Interferon Regulatory Factor 3-Mediated Signaling Limits Middle-East Respiratory Syndrome (MERS) Coronavirus Propagation in Cells from an Insectivorous Bat
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Culture and Virus Infection
2.2. Virus Titration
2.3. TLR3 Stimulation
2.4. Nucleic Acid Extraction, qRT-PCR, and Conventional PCR
2.5. Agarose Gel Electrophoresis
2.6. Knock-Down of IRF3 Transcripts in Efk3 and MRC5 Cells
2.7. Generating IRF3 Knockout Bat Cells
2.8. Immunofluorescence
2.9. Cell Fractionation
2.10. Immune Blots
2.11. Phylogenetic Analysis
2.12. Statistics
3. Results
3.1. MERS-CoV Propagates to Lower Levels in Big Brown Bat Cells
3.2. In Contrast to Human Cells, MERS-CoV Induces IFNβ Transcripts in Bat Cells
3.3. IRF3 Localizes in the Nucleus Of Big Brown Bat Cells in Response to Poly(I:C)
3.4. IRF3 is Critical for Antiviral Interferon beta (IFNβ) Production in Big Brown Bat Cells
3.5. IRF3-Mediated Signaling Inhibits MERS-CoV Propagation in Big Brown Bat Cells
4. Discussion
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Moratelli, R.; Calisher, C.H. Bats and zoonotic viruses: Can we confidently link bats with emerging deadly viruses? Mem. Inst. Oswaldo Cruz 2015, 110, 1–22. [Google Scholar] [CrossRef] [PubMed]
- Calisher, C.H.; Childs, J.E.; Field, H.E.; Holmes, K.V.; Schountz, T. Bats: Important reservoir hosts of emerging viruses. Clin. Microbiol. Rev. 2006, 19, 531–545. [Google Scholar] [CrossRef] [PubMed]
- Maxmen, A. Bats are global reservoir for deadly coronaviruses. Nature 2017, 546, 340. [Google Scholar] [CrossRef] [PubMed]
- Hayman, D.T. Bats as Viral Reservoirs. Annu. Rev. Virol. 2016, 3, 77–99. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Shi, Z.; Yu, M.; Ren, W.; Smith, C.; Epstein, J.H.; Wang, H.; Crameri, G.; Hu, Z.; Zhang, H.; et al. Bats are natural reservoirs of SARS-like coronaviruses. Science 2005, 310, 676–679. [Google Scholar] [CrossRef] [PubMed]
- Hu, B.; Zeng, L.P.; Yang, X.L.; Ge, X.Y.; Zhang, W.; Li, B.; Xie, J.Z.; Shen, X.R.; Zhang, Y.Z.; Wang, N.; et al. Discovery of a rich gene pool of bat SARS-related coronaviruses provides new insights into the origin of SARS coronavirus. PLoS Pathog. 2017, 13, e1006698. [Google Scholar] [CrossRef] [PubMed]
- Drexler, J.F.; Corman, V.M.; Drosten, C. Ecology, evolution and classification of bat coronaviruses in the aftermath of SARS. Antivir. Res. 2014, 101, 45–56. [Google Scholar] [CrossRef] [PubMed]
- Anthony, S.J.; Gilardi, K.; Menachery, V.D.; Goldstein, T.; Ssebide, B.; Mbabazi, R.; Navarrete-Macias, I.; Liang, E.; Wells, H.; Hicks, A.; et al. Further Evidence for Bats as the Evolutionary Source of Middle East Respiratory Syndrome Coronavirus. MBio 2017, 8. [Google Scholar] [CrossRef] [PubMed]
- Goldstein, S.A.; Weiss, S.R. Origins and pathogenesis of Middle East respiratory syndrome-associated coronavirus: Recent advances. F1000Res 2017, 6, 1628. [Google Scholar] [CrossRef] [PubMed]
- Munster, V.J.; Adney, D.R.; van Doremalen, N.; Brown, V.R.; Miazgowicz, K.L.; Milne-Price, S.; Bushmaker, T.; Rosenke, R.; Scott, D.; Hawkinson, A.; et al. Replication and shedding of MERS-CoV in Jamaican fruit bats (Artibeus jamaicensis). Sci. Rep. 2016, 6, 21878. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Huang, Y.W.; Dickerman, A.W.; Pineyro, P.; Li, L.; Fang, L.; Kiehne, R.; Opriessnig, T.; Meng, X.J. Origin, evolution, and genotyping of emergent porcine epidemic diarrhea virus strains in the United States. MBio 2013, 4, e00737-00713. [Google Scholar] [CrossRef] [PubMed]
- Zhou, P.; Fan, H.; Lan, T.; Yang, X.L.; Shi, W.F.; Zhang, W.; Zhu, Y.; Zhang, Y.W.; Xie, Q.M.; Mani, S.; et al. Fatal swine acute diarrhoea syndrome caused by an HKU2-related coronavirus of bat origin. Nature 2018, 556, 255–258. [Google Scholar] [CrossRef] [PubMed]
- WHO. Middle East Respiratory Syndrome Coronavirus. Available online: http://www.who.int/emergencies/mers-cov/en/ (accessed on 10 November 2018).
- Schulz, L.L.; Tonsor, G.T. Assessment of the economic impacts of porcine epidemic diarrhea virus in the United States. J. Anim. Sci. 2015, 93, 5111–5118. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Moreno, A.; Lelli, D.; de Sabato, L.; Zaccaria, G.; Boni, A.; Sozzi, E.; Prosperi, A.; Lavazza, A.; Cella, E.; Castrucci, M.R.; et al. Detection and full genome characterization of two beta CoV viruses related to Middle East respiratory syndrome from bats in Italy. Virol. J. 2017, 14, 239. [Google Scholar] [CrossRef] [PubMed]
- Corman, V.M.; Muth, D.; Niemeyer, D.; Drosten, C. Hosts and Sources of Endemic Human Coronaviruses. Adv. Virus Res. 2018, 100, 163–188. [Google Scholar] [CrossRef] [PubMed]
- Bailey, E.S.; Fieldhouse, J.K.; Choi, J.Y.; Gray, G.C. A Mini Review of the Zoonotic Threat Potential of Influenza Viruses, Coronaviruses, Adenoviruses, and Enteroviruses. Front. Public Health 2018, 6, 104. [Google Scholar] [CrossRef] [PubMed]
- Luo, C.M.; Wang, N.; Yang, X.L.; Liu, H.Z.; Zhang, W.; Li, B.; Hu, B.; Peng, C.; Geng, Q.B.; Zhu, G.J.; et al. Discovery of novel bat coronaviruses in south China that use the same receptor as MERS coronavirus. J. Virol. 2018. [Google Scholar] [CrossRef] [PubMed]
- Siu, K.L.; Yeung, M.L.; Kok, K.H.; Yuen, K.S.; Kew, C.; Lui, P.Y.; Chan, C.P.; Tse, H.; Woo, P.C.; Yuen, K.Y.; et al. Middle east respiratory syndrome coronavirus 4a protein is a double-stranded RNA-binding protein that suppresses PACT-induced activation of RIG-I and MDA5 in the innate antiviral response. J. Virol. 2014, 88, 4866–4876. [Google Scholar] [CrossRef]
- Niemeyer, D.; Zillinger, T.; Muth, D.; Zielecki, F.; Horvath, G.; Suliman, T.; Barchet, W.; Weber, F.; Drosten, C.; Muller, M.A. Middle East respiratory syndrome coronavirus accessory protein 4a is a type I interferon antagonist. J. Virol. 2013, 87, 12489–12495. [Google Scholar] [CrossRef]
- Zhou, J.; Chu, H.; Chan, J.F.; Yuen, K.Y. Middle East respiratory syndrome coronavirus infection: Virus-host cell interactions and implications on pathogenesis. Virol. J. 2015, 12, 218. [Google Scholar] [CrossRef]
- Lui, P.Y.; Wong, L.Y.; Fung, C.L.; Siu, K.L.; Yeung, M.L.; Yuen, K.S.; Chan, C.P.; Woo, P.C.; Yuen, K.Y.; Jin, D.Y. Middle East respiratory syndrome coronavirus M protein suppresses type I interferon expression through the inhibition of TBK1-dependent phosphorylation of IRF3. Emerg. Microbes Infect. 2016, 5, e39. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Zhang, L.; Geng, H.; Deng, Y.; Huang, B.; Guo, Y.; Zhao, Z.; Tan, W. The structural and accessory proteins M, ORF 4a, ORF 4b, and ORF 5 of Middle East respiratory syndrome coronavirus (MERS-CoV) are potent interferon antagonists. Protein Cell 2013, 4, 951–961. [Google Scholar] [CrossRef] [Green Version]
- Kawai, T.; Akira, S. Innate immune recognition of viral infection. Nat. Immunol. 2006, 7, 131–137. [Google Scholar] [CrossRef] [PubMed]
- Ivashkiv, L.B.; Donlin, L.T. Regulation of type I interferon responses. Nat. Rev. Immunol. 2014, 14, 36–49. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schoggins, J.W.; Rice, C.M. Interferon-stimulated genes and their antiviral effector functions. Curr. Opin. Virol. 2011, 1, 519–525. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Choi, U.Y.; Kang, J.S.; Hwang, Y.S.; Kim, Y.J. Oligoadenylate synthase-like (OASL) proteins: Dual functions and associations with diseases. Exp. Mol. Med. 2015, 47, e144. [Google Scholar] [CrossRef] [PubMed]
- Schulz, K.S.; Mossman, K.L. Viral Evasion Strategies in Type I IFN Signaling—A Summary of Recent Developments. Front. Immunol. 2016, 7, 498. [Google Scholar] [CrossRef]
- De Wit, E.; van Doremalen, N.; Falzarano, D.; Munster, V.J. SARS and MERS: Recent insights into emerging coronaviruses. Nat. Rev. Microbiol. 2016, 14, 523–534. [Google Scholar] [CrossRef]
- Lu, X.; Pan, J.; Tao, J.; Guo, D. SARS-CoV nucleocapsid protein antagonizes IFN-beta response by targeting initial step of IFN-beta induction pathway, and its C-terminal region is critical for the antagonism. Virus Genes 2011, 42, 37–45. [Google Scholar] [CrossRef]
- Cao, L.; Ge, X.; Gao, Y.; Herrler, G.; Ren, Y.; Ren, X.; Li, G. Porcine epidemic diarrhea virus inhibits dsRNA-induced interferon-beta production in porcine intestinal epithelial cells by blockade of the RIG-I-mediated pathway. Virol. J. 2015, 12, 127. [Google Scholar] [CrossRef]
- Ding, Z.; Fang, L.; Jing, H.; Zeng, S.; Wang, D.; Liu, L.; Zhang, H.; Luo, R.; Chen, H.; Xiao, S. Porcine epidemic diarrhea virus nucleocapsid protein antagonizes beta interferon production by sequestering the interaction between IRF3 and TBK1. J. Virol. 2014, 88, 8936–8945. [Google Scholar] [CrossRef] [PubMed]
- Cai, Y.; Yu, S.Q.; Postnikova, E.N.; Mazur, S.; Bernbaum, J.G.; Burk, R.; Zhang, T.; Radoshitzky, S.R.; Muller, M.A.; Jordan, I.; et al. CD26/DPP4 cell-surface expression in bat cells correlates with bat cell susceptibility to Middle East respiratory syndrome coronavirus (MERS-CoV) infection and evolution of persistent infection. PLoS ONE 2014, 9, e112060. [Google Scholar] [CrossRef] [PubMed]
- Ithete, N.L.; Stoffberg, S.; Corman, V.M.; Cottontail, V.M.; Richards, L.R.; Schoeman, M.C.; Drosten, C.; Drexler, J.F.; Preiser, W. Close relative of human Middle East respiratory syndrome coronavirus in bat, South Africa. Emerg. Infect. Dis. 2013, 19, 1697–1699. [Google Scholar] [CrossRef] [PubMed]
- Banerjee, A.; Rapin, N.; Miller, M.; Griebel, P.; Zhou, Y.; Munster, V.; Misra, V. Generation and Characterization of Eptesicus fuscus (Big brown bat) kidney cell lines immortalized using the Myotis polyomavirus large T-antigen. J. Virol. Methods 2016, 237, 166–173. [Google Scholar] [CrossRef] [PubMed]
- Karber, G. Beitrag zur kollektiven Behandlung pharmakologischer Reihenversuche. Naunyn-Schmiedebergs Archiv für experimentelle Pathologie und Pharmakologie 1931, 162, 480–483. [Google Scholar] [CrossRef]
- Spearman, C. The Method of “Right and Wrong Cases” (Constant Stimuli) without Gauss’s Formula. Br. J. Psychol. 1908, 2, 227–242. [Google Scholar]
- Banerjee, A.; Rapin, N.; Bollinger, T.; Misra, V. Lack of inflammatory gene expression in bats: A unique role for a transcription repressor. Sci. Rep. 2017, 7, 2232. [Google Scholar] [CrossRef] [PubMed]
- Lau, S.; Fan, R.Y.Y.; Hayes, L.K.H.; Zhu, L.; Fung, J.; Li, K.S.M.; Wong, E.Y.M.; Ahmed, S.S.; Chan, J.F.W.; Kok, K.H.; et al. Replication of MERS and SARS Coronaviruses in Bat Cells Offers Insights to Their Ancestral Origins. Available online: https://www.biorxiv.org/content/early/2018/05/20/326538 (accessed on 5 December 2018).
- Rapin, N.; Johns, K.; Martin, L.; Warnecke, L.; Turner, J.M.; Bollinger, T.K.; Willis, C.K.; Voyles, J.; Misra, V. Activation of innate immune-response genes in little brown bats (Myotis lucifugus) infected with the fungus Pseudogymnoascus destructans. PLoS ONE 2014, 9, e112285. [Google Scholar] [CrossRef]
- Brinkman, E.K.; Chen, T.; Amendola, M.; van Steensel, B. Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Res. 2014, 42, e168. [Google Scholar] [CrossRef]
- McCloy, R.A.; Rogers, S.; Caldon, C.E.; Lorca, T.; Castro, A.; Burgess, A. Partial inhibition of Cdk1 in G 2 phase overrides the SAC and decouples mitotic events. Cell Cycle 2014, 13, 1400–1412. [Google Scholar] [CrossRef] [Green Version]
- Bergeron, T.; Zhang, R.; Elliot, K.; Rapin, N.; MacDonald, V.; Linn, K.; Simko, E.; Misra, V. The effect of Zhangfei on the unfolded protein response and growth of cells derived from canine and human osteosarcomas. Vet. Comp. Oncol. 2013, 11, 140–150. [Google Scholar] [CrossRef]
- Tamura, K.; Nei, M. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol. Biol. Evol. 1993, 10, 512–526. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [PubMed]
- Lau, S.K.; Lau, C.C.; Chan, K.H.; Li, C.P.; Chen, H.; Jin, D.Y.; Chan, J.F.; Woo, P.C.; Yuen, K.Y. Delayed induction of proinflammatory cytokines and suppression of innate antiviral response by the novel Middle East respiratory syndrome coronavirus: Implications for pathogenesis and treatment. J. Gen. Virol. 2013, 94, 2679–2690. [Google Scholar] [CrossRef] [PubMed]
- Noyce, R.S.; Collins, S.E.; Mossman, K.L. Differential modification of interferon regulatory factor 3 following virus particle entry. J. Virol. 2009, 83, 4013–4022. [Google Scholar] [CrossRef] [PubMed]
- TenOever, B.R.; Sharma, S.; Zou, W.; Sun, Q.; Grandvaux, N.; Julkunen, I.; Hemmi, H.; Yamamoto, M.; Akira, S.; Yeh, W.C.; et al. Activation of TBK1 and IKKvarepsilon kinases by vesicular stomatitis virus infection and the role of viral ribonucleoprotein in the development of interferon antiviral immunity. J. Virol. 2004, 78, 10636–10649. [Google Scholar] [CrossRef] [PubMed]
- Servant, M.J.; ten Oever, B.; LePage, C.; Conti, L.; Gessani, S.; Julkunen, I.; Lin, R.; Hiscott, J. Identification of distinct signaling pathways leading to the phosphorylation of interferon regulatory factor 3. J. Biol. Chem. 2001, 276, 355–363. [Google Scholar] [CrossRef]
- Servant, M.J.; Grandvaux, N.; tenOever, B.R.; Duguay, D.; Lin, R.; Hiscott, J. Identification of the minimal phosphoacceptor site required for in vivo activation of interferon regulatory factor 3 in response to virus and double-stranded RNA. J. Biol. Chem. 2003, 278, 9441–9447. [Google Scholar] [CrossRef]
- Tynell, J.; Westenius, V.; Ronkko, E.; Munster, V.J.; Melen, K.; Osterlund, P.; Julkunen, I. Middle East respiratory syndrome coronavirus shows poor replication but significant induction of antiviral responses in human monocyte-derived macrophages and dendritic cells. J. Gen. Virol. 2016, 97, 344–355. [Google Scholar] [CrossRef]
- Yang, Y.; Du, L.; Liu, C.; Wang, L.; Ma, C.; Tang, J.; Baric, R.S.; Jiang, S.; Li, F. Receptor usage and cell entry of bat coronavirus HKU4 provide insight into bat-to-human transmission of MERS coronavirus. Proc. Natl. Acad. Sci. USA 2014, 111, 12516–12521. [Google Scholar] [CrossRef] [Green Version]
- Widagdo, W.; Begeman, L.; Schipper, D.; Run, P.R.V.; Cunningham, A.A.; Kley, N.; Reusken, C.B.; Haagmans, B.L.; van den Brand, J.M.A. Tissue Distribution of the MERS-Coronavirus Receptor in Bats. Sci. Rep. 2017, 7, 1193. [Google Scholar] [CrossRef] [PubMed]
- Letko, M.; Miazgowicz, K.; McMinn, R.; Seifert, S.N.; Sola, I.; Enjuanes, L.; Carmody, A.; van Doremalen, N.; Munster, V. Adaptive Evolution of MERS-CoV to Species Variation in DPP4. Cell Rep. 2018, 24, 1730–1737. [Google Scholar] [CrossRef] [PubMed]
- DeDiego, M.L.; Nieto-Torres, J.L.; Jimenez-Guardeno, J.M.; Regla-Nava, J.A.; Castano-Rodriguez, C.; Fernandez-Delgado, R.; Usera, F.; Enjuanes, L. Coronavirus virulence genes with main focus on SARS-CoV envelope gene. Virus Res. 2014, 194, 124–137. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gu, J.; Korteweg, C. Pathology and pathogenesis of severe acute respiratory syndrome. Am. J. Pathol. 2007, 170, 1136–1147. [Google Scholar] [CrossRef] [PubMed]
- Collins, S.E.; Mossman, K.L. Danger, diversity and priming in innate antiviral immunity. Cytokine Growth Factor Rev. 2014, 25, 525–531. [Google Scholar] [CrossRef] [PubMed]
- Zhou, P.; Tachedjian, M.; Wynne, J.W.; Boyd, V.; Cui, J.; Smith, I.; Cowled, C.; Ng, J.H.; Mok, L.; Michalski, W.P.; et al. Contraction of the type I IFN locus and unusual constitutive expression of IFN-alpha in bats. Proc. Natl. Acad. Sci. USA 2016, 113, 2696–2701. [Google Scholar] [CrossRef] [PubMed]
- Omatsu, T.; Bak, E.J.; Ishii, Y.; Kyuwa, S.; Tohya, Y.; Akashi, H.; Yoshikawa, Y. Induction and sequencing of Rousette bat interferon alpha and beta genes. Vet. Immunol. Immunopathol. 2008, 124, 169–176. [Google Scholar] [CrossRef] [PubMed]
- Virtue, E.R.; Marsh, G.A.; Baker, M.L.; Wang, L.F. Interferon production and signaling pathways are antagonized during henipavirus infection of fruit bat cell lines. PLoS ONE 2011, 6, e22488. [Google Scholar] [CrossRef]
- Biesold, S.E.; Ritz, D.; Gloza-Rausch, F.; Wollny, R.; Drexler, J.F.; Corman, V.M.; Kalko, E.K.; Oppong, S.; Drosten, C.; Muller, M.A. Type I interferon reaction to viral infection in interferon-competent, immortalized cell lines from the African fruit bat Eidolon helvum. PLoS ONE 2011, 6, e28131. [Google Scholar] [CrossRef]
- Falzarano, D.; Kamissoko, B.; de Wit, E.; Maiga, O.; Cronin, J.; Samake, K.; Traore, A.; Milne-Price, S.; Munster, V.J.; Sogoba, N.; et al. Dromedary camels in northern Mali have high seropositivity to MERS-CoV. One Health 2017, 3, 41–43. [Google Scholar] [CrossRef]
- Subudhi, S.; Rapin, N.; Bollinger, T.K.; Hill, J.E.; Donaldson, M.E.; Davy, C.M.; Warnecke, L.; Turner, J.M.; Kyle, C.J.; Willis, C.K.R.; et al. A persistently infecting coronavirus in hibernating Myotis lucifugus, the North American little brown bat. J. Gen. Virol. 2017, 98, 2297–2309. [Google Scholar] [CrossRef] [PubMed]
- Kennedy, M.A.; Moore, E.; Wilkes, R.P.; Citino, S.B.; Kania, S.A. Analysis of genetic mutations in the 7a7b open reading frame of coronavirus of cheetahs (Acinonyx jubatus). Am. J. Vet. Res. 2006, 67, 627–632. [Google Scholar] [CrossRef] [PubMed]
- Kipar, A.; Meli, M.L.; Baptiste, K.E.; Bowker, L.J.; Lutz, H. Sites of feline coronavirus persistence in healthy cats. J. Gen. Virol. 2010, 91, 1698–1707. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Saitoh, T.; Tun-Kyi, A.; Ryo, A.; Yamamoto, M.; Finn, G.; Fujita, T.; Akira, S.; Yamamoto, N.; Lu, K.P.; Yamaoka, S. Negative regulation of interferon-regulatory factor 3-dependent innate antiviral response by the prolyl isomerase Pin1. Nat. Immunol. 2006, 7, 598–605. [Google Scholar] [CrossRef] [PubMed]
- DeWitte-Orr, S.J.; Mehta, D.R.; Collins, S.E.; Suthar, M.S.; Gale, M., Jr.; Mossman, K.L. Long double-stranded RNA induces an antiviral response independent of IFN regulatory factor 3, IFN-beta promoter stimulator 1, and IFN. J. Immunol. 2009, 183, 6545–6553. [Google Scholar] [CrossRef] [PubMed]
- De La Cruz-Rivera, P.C.; Kanchwala, M.; Liang, H.; Kumar, A.; Wang, L.F.; Xing, C.; Schoggins, J.W. The IFN Response in Bats Displays Distinctive IFN-Stimulated Gene Expression Kinetics with Atypical RNASEL Induction. J. Immunol. 2017. [Google Scholar] [CrossRef] [PubMed]
- Banerjee, A.; Misra, V.; Schountz, T.; Baker, M.L. Tools to study pathogen-host interactions in bats. Virus Res. 2018, 248, 5–12. [Google Scholar] [CrossRef]
Name | Sequence-human (5′-3′) | Sequence-E. fuscus (5′-3′) | Feature |
---|---|---|---|
IFNβ | GCTTGGATTCCTACAAAGAAGCA | GCTCCGATTCCGACAGAGAAGCA | Forward primer |
ATAGATGGTCAATGCGGCGTC | ATGCATGACCACCATGGCTTC | Reverse primer | |
GAPDH | GGAGCGAGATCCCTCCAAAAT | GGAGCGAGATCCCGCCAACAT | Forward primer |
GGCTGTTGTCATACTTCTCATGG | GGGAGTTGTCATACTTGTCATGG | Reverse primer | |
TNF | CAGCCTCTTCTCCTTCCTGA | GCCCATGTTGTAGCAAACC | Forward primer |
AGATGATCTGACTGCCTGGG | GCCCTTGAAGAGGACCTGGG | Reverse primer | |
OAS1 | AGTTGACTGGCGGCTATAAAC | AGGTGACGGACGACTACAGAC | Forward primer |
GTGCTTGACTAGGCGGATGAG | GTGCTTGACCAGGCGGATGAG | Reverse primer | |
DPP4 | TGACATGGGCAACACAAGA | TGATCTTGCCTCCTCATTTTGATAA | Forward primer |
AACCCAGCCAGTAGTACTC | GTAACCACTTCCTCTGCCATCAA | Reverse primer | |
siIRF3-1 (Duplex) | 5′ rGrUrGrGrArGrGrCrArGrUrArCrUrUrCrUrGrArUrArCrCCA 3′ | 5′ rCrArArGrArArGrCrUrArGrUrGrArUrGrGrUrCrArArGrGTT 3′ | r=Ribose sugar |
5′ rUrGrGrGrUrArUrCrArGrArArGrUrArCrUrGrCrCrUrCrCrArCrCrA 3′ | 5′ rArArCrCrUrUrGrArCrCrArUrCrArCrUrArGrCrUrUrCrUrUrGrGrU 3′ | r=Ribose sugar | |
siIRF3-2 (Duplex) | 5′ rArCrUrGrUrGrGrArCrCrUrGrCrArCrArUrUrUrCrCrArACA 3′ | 5′ rCrUrGrCrCrArArCrCrUrGrGrArArGrArGrGrArArUrUrUCA 3′ | r=Ribose sugar |
5′ rUrGrUrUrGrGrArArArUrGrUrGrCrArGrGrUrCrCrArCrArGrUrArU 3′ | 5′ rUrGrArArArUrUrCrCrUrCrUrUrCrCrArGrGrUrUrGrGrCrArGrGrU 3′ | r=Ribose sugar |
Species Name | Accession Number |
---|---|
Aotus nancymaae | XM_012460874 |
Callithrix jacchus | XM_002762377 |
Camelus dromedarius | XM_010993178 |
Castor Canadensis | XM_020159968 |
Cercocebus atys | NM_001305969 XM_012080898 |
Chlorocebus sabeaus | XM_007997589 |
Colobus angolensis palliatus | XM_011946361 |
Eptesicus fuscus | XM_008154348 |
Felis catus | XM_003997503 |
Galeopterus variegatus | XM_008575391 |
Gorilla gorilla | XM_019015447 |
Homo sapiens | NM_001571 |
Macaca mulatta | NM_001135797 XM_001115379 |
Miniopterus natalensis | XM_016206049 |
Mus musculus | NM_016849 |
Myotis brandtii | XM_014550465 |
Myotis davidii | KU161111 |
Myotis lucifugus | XM_014449832 |
Pan paniscus | XM_003814337 |
Pan troglodytes | XM_016936566 |
Panthera tigris altaica | XM_007074177 |
Papio anubis | XM_009194993 |
Propithecus coquereli | XM_012643169 |
Pteropus alecto | XM_006905022 |
Pteropus vampyrus | XM_011374528 |
Rhinolophus sinicus | XM_019741528 |
Rhinopithecus bieti | XM_017882166 |
Rhinopithecus roxellana | XM_010369491 |
Rousettus aegyptiacus | XM_016122379 |
Sus scrofa | NM_213770 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Banerjee, A.; Falzarano, D.; Rapin, N.; Lew, J.; Misra, V. Interferon Regulatory Factor 3-Mediated Signaling Limits Middle-East Respiratory Syndrome (MERS) Coronavirus Propagation in Cells from an Insectivorous Bat. Viruses 2019, 11, 152. https://doi.org/10.3390/v11020152
Banerjee A, Falzarano D, Rapin N, Lew J, Misra V. Interferon Regulatory Factor 3-Mediated Signaling Limits Middle-East Respiratory Syndrome (MERS) Coronavirus Propagation in Cells from an Insectivorous Bat. Viruses. 2019; 11(2):152. https://doi.org/10.3390/v11020152
Chicago/Turabian StyleBanerjee, Arinjay, Darryl Falzarano, Noreen Rapin, Jocelyne Lew, and Vikram Misra. 2019. "Interferon Regulatory Factor 3-Mediated Signaling Limits Middle-East Respiratory Syndrome (MERS) Coronavirus Propagation in Cells from an Insectivorous Bat" Viruses 11, no. 2: 152. https://doi.org/10.3390/v11020152