1. Introduction
Eradication of the human immunodeficiency virus (HIV) remains a challenge despite the introduction of combination anti-retroviral therapy (cART) that suppresses viral load to undetectable levels but does not eliminate viral reservoirs [
1]. Interruption of the cART regimen, which is common among HIV-1+ patients, especially in resource-poor countries, results in the HIV-1 rebound and the appearance of a mutated viral species resistant to antiviral drugs [
2]. In addition, chronic long-term HIV-1 infection leads to cardiovascular and neurological diseases, metabolic syndrome and non-infectious respiratory disease, which summarily contribute to HIV-1 morbidity and mortality [
3,
4,
5]. As cART does not affect HIV-1 transcription, small molecules are needed to block HIV-1 transcription in order to prevent HIV-1 provirus activation and eliminate HIV-1-related chronic comorbidities. HIV-1 transcription is activated by the HIV-1 Tat protein that interacts with the HIV-1 transactivation response (TAR) RNA and recruits host CDK9/cyclin T1 and other factors to induce the elongation of HIV-1 transcription and facilitate full-length transcript production [
6]. In the absence of the Tat protein, HIV-1 transcription is terminated after the synthesis of 82 nucleotide long TAR RNA [
7,
8]. HIV-1 TAR RNA has been thought as a target for small molecule inhibitors, as it stands out as a unique HIV-1 target. Computation screening of close to 200,000 compounds identified acetylpromazine that was shown to bind the bulge of TAR RNA [
9], overlapping with the binding of the Tat protein that specifically interacts with the bulge [
10,
11]. A more recent study that utilized a virtual screening based on “scaffold-hopping” with several potential TAR RNA binding scaffolds including acetylpromazine, identified molecules that disrupted Tat–TAR RNA interaction with mid–micro molar IC
50 [
12]. Here, we utilized the existing NMR structure of TAR RNA with the bound acetylpromazine to screen in silico compounds from the Enamine database. Docking identified 173 compounds that were further tested for the inhibition of HIV-1 replication in CEM T cells infected with VSVG-pseudotyped HIV-1. This allowed narrowing down of the candidate list to three compounds that were analyzed for their effect on Tat-induced and basal HIV-1 transcription and disruption of the Tat/TAR RNA and Tat/CDK9/cyclin T1 complexes. Taken together, our study identified a novel compound that may serve as a new lead for anti-HIV-1 therapeutics.
2. Materials and Methods
2.1. Materials
293T and CEM T cells were purchased from ATCC (Manassas, VA). Protein A/G agarose beads, anti-cyclin T1 rabbit monoclonal antibody, anti-CDK9 rabbit monoclonal antibody were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-FLAG mouse monoclonal antibody was purchased from Sigma (St. Louis, MO, USA). Supplemented DMEM and RPMI media were purchased from Invitrogen. Biotinylated WT TAR RNA (59 nucleotides long) and mutant delta TAR RNA (48 nucleotides long) were synthesized by Integrated DNA Technologies (Coralville, IL, USA). Unless indicated, all other chemicals and enzymes were obtained from Sigma-Aldrich (St. Louis, MO, USA). Small molecules were synthesized by Enamine (Ukraine).
2.2. Viruses and Plasmids
HIV-1 proviral DNA, pNL4-3.Luc.R-E containing two nonsense frame shifts in the
env and
vpr genes with Luciferase reporter gene cloned in place of
nef was obtained from NIH AIDS Reagent Program (Germantown, MD). VSVG pseudotyped HIV-1 expressing luciferase virus (HIV-1-LUC-G) was generated using pNL4A3.Luc.R.E and VSVG-expressing plasmid, pHEF-VSVG, obtained from NIH AIDS Reagent Program (Germantown, MD). Flag-Tat-expressing vector was previously described [
13]. HIV-1 LTR-luciferase vector was kindly provided by Dr. Manuel López-Cabrera (Unidad de Biología Molecular, Madrid, Spain).
2.3. Molecular Docking
Virtual screening using docking technique of Enamine stock database was conducted with QXP program, which showed excellent results to reproduce experimental docking positions on targets with diverse binding sites. The structure of HIV-1 TAR with bound acetylpromazine (PDB ID: 1LJV,
Figure 1A) was used in this study [
9]. The binding site was defined and, consequently, grid was generated using residues within 10 Å from the bound ligand. A systematic docking routine sdock+ was employed to generate 300 positions per ligand and top 10 scored positions were saved. The post docking filtering was performed using multiRmsd, which allows performing hypothesis driven selection of putative complexes from QXP docking results.
2.4. HIV-1 Infection
HIV-1-LUC-G was utilized to infect leukemic lymphoid CEM T cells. CEM T cells were grown in RPMI medium (Invitrogen) supplemented with 10% Fetal Bovine Serum (FBS) and 1% antibiotic solution (penicillin and streptomycin) at 37 °C in humidified incubator with 5% CO2. CEM T cells were infected by HIV-1-LUC-G at a multiplicity of infection (MOI) 0.01, cultured at 1 × 106 cells/mL in 6-well plates at 37 °C and 5% CO2 for 24 h and then treated with different concentrations of indicated compounds. For infection with T-tropic HIV-1 IIIB, CEM T cells were infected at a MOI = 0.01. Cells were collected after 6 h post infection for non-integrated HIV-1 DNA isolation and 4 days post infection for p24 and viral RNA analysis.
Peripheral blood mononuclear cells (PBMCs) were activated prior to HIV-1 infection with phytohemagglutinin (PHA) (0.5 μg/mL) for 24 h in complete RMPI media followed by interleukin (IL)-2 (10 U/mL) for 24 h. PBMCs were infected with HIV-1 IIIB (MOI = 0.01). Media and the cells were collected 4 days post infection for p24 measurement and viral RNA analysis.
2.5. Luciferase Assay
At 48 h post infection, the cells were collected, washed with PBS and then incubated with 100 μL of steady light reconstituted luciferase buffer (Luclite Kit, PerkinElmer) for 10 min at room temperature. Luminescence was measured using Glo-Max Microplate Multimode reader (Promega).
2.6. Cell Proliferation Assays
CEM T cells were seeded at concentration of 2 × 105 cells/mL in 96-well plates and treated with selected inhibitors at different concentrations (1 μM, 3 μM 10 μM, 30 μM, 60 μM and 100 μM) for 24 h. Next day, 10 μL of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) reagent was added to each well and incubated for 2 h at 37 °C in tissue culture incubator. Then 200 μL of DMSO was added to each well and the absorbance at 595 nm was measured using a microplate reader (Bio-Rad).
Viability of HIV-1 IIIB infected PBMCs was determined using trypan blue exclusion assay. The cells were supplemented with 0.2% trypan blue, transferred to a plastic disposable counting chamber, and counted on a TC10 automatic cell counter (Bio-Rad).
2.7. Tat-Induced HIV-1 Transcription Based on Luciferase Assays
293T cells (ATCC) were grown in DMEM media supplemented with 10% Fetal Bovine Serum (FBS) and 1% antibiotic solution (penicillin and streptomycin) at 37 °C in humidified incubator with 5% CO2. 293T cells were seeded in 96-well plates at 30% confluence and Lipofectamine 3000 reagent (Life Technologies) was utilized for transfection. 293T cells were co-transfected with Tat-expressing vector and HIV-1 LTR-luciferase reporter gene. At 24 h post transfection, the compounds were diluted in DMEM media and added to the cells at different concentrations and incubated for another 24 h. At 48 h post transfection, the cells were collected and washed with phosphate-buffered saline (PBS), and then 100 μL of steady light reconstituted luciferase buffer (Lucilyte, PerkinElmer) was added for 10 min at room temperature. Luminescence was measured using Glo-Max Microplate Multimode reader (Promega).
2.8. Tat–TAR RNA Interaction Assay
Biotinylated WT TAR RNA (59 nucleotides long, 5′-GGGUCUCUCUGGUUAGACCAGAUCUGAGCCUGGGAGCUCUCUGGCUAACUAGGGAACCC-3′) and mutant delta TAR RNA with the deletions of Tat-binding bulge nucleotides 21-27 and 38-41 (48 nucleotides long, 5′-GGGUCUCUCUGGUUAGACCAGCCUGGGAGCUGGCUAACUAGGGAACCC-3′) were synthesized by Integrated DNA Technologies (Coralville, IL, USA). To prepare cell lysates containing Tat, 293T cells were co-transfected with Flag-Tat expression vector for 48 h and then lysed in the whole cell lysate buffer (50 mM Tris-HCl, pH 7.5, 0.5 M NaCl, 1% NP-40, 0.1% SDS) supplemented with protease inhibitors cocktail (Sigma). To bind TAR RNA, streptavidin-agarose beads were washed with the binding buffer prepared in RNAse free water (20 mM Tris-HCl pH 7.5, 2.5 mM MgCl
2, 100 mM NaCl). The beads were blocked with BSA and tRNA was also added to prevent unspecific binding. Blocked beads were then incubated with 10 µg of TAR RNA or 10 µg of delta TAR RNA as control. Beads incubated with TAR RNA and delta TAR RNA were washed and incubated with approximately 400 µg Tat lysate in presence of TAK buffer (50 mM Tris-HCl, pH 8.0, 5 mM MgCl
2, 5 mM MnCl
2, 10 μM ZnSO
4, 1 mM DTT). Then 10 µM of each compound was added. Beads were collected by 5 min centrifugation at 1000×
g, and the bound proteins were eluted in 1x SDS loading buffer. Proteins then separated on 10% Bis-Tris gel, followed by transferring to PVDF membrane, immunoblotting with anti-Flag antibody and chemiluminescence detection as previously described [
14].
2.9. Immunoprecipitation and Western Blotting Analysis
293T cells transfected as described above were lysed in the whole cell lysate buffer supplemented with protease inhibitors as described above. Total protein concentration was determined using BCA protein assay (Bio-Rad). Lysates were stored at -80 ℃ until use. Protein A/G agarose beads (Sana Cruz Biotechnology) were blocked with 5% Bovine Serum Albumin (BSA). Blocked beads were incubated with anti-Flag antibody then combined with protein lysate and incubated for 2 h at 4 °C. Beads were washed with 1x TNN buffer (10 mM Tris-HCl 7.5, 0.1% NP-40 and 100 mM NaCl) and then heated for 5 min at 95 °C. Eluted proteins were loaded on 10% Bis-Tris gel and resolved in 1x MOPS running buffer supplemented with SDS and anti-oxidant (Invitrogen). Proteins in the gel were transferred to PVDF membrane. The membrane was blocked in 5% non-fat milk, washed in PBS buffer containing 0.1% Tween-20 (PBST) and incubated with primary antibodies including Anti-CDK9 (1:4000) (Rabbit, Lot No: I0414), Anti-Cyclin T1 (1:4000) (Rabbit, Lot No:D1709) or anti-Flag 1:2000 for 2 h at room temperature. The membrane was washed with PBST and incubated with HRP-conjugated anti-mouse or anti-rabbit and probed. Chemiluminescence was detected with chemiluminescent substrate (Clarity ECL Western Blot Substrate Kits, Bio-Rad) using ChemiDoc XRS Imaging station (Bio-Rad).
2.10. The p24 Enzyme-Linked Immunosorbent Assay (ELISA)
CEM T cells or PBMCs were infected with HIV-1 IIIB (MOI = 0.01). Supernatants were collected at 48 h post infection and p24 was measured by HIV-1 p24 antibody ELISA (PerkinElmer) using OPD as substrate. Data were analyzed using standards provided within the kit.
2.11. Determination of HIV-1 gag and nef mRNA and HIV-1 Reverse Transcription
Quantitative analysis of HIV-1 RNA was conducted on total RNA isolated from CEM T cells infected with fully replication-competent HIV-1(IIIB). RNA was isolated using TRIzol Reagent (Invitrogen, Carlsbad, CA). For gag or nef RNA quantification, total RNA (100 ng) was reverse transcribed to cDNA using Superscript RT-PCR kit (Invitrogen, Carlsbad, CA). For quantification of HIV-1 DNA, total DNA was extracted from 1 × 106 cells infected with HIV-1(IIIB) using total DNA isolation kit (Thermo Fischer). Real-time PCR analysis was conducted in Roche Light Cycler 480 (Roche Diagnostics) using SYBR Green Master Mix (Roche Diagnostics). PCR amplification was carried with initial preincubation for 5 min at 45 ℃, then 3 min at 95 ℃ followed by 45 cycles of denaturation at 95 ℃ for 15 s, annealing and extension at 60 ℃ for 45 s, and final extension at 72 ℃ for 10 s. Mean Cp values for Early LTR, Late LTR transcripts and β-globin DNA was determined using ΔΔCt method. Quantification of gag or nef mRNA was carried out using 18S RNA as a housekeeping control. Mean Cp values were determined and ΔΔCt method was used to calculate relative expression levels. The following primer sequences were used.
HIV gag forward: ATAATCCACCTATCCCAGTAGGAGAAAT
HIV gag reverse: TITGGTCCITGTCITATGTCCAGAATGC
HIV nef forward: ATCCACTGACCTTTGGATGG
HIV nef reverse: GTACTCCGGATGCAGCTCTC
Early LTR forward: GGCTAACTAGGGAACCCACTG
Early LTR reverse: CTGCTAGAGATTTTCCACACTGAC
Late LTR forward: TGTGTGCCCGTCTGTTGTGT
Late LTR reverse: GAGTCCTGCGTCGAGAGATC
β-actin forward: CTCCCAAAGTGCTGGGATTA
β-actin reverse: CAAAGGCGAGGCTCTGTG
18SrRNA forward: CAAAGGCGAGGCTCTGTG
18SrRNA reverse: CTCCAGGTTTTGCAACCAGT
2.12. In Vitro Translation System
Rabbit reticulocytes lysate translation system (Promega) was used to test the effect of compounds on translation. The 50 µL reaction contained 35 µL reticylocyte lysate (10 mM creatine phosphate, 50μg/mL creatine phosphokinase, 2 mM DTT, 50 μg/mL calf liver tRNA, 79 mM Potassium Acetate, 0.5 mM Magnesium acetate, 0.02 mM Hemin), 2 µM amino acids, Ribonuclease inhibitor (1.1 U/μL), 43 ng luciferase RNA and 3 µg Transcend™ tRNA. The indicated inhibitors were added at 30 µM concentration and incubated at 30 ℃ for 90 min. The reaction was terminated by placing the reaction on ice. Biotin containing translation products were analyzed by Western blotting as described above using the antibodies provided in the kit.
2.13. Statistical Analysis
Statistical analysis was performed using GraphPad Prism 6 software (Graph Pad Software, San Diego, CA, USA). All data are presented as means with standard deviation. Means and standard deviations were calculated for 3 repeats at each concentration of each compound. Differences between the two groups were compared using the parametric unpaired two-tailed Student’s t-test. For reproducibility, experiments were repeated three times.
4. Discussion
In this study, we screened over one million individual compounds from the Enamine database against the TAR RNA structure, and identified 173 compounds that were further analyzed to identify the most efficient inhibitor and to gain insight on its mechanism of action. Our top candidate, the T0516-4834 compound showed selective inhibition of Tat-induced HIV-1 transcription, efficient inhibition of HIV-1
gag mRNA expression and p24 production and disruption of Tat–TAR RNA interaction and, to a lesser extent, Tat/CDK9/cyclin T1 interaction. While the T0516-4834 compound inhibited both unspliced
gag mRNA as well as spliced
nef mRNA production, the T6780107 compound only inhibited unspliced
gag mRNA production, suggesting that it may affect HIV-1 splicing. A recent study has reported the discovery and optimization of thienopyrimidines as HIV-1 TAR RNA binding molecules [
16]. These TAR RNA binding molecules displaced Tat-derived peptide from TAR RNA with 40 μM IC
50 and demonstrated non-canonical TAR RNA binding as determined by NMR [
16]. Our top performing compound benzoxazole T0516-4834 showed in silico interaction with TAR RNA within a cleft formed by U25 and U40 nucleotides, similar to the thienopyridine compound 2 [
16] (
Figure 6). Thienopyridines inhibited the HIV-1-induced cytopathic effect at 28 µM EC
50, without cytotoxicity [
17]. In our study, we observed HIV-1 inhibition with 0.3 μM IC
50 in one round of HIV-1 infection. We also achieved ~10-fold HIV-1 inhibition in HIV-1 IIIB infected PBMCs treated with 10 µM T0516-4834. Thus our compound described here seems to show superior HIV-1 inhibition despite its close structure similarity to the previously described compound 2. In our preliminary comparison of the T0516-4834 compound to the thienopyridine compound 2, we conducted a series of 100 ns MD simulations, which revealed that compound 2 preserves pi–pi interaction with G26 and C39 only, while bases from the opposite side of the crevice (bases U25 and U40) divert from the ligand and their interactions are transient. In turn, T0516-4834 reshapes the crevice and forms stable pi–pi stacking with bases G26, C39 and U40 and these interactions are preserved through the entire simulation. Thus, T0516-4834 compound seems to induce RNA rearrangement (induced fit) that might allow maintaining more extensive interactions with the TAR RNA molecule. These data will be published elsewhere.
In addition to thienopyrimidines, several additional classes of molecules were shown to bind TAR RNA including a cyclic peptide mimic of Tat [
18], amilorides [
19] and a tri-cationic oligopyridylamide, ADH-19 [
20]. However, none of these compounds were able to achieve significant HIV-1 inhibition with sub micromolar or even low micromolar IC
50.
To understand whether the identified compound selectively inhibited Tat-induced transcription, we analyzed its effect on basal and Tat-induced transcription. Only the T6780107 and T5628834 compounds affected HIV-1 basal transcription with low micro molar IC50s. Tat-induced transcription was inhibited by T6780107 and T0516-4834, whereas the T5628834 compound showed little effect. Thus, only the T0516-4834 compound showed selectivity for the inhibition of Tat-mediated transcription compared to basal transcription. These effects are consistent with the inhibition of Tat–TAR RNA interaction by the T0516-4834 compound, which only happens at Tat-induced and not basal transcription. The T5628834 compound suppressed p24 levels and gag mRNA in HIV-1 infected PBMCs but had no effect on nef mRNA production. Thus, while T5628834 might disrupt binding of Tat to CDK9/Cyclin T1, it might have additional effects, such as an effect on HIV-1 splicing. Moreover, the T6780107 compound might have an effect on splicing as it reduced p24 and gag mRNA levels but had no effect on nef mRNA. This compound had no effect on CDK9/cyclin T1 interaction and remains to be further investigated.
The previously reported TR87 compound, which binds with high affinity to TAR RNA, reduces Tat-mediated transcription and downregulates HIV-1 replication through the disturbance of Tat/TAR RNA interaction [
21]. Similarly, CGP64222, which binds Tat protein inducing a conformational change in TAR RNA bulge, blocks HIV-1 replication and specifically inhibits Tat-transactivation [
22,
23]. The most promising, to date, HIV-1 transcription inhibitor, didehydro-cortistatin A, targets Tat protein by binding to the positively charged lysine of Tat’s TAR RNA binding domain and decreases the binding affinity of Tat to TAR RNA [
24].
The tested compounds inhibited HIV-1 transcription and had no effect on HIV-1 reverse transcription. Thus, the early steps of HIV-1 infection including entry, binding and reverse transcription are not likely to be affected by the compounds. The utility of HIV-1 transcription inhibitors is highlighted by our recent study in which the activation of HIV-1 in macrophages was the major contributing factor to lung inflammation in HIV-1 transgenic (HIV-Tg) mice [
25,
26]. Treatment of HIV-Tg mice with 1E7-03, an HIV-1 transcription inhibitor, ameliorated LPS-induced lung inflammation and prevented mice death [
26]. As individuals living with HIV-1 have a higher prevalence of non-infectious lung disease [
27], future testing of the compounds described here are warranted in HIV-1-related pathologies including lung inflammation. Because cART therapy has no effect on HIV transcription, the development of transcriptional inhibitors such as T0516-4834 or 1E7-03 is needed and might help to treat HIV-1–related chronic complications.