Usage of Cell-Free Protein Synthesis in Post-Translational Modification of μ-Conopeptide PIIIA
Abstract
:1. Introduction
Modification | Sites | Post-Translational Enzymes |
---|---|---|
Disulfide | Cys residues | protein disulfide isomerise, PDI [21] |
Hydroxylation | Pro C-4 | proline hydroxylase [16] hydroxylase with D-aa specificity [22] lysyl hydroxylase [23] |
Lys C-5 | ||
Val γ- | ||
Carboxylation | Glu γ-(vitamin K-dependent) | γ-glutamyl carboxylase [24] |
Bromination | Trp C-6 | bromoperoxidase [25] |
Sulfotyrsine | Tyr | tyrosyl sulfotransferase [12] |
Epimerization | Trp, Leu, Phe, and Val | epimerase [26] |
Cyclization | Gln | glutaminyl cyclase [11] |
O-glycosylation | Ser, Thr | polypeptide hexNAc transferase [8] |
Amidation | C terminus | peptidylglycine alpha amidating monooxygenase [27] |
Cis-trans isomerization | Pro | peptidylprolyl cis-trans isomerases, PPIases [28] |
2. Results
2.1. A Cell-Free Protein Synthesis Platform for μ-PIIIA Biosynthesis
2.2. Use of the CE-CFPS Platform for the Proline Hydroxylation of μ-PIIIA
2.3. Targeted Post-Translational Modification of μ-PIIIA Expression in Escherichia coli
2.4. Effect of Recombinant PIIIA on hNav1.4
3. Discussion
4. Materials and Methods
4.1. Strains and Agents
4.2. Cell Culture
4.3. Plasmid Construction
4.4. CE-CFPS Reactions
4.5. Purification and Identification of rPIIIA 3
4.6. Qualitative Analyses by MALDI-TOF MS
4.7. Western-Blot Assay
4.8. Whole Cell Patch-Clamp Recordings
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Jin, A.-H.; Muttenthaler, M.; Dutertre, S.; Himaya, S.W.A.; Kaas, Q.; Craik, D.J.; Lewis, R.J.; Alewood, P.F. Conopeptides: Chemistry and Biology. Chem. Rev. 2019, 119, 11510–11549. [Google Scholar] [CrossRef]
- Buczek, O.; Bulaj, G.; Olivera, B.M. Conopeptides and the posttranslational modification of secreted gene products. Cell. Mol. Life Sci. 2005, 62, 3067–3079. [Google Scholar] [CrossRef] [PubMed]
- Bulaj, G.; Buczek, O.; Goodsell, I.; Jimenez, E.C.; Kranski, J.; Nielsen, J.S.; Garrett, J.E.; Olivera, B.M. Efficient oxidative folding of conopeptides and the radiation of venomous cone snails. Proc. Natl. Acad. Sci. USA 2003, 100 (Suppl. S2), 14562–14568. [Google Scholar] [CrossRef]
- Rigby, A.C.; Baleja, J.D.; Li, L.; Pedersen, L.G.; Furie, B.C.; Furie, B. Role of gamma-carboxyglutamic acid in the calcium-induced structural transition of conantokin G, a conotoxin from the marine snail Conus geographus. Biochemistry 1997, 36, 15677–15684. [Google Scholar] [CrossRef]
- Dutton, J.L.; Bansal, P.S.; Hogg, R.C.; Adams, D.J.; Alewood, P.F.; Craik, D.J. A new level of conopeptide diversity, a non-native disulfide bond connectivity in alpha-conopeptide AuIB reduces structural definition but increases biological activity. J. Biol. Chem. 2002, 277, 48849–48857. [Google Scholar] [CrossRef] [Green Version]
- Buczek, O.; Yoshikami, D.; Bulaj, G.; Jimenez, E.C.; Olivera, B.M. Post-translational amino acid isomerization: A functionally important D-amino acid in an excitatory peptide. J. Biol. Chem. 2005, 280, 4247–4253. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Craig, A.G.; Jimenez, E.C.; Dykert, J.; Nielsen, D.B.; Gulyas, J.; Abogadie, F.C.; Porter, J.; Rivier, J.E.; Cruz, L.J.; Olivera, B.M.; et al. A novel post-translational modification involving bromination of tryptophan. Identification of the residue, l-6-bromotryptophan, in peptides from Conus imperialis and Conus radiatus venom. J. Biol. Chem. 1997, 272, 4689–4698. [Google Scholar] [CrossRef] [Green Version]
- Craig, A.G.; Park, M.; Fischer, W.H.; Kang, J.; Compain, P.; Piller, F. Enzymatic glycosylation of contulakin-G, a glycopeptide isolated from Conus venom, with a mammalian ppGalNAc-transferase. Toxicon 2001, 39, 809–815. [Google Scholar] [CrossRef] [PubMed]
- Craig, A.G.; Zafaralla, G.; Cruz, L.J.; Santos, A.D.; Hillyard, D.R.; Dykert, J.; Rivier, J.E.; Gray, W.R.; Imperial, J.; DelaCruz, R.G.; et al. An O-glycosylated neuroexcitatory conus peptide. Biochemistry 1998, 37, 16019–16025. [Google Scholar] [CrossRef]
- Gerwig, G.J.; Hocking, H.G.; Stocklin, R.; Kamerling, J.P.; Boelens, R. Glycosylation of conopeptides. Mar. Drugs 2013, 11, 623–642. [Google Scholar] [CrossRef]
- Vijayasarathy, M.; Basheer, S.M.; Balaram, P. Cone Snail Glutaminyl Cyclase Sequences from Transcriptomic Analysis and Mass Spectrometric Characterization of Two Pyroglutamyl Conopeptides. J. Proteome Res. 2018, 17, 2695–2703. [Google Scholar] [CrossRef]
- Loughnan, M.L.; Nicke, A.; Jones, A.; Adams, D.J.; Alewood, P.F.; Lewis, R.J. Chemical and functional identification and characterization of novel sulfated alpha-conopeptides from the cone snail Conus anemone. J. Med. Chem. 2004, 47, 1234–1241. [Google Scholar] [CrossRef]
- Wang, L.; Tang, W.; Wang, X.; Chen, Y.; Wu, Y.; Qiang, Y.; Feng, Y.; Ren, Z.; Chen, S.; Xu, A. PPIase is associated with the diversity of conopeptides from cone snail venom glands. Biochimie 2015, 112, 129–138. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Wang, X.; Ren, Z.; Tang, W.; Zou, Q.; Wang, J.; Chen, S.; Zhang, H.; Xu, A. Oxidative Folding of Conopeptides Modified by Conus Protein Disulfide Isomerase. Protein J. 2017, 36, 407–416. [Google Scholar] [CrossRef] [PubMed]
- Kunda, S.; Yuan, Y.; Balsara, R.D.; Zajicek, J.; Castellino, F.J. Hydroxyproline-induced Helical Disruption in Conantokin Rl-B Affects Subunit-selective Antagonistic Activities toward Ion Channels of N-Methyl-d-aspartate Receptors. J. Biol. Chem. 2015, 290, 18156–18172. [Google Scholar] [CrossRef] [Green Version]
- Vijayasarathy, M.; Balaram, P. Cone snail prolyl-4-hydroxylase alpha-subunit sequences derived from transcriptomic data and mass spectrometric analysis of variable proline hydroxylation in C. amadis venom. J. Proteom. 2019, 194, 37–48. [Google Scholar] [CrossRef] [PubMed]
- Gorres, K.L.; Raines, R.T. Prolyl 4-hydroxylase. Crit. Rev. Biochem. Mol. Biol. 2010, 45, 106–124. [Google Scholar] [CrossRef]
- Smolskaya, S.; Logashina, Y.A.; Andreev, Y.A. Escherichia coli Extract-Based Cell-Free Expression System as an Alternative for Difficult-to-Obtain Protein Biosynthesis. Int. J. Mol. Sci. 2020, 21, 928. [Google Scholar] [CrossRef] [Green Version]
- Hershewe, J.; Kightlinger, W.; Jewett, M.C. Cell-free systems for accelerating glycoprotein expression and biomanufacturing. J. Ind. Microbiol. Biotechnol. 2020, 47, 977–991. [Google Scholar] [CrossRef]
- Tokmakov, A.A.; Kurotani, A.; Takagi, T.; Toyama, M.; Shirouzu, M.; Fukami, Y.; Yokoyama, S. Multiple post-translational modifications affect heterologous protein synthesis. J. Biol. Chem. 2012, 287, 27106–27116. [Google Scholar] [CrossRef] [Green Version]
- Safavi-Hemami, H.; Siero, W.A.; Gorasia, D.G.; Young, N.D.; Macmillan, D.; Williamson, N.A.; Purcell, A.W. Specialisation of the venom gland proteome in predatory cone snails reveals functional diversification of the conopeptide biosynthetic pathway. J. Proteome Res. 2011, 10, 3904–3919. [Google Scholar] [CrossRef] [PubMed]
- Pisarewicz, K.; Mora, D.; Pflueger, F.C.; Fields, G.B.; Mari, F. Polypeptide chains containing D-gamma-hydroxyvaline. J. Am. Chem. Soc. 2005, 127, 6207–6215. [Google Scholar] [CrossRef] [PubMed]
- Aguilar, M.B.; Lopez-Vera, E.; Ortiz, E.; Becerril, B.; Possani, L.D.; Olivera, B.M.; Heimer de la Cotera, E.P. A novel conotoxin from Conus delessertii with posttranslationally modified lysine residues. Biochemistry 2005, 44, 11130–11136. [Google Scholar] [CrossRef]
- Hansson, K.; Ma, X.; Eliasson, L.; Czerwiec, E.; Furie, B.; Furie, B.C.; Rorsman, P.; Stenflo, J. The first gamma-carboxyglutamic acid-containing contryphan. A selective L-type calcium ion channel blocker isolated from the venom of Conus marmoreus. J. Biol. Chem. 2004, 279, 32453–32463. [Google Scholar] [CrossRef] [Green Version]
- Vijayasarathy, M.; Balaram, P. Mass spectrometric identification of bromotryptophan containing conopeptide sequences from the venom of C. amadis. Toxicon 2018, 144, 68–74. [Google Scholar] [CrossRef]
- Jimenez, E.C.; Olivera, B.M.; Gray, W.R.; Cruz, L.J. Contryphan is a d-tryptophan-containing Conus peptide. J. Biol. Chem. 1996, 271, 28002–28005. [Google Scholar] [CrossRef] [Green Version]
- Ul-Hasan, S.; Burgess, D.M.; Gajewiak, J.; Li, Q.; Hu, H.; Yandell, M.; Olivera, B.M.; Bandyopadhyay, P.K. Characterization of the peptidylglycine alpha-amidating monooxygenase (PAM) from the venom ducts of neogastropods, Conus bullatus and Conus geographus. Toxicon 2013, 74, 215–224. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Safavi-Hemami, H.; Bulaj, G.; Olivera, B.M.; Williamson, N.A.; Purcell, A.W. Identification of Conus peptidylprolyl cis-trans isomerases (PPIases) and assessment of their role in the oxidative folding of conopeptides. J. Biol. Chem. 2010, 285, 12735–12746. [Google Scholar] [CrossRef] [Green Version]
- Brown, M.A.; Begley, G.S.; Czerwiec, E.; Stenberg, L.M.; Jacobs, M.; Kalume, D.E.; Roepstorff, P.; Stenflo, J.; Furie, B.C.; Furie, B. Precursors of novel Gla-containing conopeptides contain a carboxy-terminal recognition site that directs gamma-carboxylation. Biochemistry 2005, 44, 9150–9159. [Google Scholar] [CrossRef]
- Buczek, O.; Olivera, B.M.; Bulaj, G. Propeptide does not act as an intramolecular chaperone but facilitates protein disulfide isomerase-assisted folding of a conopeptide precursor. Biochemistry 2004, 43, 1093–1101. [Google Scholar] [CrossRef]
- Tietze, A.A.; Tietze, D.; Ohlenschlager, O.; Leipold, E.; Ullrich, F.; Kuhl, T.; Mischo, A.; Buntkowsky, G.; Gorlach, M.; Heinemann, S.H.; et al. Structurally diverse mu-conopeptide PIIIA isomers block sodium channel NaV 1.4. Angew. Chem. Int. Ed. Engl. 2012, 51, 4058–4061. [Google Scholar] [CrossRef] [PubMed]
- Eipper, B.A.; Milgram, S.L.; Husten, E.J.; Yun, H.Y.; Mains, R.E. Peptidylglycine alpha-amidating monooxygenase: A multifunctional protein with catalytic, processing, and routing domains. Protein Sci. 1993, 2, 489–497. [Google Scholar] [CrossRef]
- Kwon, Y.C.; Jewett, M.C. High-throughput preparation methods of crude extract for robust cell-free protein synthesis. Sci. Rep. 2015, 5, 8663. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sitaraman, K.; Esposito, D.; Klarmann, G.; Le Grice, S.F.; Hartley, J.L.; Chatterjee, D.K. A novel cell-free protein synthesis system. J. Biotechnol. 2004, 110, 257–263. [Google Scholar] [CrossRef] [PubMed]
- Rasor, B.J.; Yi, X.; Brown, H.; Alper, H.S.; Jewett, M.C. An integrated in vivo/in vitro framework to enhance cell-free biosynthesis with metabolically rewired yeast extracts. Nat. Commun. 2021, 12, 5139. [Google Scholar] [CrossRef]
- Harbers, M. Wheat germ systems for cell-free protein expression. FEBS Lett. 2014, 588, 2762–2773. [Google Scholar] [CrossRef] [Green Version]
- Hempel, R.; Schmidt-Brauns, J.; Gebinoga, M.; Wirsching, F.; Schwienhorst, A. Cation radius effects on cell-free translation in rabbit reticulocyte lysate. Biochem. Biophys. Res. Commun. 2001, 283, 267–272. [Google Scholar] [CrossRef]
- Ezure, T.; Suzuki, T.; Shikata, M.; Ito, M.; Ando, E.; Utsumi, T.; Nishimura, O.; Tsunasawa, S. Development of an insect cell-free system. Curr. Pharm. Biotechnol. 2010, 11, 279–284. [Google Scholar] [CrossRef]
- Brodel, A.K.; Sonnabend, A.; Kubick, S. Cell-free protein expression based on extracts from CHO cells. Biotechnol. Bioeng. 2014, 111, 25–36. [Google Scholar] [CrossRef]
- Mikami, S.; Kobayashi, T.; Imataka, H. Cell-free protein synthesis systems with extracts from cultured human cells. Methods Mol. Biol. 2010, 607, 43–52. [Google Scholar]
- Ramm, F.; Jack, L.; Kaser, D.; Schlosshauer, J.L.; Zemella, A.; Kubick, S. Cell-Free Systems Enable the Production of AB(5) Toxins for Diagnostic Applications. Toxins 2022, 14, 233. [Google Scholar] [CrossRef]
- Kay, J.E.; Jewett, M.C. A cell-free system for production of 2,3-butanediol is robust to growth-toxic compounds. Metab. Eng. Commun. 2020, 10, e00114. [Google Scholar] [CrossRef]
- Valliere, M.A.; Korman, T.P.; Woodall, N.B.; Khitrov, G.A.; Taylor, R.E.; Baker, D.; Bowie, J.U. A cell-free platform for the prenylation of natural products and application to cannabinoid production. Nat. Commun. 2019, 10, 565. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Karim, A.S.; Jewett, M.C. A cell-free framework for rapid biosynthetic pathway prototyping and enzyme discovery. Metab. Eng. 2016, 36, 116–126. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Stech, M.; Nikolaeva, O.; Thoring, L.; Stocklein, W.F.M.; Wustenhagen, D.A.; Hust, M.; Dubel, S.; Kubick, S. Cell-free synthesis of functional antibodies using a coupled in vitro transcription-translation system based on CHO cell lysates. Sci. Rep. 2017, 7, 12030. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lu, Y.; Welsh, J.P.; Swartz, J.R. Production and stabilization of the trimeric influenza hemagglutinin stem domain for potentially broadly protective influenza vaccines. Proc. Natl. Acad. Sci. USA 2014, 111, 125–130. [Google Scholar] [CrossRef]
- Liu, R.; Zhang, Y.; Zhai, G.; Fu, S.; Xia, Y.; Hu, B.; Cai, X.; Zhang, Y.; Li, Y.; Deng, Z.; et al. A Cell-Free Platform Based on Nisin Biosynthesis for Discovering Novel Lanthipeptides and Guiding their Overproduction In Vivo. Adv. Sci. 2020, 7, 2001616. [Google Scholar] [CrossRef]
- Bandyopadhyay, P.K.; Colledge, C.J.; Walker, C.S.; Zhou, L.M.; Hillyard, D.R.; Olivera, B.M. Conantokin-G precursor and its role in gamma-carboxylation by a vitamin K-dependent carboxylase from a Conus snail. J. Biol. Chem. 1998, 273, 5447–5450. [Google Scholar] [CrossRef] [Green Version]
- Liu, Y.; Yin, Y.; Song, Y.; Wang, K.; Wu, F.; Jiang, H. Alpha-Conopeptide as Potential to alpha7-nAChR Recombinant Expressed in Escherichia coli. Mar. Drugs 2020, 18, 422. [Google Scholar] [CrossRef]
- Ghovanloo, M.R.; Choudhury, K.; Bandaru, T.S.; Fouda, M.A.; Rayani, K.; Rusinova, R.; Phaterpekar, T.; Nelkenbrecher, K.; Watkins, A.R.; Poburko, D.; et al. Cannabidiol inhibits the skeletal muscle Nav1.4 by blocking its pore and by altering membrane elasticity. J. Gen. Physiol. 2021, 153, e202012701. [Google Scholar] [CrossRef]
pI-p3a1-2.4d | pI-p3a2-2.4d | pI-p3a3-2.4d | |||||||
---|---|---|---|---|---|---|---|---|---|
pH-2.4d | + | + | + | + | + | + | + | + | + |
pC-2.4d | + | + | + | ||||||
pPDI-2.4d | + | + | + | + | + | + |
Name | Sequence (5′–3′) |
---|---|
pET-PIIIA-F | cgGAATTCATGCTGCCGATGGACGGTGA |
pET-PIIIA-R | GAGCTCTTAGCAGCAACGGTGCGGT |
pET-H-F | gcCTCGAGATGAAACTGACCGGTCCGGCGC |
pET-H-R | GCGGCCGCTTACTGAATAACCTCTTTCAGCG |
pET-SUMO-PDI-F | ggGGTACCAAGTTCAGCAGCTGCCTG |
pET-SUMO-PDI-R | CTCGAGTTACAGTTCATCACGCGG |
pET-SUMO-H-F | ggGGTACCAAACTGACCTGGACCACCAC |
pET-SUMO-H-R | CTCGAGTTACTCAATGATTTGCTTGATCGC |
pET-SUMO-C-F | ggGGTACCATGGAGAAGGTGACCACCG |
pET-SUMO-C-R | CTCGAGTTACAGCAGATCAACCAGAAACAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, Y.; Zhao, Z.; Song, Y.; Yin, Y.; Wu, F.; Jiang, H. Usage of Cell-Free Protein Synthesis in Post-Translational Modification of μ-Conopeptide PIIIA. Mar. Drugs 2023, 21, 421. https://doi.org/10.3390/md21080421
Liu Y, Zhao Z, Song Y, Yin Y, Wu F, Jiang H. Usage of Cell-Free Protein Synthesis in Post-Translational Modification of μ-Conopeptide PIIIA. Marine Drugs. 2023; 21(8):421. https://doi.org/10.3390/md21080421
Chicago/Turabian StyleLiu, Yanli, Zitong Zhao, Yunyang Song, Yifeng Yin, Fanghui Wu, and Hui Jiang. 2023. "Usage of Cell-Free Protein Synthesis in Post-Translational Modification of μ-Conopeptide PIIIA" Marine Drugs 21, no. 8: 421. https://doi.org/10.3390/md21080421