Prevalence and Correlates of Pre-Treatment HIV Drug Resistance among HIV-Infected Children in Ethiopia
Abstract
:1. Introduction
2. Materials and Methods
2.1. Study Participants
2.2. Ethics Statement
2.3. Specimen Collection, Handling and Storage
2.4. HIV Drug Resistance Genotyping and Phylogenetic Inference
2.5. Drug Resistance Genotype Interpretation
2.6. Statistical Analysis
3. Results
3.1. Patient Characteristics
3.2. Prevalence of PDR and Detected Drug Resistance Mutation Types
3.3. Correlates of PDR in Ethiopian Children
4. Discussion
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Michaels, S.H.; Clark, R.; Kissinger, P. Declining morbidity and mortality among patients with advanced human immunodeficiency virus infection. N. Engl. J. Med. 1998, 339, 405–406. [Google Scholar] [CrossRef] [PubMed]
- Weverling, G.J.; Mocroft, A.; Ledergerber, B.; Kirk, O.; Gonzales-Lahoz, J.; d’Arminio Monforte, A.; Proenca, R.; Phillips, A.N.; Lundgren, J.D.; Reiss, P. Discontinuation of Pneumocystis carinii pneumonia prophylaxis after start of highly active antiretroviral therapy in HIV-1 infection. EuroSIDA Study Group. Lancet 1999, 353, 1293–1298. [Google Scholar] [CrossRef]
- Hogg, R.S.; Heath, K.V.; Yip, B.; Craib, K.J.; O’Shaughnessy, M.V.; Schechter, M.T.; Montaner, J.S. Improved survival among HIV-infected individuals following initiation of antiretroviral therapy. JAMA 1998, 279, 450–454. [Google Scholar] [CrossRef] [PubMed]
- UNAIDS. 90-90-90 Targets. 2017. Available online: https://www.unaids.org/en/resources/documents/2017/90-90-90 (accessed on 1 June 2019).
- Granich, R.M.; Gilks, C.F.; Dye, C.; De Cock, K.M.; Williams, B.G. Universal voluntary HIV testing with immediate antiretroviral therapy as a strategy for elimination of HIV transmission: A mathematical model. Lancet 2009, 373, 48–57. [Google Scholar] [CrossRef]
- UNAIDS. UNAIDS Data 2018. Available online: https://www.unaids.org/sites/default/files/media_asset/unaids-data-2018_en.pdf (accessed on 21 June 2019).
- Davies, M.A.; Pinto, J. Targeting 90-90-90-don’t leave children and adolescents behind. J. Int. AIDS Soc. 2015, 18, 20745. [Google Scholar] [CrossRef] [PubMed]
- Louis, F.J.; Segaren, N.; Desinor, O.; Beard, R.S.; Jean-Louis, R.; Chang, J.; Boisson, S.; Hulland, E.N.; Wagar, N.; DeVos, J.; et al. High Levels of HIV-1 Drug Resistance in Children Who Acquired HIV Infection Through Mother to Child Transmission in the Era of Option B+, Haiti, 2013 to 2014. Pediatric Infect. Dis. J. 2019, 38, 503–507. [Google Scholar] [CrossRef] [PubMed]
- Inzaule, S.C.; Hamers, R.L.; Calis, J.; Boerma, R.; Sigaloff, K.; Zeh, C.; Mugyenyi, P.; Akanmu, S.; Rinke de Wit, T.F. When prevention of mother-to-child HIV transmission fails: Preventing pretreatment drug resistance in African children. AIDS 2018, 32, 143–147. [Google Scholar] [CrossRef]
- African Health Observatory: Analytical Summary—HIV/AIDS. Available online: http://www.aho.afro.who.int/profiles_information/index.php/Ethiopia:Analytical_summary_-_HIV/AIDS (accessed on 2 September 2019).
- Avert. Global Information and Education on HIV and AIDS: Prevention of Mother-to-Child Transmission (PMTCT) of HIV. 2019. Available online: https://www.avert.org/professionals/hiv-programming/prevention/prevention-mother-child (accessed on 20 June 2019).
- FMOH. National Guidelines for Comprehensive HIV Prevention, Care and Treatment. 2017. Available online: https://www.medbox.org/ethiopia-national-guidelines-for-comprehensive-hiv-prevention-care-and-treatment-1/download.pdf (accessed on 20 June 2019).
- Hamers, R.L.; Rinke de Wit, T.F.; Holmes, C.B. HIV drug resistance in low-income and middle-income countries. Lancet HIV 2018, 5, e588–e596. [Google Scholar] [CrossRef]
- Tadesse, B.T.; Foster, B.A.; Chala, A.; Chaka, T.E.; Bizuayehu, T.; Ayalew, F.; H/Meskel, G.; Tadesse, S.; Jerene, D.; Makonnen, E.; et al. HIV and cART-Associated Dyslipidemia Among HIV-Infected Children. J. Clin. Med. 2019, 8, 430. [Google Scholar] [CrossRef]
- UNAIDS. Ethiopia: Country Factsheets. 2017. Available online: https://www.unaids.org/en/regionscountries/countries/ethiopia (accessed on 20 June 2019).
- Ministry of Health of Federal Democratic Republic of Ethiopia. National Strategic Plan for Elimination of Mother to Child Transmission of HIV (e-MTCT of HIV) 2013–2015; Ministry of Health of Federal Democratic Republic of Ethiopia: Addis Ababa, Ethiopia, 2013.
- Federal Democratic Republic of Ethiopia HIV Prevention and Control Office. Country Progress Report on the HIV Response; Federal Democratic Republic of Ethiopia HIV Prevention and Control Office: Addis Ababa, Ethiopia, 2014.
- Buckton, A.J.; Prabhu, D.P.; Cane, P.A.; Pillay, D. No evidence for cross-contamination of dried blood spots excised using an office hole-punch for HIV-1 drug resistance genotyping. J. Antimicrob. Chemother. 2009, 63, 615–616. [Google Scholar] [CrossRef] [Green Version]
- Tadesse, B.T.; Kinloch, N.N.; Baraki, B.; Lapointe, H.R.; Cobarrubias, K.D.; Brockman, M.A.; Brumme, C.J.; Foster, B.A.; Jerene, D.; Makonnen, E.; et al. High Levels of Dual-Class Drug Resistance in HIV-Infected Children Failing First-Line Antiretroviral Therapy in Southern Ethiopia. Viruses 2018, 10, 60. [Google Scholar] [CrossRef] [PubMed]
- Woods, C.K.; Brumme, C.J.; Liu, T.F.; Chui, C.K.; Chu, A.L.; Wynhoven, B.; Hall, T.A.; Trevino, C.; Shafer, R.W.; Harrigan, P.R. Automating HIV drug resistance genotyping with RECall, a freely accessible sequence analysis tool. J. Clin. Microbiol. 2012, 50, 1936–1942. [Google Scholar] [CrossRef] [PubMed]
- Gaschen, B.; Kuiken, C.; Korber, B.; Foley, B. Retrieval and on-the-fly alignment of sequence fragments from the HIV database. Bioinformatics 2001, 17, 415–418. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Larsson, A. AliView: A fast and lightweight alignment viewer and editor for large datasets. Bioinformatics 2014, 30, 3276–3278. [Google Scholar] [CrossRef] [PubMed]
- Guindon, S.; Dufayard, J.F.; Lefort, V.; Anisimova, M.; Hordijk, W.; Gascuel, O. New algorithms and methods to estimate maximum-likelihood phylogenies: Assessing the performance of PhyML 3.0. Syst. Biol. 2010, 59, 307–321. [Google Scholar] [CrossRef] [PubMed]
- Bennett, D.E.; Camacho, R.J.; Otelea, D.; Kuritzkes, D.R.; Fleury, H.; Kiuchi, M.; Heneine, W.; Kantor, R.; Jordan, M.R.; Schapiro, J.M.; et al. Drug resistance mutations for surveillance of transmitted HIV-1 drug-resistance: 2009 update. PLoS ONE 2009, 4, e4724. [Google Scholar] [CrossRef] [PubMed]
- Shafer, R.W.; Rhee, S.Y.; Pillay, D.; Miller, V.; Sandstrom, P.; Schapiro, J.M.; Kuritzkes, D.R.; Bennett, D. HIV-1 protease and reverse transcriptase mutations for drug resistance surveillance. AIDS 2007, 21, 215–223. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Siepel, A.C.; Halpern, A.L.; Macken, C.; Korber, B.T. A computer program designed to screen rapidly for HIV type 1 intersubtype recombinant sequences. AIDS Res. Hum. Retrovir. 1995, 11, 1413–1416. [Google Scholar] [CrossRef] [PubMed]
- Gifford, R.J.; Liu, T.F.; Rhee, S.Y.; Kiuchi, M.; Hue, S.; Pillay, D.; Shafer, R.W. The calibrated population resistance tool: Standardized genotypic estimation of transmitted HIV-1 drug resistance. Bioinformatics 2009, 25, 1197–1198. [Google Scholar] [CrossRef]
- Rhee, S.Y.; Gonzales, M.J.; Kantor, R.; Betts, B.J.; Ravela, J.; Shafer, R.W. Human immunodeficiency virus reverse transcriptase and protease sequence database. Nucleic Acids Res. 2003, 31, 298–303. [Google Scholar] [CrossRef] [Green Version]
- Shafer, R.W. Rationale and uses of a public HIV drug-resistance database. J. Infect. Dis. 2006, 194 (Suppl. 1), S51–S58. [Google Scholar] [CrossRef] [PubMed]
- Calcagno, A.; Motta, I.; Milia, M.G.; Rostagno, R.; Simiele, M.; Libanore, V.; Fontana, S.; D’Avolio, A.; Ghisetti, V.; Di Perri, G.; et al. Dried plasma/blood spots for monitoring antiretroviral treatment efficacy and pharmacokinetics: A cross-sectional study in rural Burundi. Br. J. Clin. Pharm. 2015, 79, 801–808. [Google Scholar] [CrossRef] [PubMed]
- Garrido, C.; Zahonero, N.; Fernandes, D.; Serrano, D.; Silva, A.R.; Ferraria, N.; Antunes, F.; Gonzalez-Lahoz, J.; Soriano, V.; de Mendoza, C. Subtype variability, virological response and drug resistance assessed on dried blood spots collected from HIV patients on antiretroviral therapy in Angola. J. Antimicrob. Chemother. 2008, 61, 694–698. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rodriguez-Auad, J.P.; Rojas-Montes, O.; Maldonado-Rodriguez, A.; Alvarez-Muñoz, M.T.; Muñoz, O.; Torres-Ibarra, R.; Vazquez-Rosales, G.; Lira, R. Use of Dried Plasma Spots for HIV-1 Viral Load Determination and Drug Resistance Genotyping in Mexican Patients. BioMed Res. Int. 2015, 2015, 240407. [Google Scholar] [CrossRef] [PubMed]
- Delatorre, E.O.; Bello, G. Phylodynamics of HIV-1 subtype C epidemic in east Africa. PLoS ONE 2012, 7, e41904. [Google Scholar] [CrossRef] [PubMed]
- Hemelaar, J.; Gouws, E.; Ghys, P.D.; Osmanov, S. WHO-UNAIDS Network for HIV Isolation and Characterisation. Global trends in molecular epidemiology of HIV-1 during 2000–2007. AIDS 2011, 25, 679–689. [Google Scholar] [CrossRef]
- Kalu, A.W.; Telele, N.F.; Gebreselasie, S.; Fekade, D.; Abdurahman, S.; Marrone, G.; Sonnerborg, A. Monophylogenetic HIV-1C epidemic in Ethiopia is dominated by CCR5-tropic viruses-an analysis of a prospective country-wide cohort. BMC Infect. Dis. 2017, 17, 37. [Google Scholar] [CrossRef]
- Kassu, A.; Fujino, M.; Matsuda, M.; Nishizawa, M.; Ota, F.; Sugiura, W. Molecular epidemiology of HIV type 1 in treatment-naive patients in north Ethiopia. AIDS Res. Hum. Retrovir. 2007, 23, 564–568. [Google Scholar] [CrossRef]
- Mulu, A.; Lange, T.; Liebert, U.G.; Maier, M. Clade homogeneity and Pol gene polymorphisms in chronically HIV-1 infected antiretroviral treatment naive patients after the roll out of ART in Ethiopia. BMC Infect. Dis. 2014, 14, 158. [Google Scholar] [CrossRef]
- Tully, D.C.; Wood, C. Chronology and evolution of the HIV-1 subtype C epidemic in Ethiopia. AIDS 2010, 24, 1577–1582. [Google Scholar] [CrossRef]
- Boerma, R.S.; Sigaloff, K.C.; Akanmu, A.S.; Inzaule, S.; Boele van Hensbroek, M.; Rinke de Wit, T.F.; Calis, J.C. Alarming increase in pretreatment HIV drug resistance in children living in sub-Saharan Africa: A systematic review and meta-analysis. J. Antimicrob. Chemother. 2017, 72, 365–371. [Google Scholar] [CrossRef] [PubMed]
- Ngo-Giang-Huong, N.; Huynh, T.H.K.; Dagnra, A.Y.; Toni, T.D.; Maiga, A.I.; Kania, D.; Eymard-Duvernay, S.; Peeters, M.; Soulie, C.; Peytavin, G.; et al. Prevalence of pretreatment HIV drug resistance in West African and Southeast Asian countries. J. Antimicrob. Chemother. 2019, 74, 462–467. [Google Scholar] [CrossRef] [PubMed]
- Jordan, M.R.; Penazzato, M.; Cournil, A.; Vubil, A.; Jani, I.; Hunt, G.; Carmona, S.; Maphalala, G.; Mthethwa, N.; Watera, C.; et al. Human Immunodeficiency Virus (HIV) Drug Resistance in African Infants and Young Children Newly Diagnosed With HIV: A Multicountry Analysis. Clin. Infect. Dis. 2017, 65, 2018–2025. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Telele, N.F.; Kalu, A.W.; Gebre-Selassie, S.; Fekade, D.; Abdurahman, S.; Marrone, G.; Neogi, U.; Tegbaru, B.; Sonnerborg, A. Pretreatment drug resistance in a large countrywide Ethiopian HIV-1C cohort: A comparison of Sanger and high-throughput sequencing. Sci. Rep. 2018, 8, 7556. [Google Scholar] [CrossRef] [PubMed]
- WHO. HIV Drug Resistance Report 2017. Available online: https://apps.who.int/iris/bitstream/handle/10665/255896/9789241512831-eng.pdf (accessed on 7 July 2019).
- Firdu, N.; Enquselassie, F.; Jerene, D. HIV-infected adolescents have low adherence to antiretroviral therapy: A cross-sectional study in Addis Ababa, Ethiopia. Pan Afr. Med. J. 2017, 27, 80. [Google Scholar] [CrossRef] [PubMed]
- Chimukangara, B.; Lessells, R.J.; Rhee, S.Y.; Giandhari, J.; Kharsany, A.B.M.; Naidoo, K.; Lewis, L.; Cawood, C.; Khanyile, D.; Ayalew, K.A.; et al. Trends in Pretreatment HIV-1 Drug Resistance in Antiretroviral Therapy-naive Adults in South Africa, 2000–2016: A Pooled Sequence Analysis. EClinicalMedicine 2019, 9, 26–34. [Google Scholar] [CrossRef]
- Ngo-Giang-Huong, N.; Aghokeng, A.F. HIV Drug Resistance in Resource-limited Countries: Threat for HIV Elimination. EClinicalMedicine 2019, 9, 3–4. [Google Scholar] [CrossRef] [PubMed]
- WHO. Guidelines on the Public Health Response to Pretreatment HIV Drug Resistance. 2017. Available online: https://apps.who.int/iris/bitstream/handle/10665/255880/9789241550055-eng.pdf (accessed on 7 July 2019).
- World Health Organization (WHO). Consolidated Guidelines on the Use of Antiretroviral Drugs for Treating and Preventing HIV Infection: Recommendations for a Public Health Approach; World Health Organization: Geneva, Switzerland, 2013. [Google Scholar]
- Ministry of Health Federal Democratic Republic of Ethiopia. National Guidelines for Comprehensive HIV Prevention, Care and Treatment; Ethiopian Ministry of Health: Addis Ababa, Ethiopia, 2014.
- Ministry of Health Federal Democratic Republic of Ethiopia. Continuum of HIV Services Refers to a Comprehensive Package of HIV Prevention, Diagnostic, Treatment, Care and Support Services Provided for People at Risk of HIV Infection or Living with HIV and Their Families; Ethiopian Ministry of Health: Addis Ababa, Ethiopia, 2018.
Primer Set | First Round | Second Round | |||
---|---|---|---|---|---|
HXB2 Coordinates (Start/End) | Sequence (5′→3′) | HXB2 Coordinates (Start/End) | Sequence (5′→3′) | ||
1 * | F | 1979/2005 | AAGAAGGGCACMTAGCCARAAAYTGYA | 2011/2039 | CCTAGGAAAAARGGCTGTTGGAARTGTGG |
R | 3333/3301 | CCACTAACTTCTGTATGTCATTGACAGTCCAGC | 3280/3255 | ATAGGCTGTACTGTCCATTTATCAGG | |
2 | F | 2008/2031 | GCCCCTAGGAAAAAGGGCTGTTGG | 2011/2039 | CCTAGGAAAAARGGCTGTTGGAARTGTGG |
R | 3361/3342 | TAAATCTGACTTGCCCART | 3323/3303 | CTGTATRTCATTRACWGTCCA | |
3 | F | 1979/2005 | AAGAAGGGCACMTAGCCARAAAYTGYA | 2011/2039 | CCTAGGAAAAARGGCTGTTGGAARTGTGG |
R | 3859/3831 | GCTCCTACTATGGGTTCTTTYTCYARYTG | 3798/3777 | CAAACTCCCAYTCAGGRATCCA | |
4 | F | 1992/2015 | AGCCAGAAATTGCAGGGCCCCTAG | 2074/2095 | AGACAGGCTAATTTTTTAGGGA |
R | 3322/3303 | TGTATRTCATTGACAGTCCA | 3271/3252 | ACTGTCCATTTRTCAGGATG |
Variable | Summary Statistic | Total N |
---|---|---|
Age in years, median (IQR) | 9.0 (5.0–12.0) | 93 |
Male, N (%) | 48 (51.6) | 93 |
Symptoms at diagnosis, Yes N (%) | 56 (65.9) | 85 |
CD4 count, median (IQR) cells/mm3 | 319 (141–615) | 41 |
Plasma viral load in log10 copies/mL of, median (IQR) | 4.3 (3.7–4.9) | 83 |
Weight for age Z-score, Median (IQR), Z-score | −1.2 (−2.7–(−0.7)) | 53 * |
Height for age Z-score, Median (IQR) | −1.6 (−2.6–(−0.7)) | 82 |
Body mass index Z-score, Median (IQR) | −1.1 (−2.2–(−0.1)) | 82 |
Sample ID | Dried Spot Type | NRTI Mutations | NNRTI Mutations |
---|---|---|---|
EPDOS_6 | Plasma | None | G190G/A |
EPDOS_8 | Plasma | None | K103S, G190A |
EPDOS_9 | Plasma | None | K103N |
EPDOS_22 | Plasma | None | G190G/A |
EPDOS_29 | Plasma | None | Y181C |
EPDOS_37 | Blood | K219N | Y181C |
EPDOS_39 | Blood | M184I | Y188L |
EPDOS_53 | Blood | M184V, L210W, T215Y | Y181C |
Variable | Number Missing | Any Resistance | p Value | |
---|---|---|---|---|
Yes (N = 8) | No (N = 49) | |||
Age in years, median (IQR) | 0 | 5 (0.3–10) | 8 (5–12) | 0.06 |
Sex (% Male) | 0 | 4 (57.1) | 24 (51.1) | 0.54 |
WAZ, median (IQR) | 23 | −1.6 (−2.8–(−0.9)) | −1.9 (−2.9–(−0.9)) | 0.91 |
HAZ, median (IQR) | 7 | −1.8 (−1.9–(−0.7)) | −1.6 (−3.0–(−0.7)) | 0.62 |
BAZ, median (IQR) | 7 | −1.4 (−2.2–(−1.3)) | −1.2 (−2.2–(−0.5)) | 0.41 |
CD4, median (IQR), cells/mm3 | 33 | 267 (217–317) | 370 (161–788) | 0.53 |
Log10 pVL, median (IQR) copies/mL | 6 | 4.3 (4.1–4.8) | 4.2 (3.8–5.0) | 0.47 |
WHO clinical stage, N (%) 1 2 3 4 | 4 | 1 (25) 2 (25.0) 4 (50) 0 (0) | 15 (30.6) 10 (20.4) 19 (38.8) 2 (4.1) | 0.71 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tadesse, B.T.; Tsai, O.; Chala, A.; Chaka, T.E.; Eromo, T.; Lapointe, H.R.; Baraki, B.; Shahid, A.; Tadesse, S.; Makonnen, E.; et al. Prevalence and Correlates of Pre-Treatment HIV Drug Resistance among HIV-Infected Children in Ethiopia. Viruses 2019, 11, 877. https://doi.org/10.3390/v11090877
Tadesse BT, Tsai O, Chala A, Chaka TE, Eromo T, Lapointe HR, Baraki B, Shahid A, Tadesse S, Makonnen E, et al. Prevalence and Correlates of Pre-Treatment HIV Drug Resistance among HIV-Infected Children in Ethiopia. Viruses. 2019; 11(9):877. https://doi.org/10.3390/v11090877
Chicago/Turabian StyleTadesse, Birkneh Tilahun, Olivia Tsai, Adugna Chala, Tolossa Eticha Chaka, Temesgen Eromo, Hope R. Lapointe, Bemuluyigza Baraki, Aniqa Shahid, Sintayehu Tadesse, Eyasu Makonnen, and et al. 2019. "Prevalence and Correlates of Pre-Treatment HIV Drug Resistance among HIV-Infected Children in Ethiopia" Viruses 11, no. 9: 877. https://doi.org/10.3390/v11090877