. [Google Scholar] [CrossRef]
- Tyler, A. Crystalline Echinochrome and Spinochrome: Their Failure to Stimulate the Respiration of Eggs and of Sperm of Strongylocentrotus. Proc. Natl. Acad. Sci. USA 1939, 25, 523–528. [Google Scholar] [CrossRef]
© 2014 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Jeong, S.H.; Kim, H.K.; Song, I.-S.; Noh, S.J.; Marquez, J.; Ko, K.S.; Rhee, B.D.; Kim, N.; Mishchenko, N.P.; Fedoreyev, S.A.; et al. Echinochrome A Increases Mitochondrial Mass and Function by Modulating Mitochondrial Biogenesis Regulatory Genes. Mar. Drugs 2014, 12, 4602-4615. https://doi.org/10.3390/md12084602
Jeong SH, Kim HK, Song I-S, Noh SJ, Marquez J, Ko KS, Rhee BD, Kim N, Mishchenko NP, Fedoreyev SA, et al. Echinochrome A Increases Mitochondrial Mass and Function by Modulating Mitochondrial Biogenesis Regulatory Genes. Marine Drugs. 2014; 12(8):4602-4615. https://doi.org/10.3390/md12084602
Chicago/Turabian StyleJeong, Seung Hun, Hyoung Kyu Kim, In-Sung Song, Su Jin Noh, Jubert Marquez, Kyung Soo Ko, Byoung Doo Rhee, Nari Kim, Natalia P. Mishchenko, Sergey A. Fedoreyev, and et al. 2014. "Echinochrome A Increases Mitochondrial Mass and Function by Modulating Mitochondrial Biogenesis Regulatory Genes" Marine Drugs 12, no. 8: 4602-4615. https://doi.org/10.3390/md12084602