Development of a Novel Loop Mediated Isothermal Amplification Assay (LAMP) for the Rapid Detection of Epizootic Haemorrhagic Disease Virus
Abstract
:1. Introduction
2. Materials and Methods
2.1. Primer Design
2.2. RNA Extraction
2.3. RT-LAMP
2.4. RT-qPCR
2.5. Validation of RT-LAMPs
2.5.1. In-House Specificity
2.5.2. Analytical Sensitivity and Limit of Detection
2.5.3. Field Samples
2.5.4. Proficiency Panel
3. Results
3.1. Assay Design and Primer Evaluation
3.2. Validation of RT-LAMPs
3.2.1. In-House Specificity
3.2.2. Sensitivity and Limit of Detection
3.2.3. Field Samples
3.2.4. Proficiency Panel
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Cottingham, S.L.; White, Z.S.; Wisely, S.M.; Campos-Krauer, J.M. A Mortality-Based Description of EHDV and BTV Prevalence in Farmed White-Tailed Deer (Odocoileus virginianus) in Florida, USA. Viruses 2021, 13, 1443. [Google Scholar] [CrossRef]
- EFSA. Scientific Opinion on Epizootic Hemorrhagic Disease. EFSA J. 2009, 7, 1418. [Google Scholar] [CrossRef]
- Savini, G.; Afonso, A.; Mellor, P.; Aradaib, I.; Yadin, H.; Sanaa, M.; Wilson, W.; Monaco, F.; Domingo, M. Epizootic heamorragic disease. Res. Vet. Sci. 2011, 91, 1–17. [Google Scholar] [CrossRef]
- Omori, T.; Inaba, Y.; Morimoto, T.; Tanaka, Y.; Ishitani, R.; Kurogi, H.; Munakata, K.; Matsuda, K.; Matumoto, M. Ibaraki virus, an agent of epizootic disease of cattle resembling Bluetongue—I. Epidemiologic, clinical and pathologic observations and experimental transmission to calves. Jpn. J. Microbiol. 1969, 13, 139–157. [Google Scholar] [CrossRef] [Green Version]
- Golender, N.; Bumbarov, V.Y. Detection of Epizootic hemorrhagic disease virus serotype 1, Israel. Emerg. Infect. Dis. 2019, 25, 825–827. [Google Scholar] [CrossRef] [PubMed]
- Ahmed, S.; Mahmoud, M.A.; Viarouge, C.; Saileau, C.; Zientara, S.; Breard, E. Presence of bluetongue and epizootic hemorrhagic disease viruses in Egypt in 2016 and 2017. Infect. Genet. Evol. 2019, 73, 221–226. [Google Scholar] [CrossRef]
- Mecham, J.O.; Dean, V.C. Protein coding assignment for the genome of Epizootic hemorrhagic disease virus. J. Gen. Virol. 1988, 69, 1255–1262. [Google Scholar] [CrossRef]
- Anthony, S.J.; Maan, N.; Maan, S.; Sutton, G.; Attoui, H.; Mertens, P.P.C. Genetic and phylogenetic analysis of the non-structural proteins NS1, NS2 and NS3 of Epizootic haemorrhagic disease virus (EHDV). Virus Res. 2009, 145, 211–219. [Google Scholar] [CrossRef]
- Stewart, M.; Hardy, A.; Barry, G.; Pinto, R.M.; Caporale, M.; Melzi, E.; Hughes, J.; Taggart, A.; Janowicz, A.; Varela, M.; et al. Characterization of a second open reading frame in genome segment 10 of Bluetongue virus. J. Gen. Virol. 2015, 96, 3280–3293. [Google Scholar] [CrossRef] [PubMed]
- Anthony, S.J.; Maan, S.; Maan, N.; Kgosana, L.; Bachanek-Bankowska, K.; Batten, C.; Darpel, K.E.; Sutton, G.; Attoui, H.; Mertens, P.P.C. Genetic and phylogenetic analysis of the outer-coat proteins VP2 and VP5 of Epizootic haemorrhagic disease virus (EHDV): Comparison of genetic and serological data to characterise the EHDV serogroup. Virus Res. 2009, 145, 200–210. [Google Scholar] [CrossRef] [PubMed]
- Campbell, C.H.; Stgeorge, T.D. A preliminary-report of a comparison of Epizootic Hemorrhagic Disease viruses from Australia with others from North America, Japan and Nigeria. Aust. Vet. J. 1986, 63, 233. [Google Scholar] [CrossRef] [PubMed]
- Shirafuji, H.; Kato, T.; Yamakawa, M.; Tanaka, T.; Minemori, Y.; Yanase, T. Characterization of genome segments 2, 3 and 6 of Epizootic hemorrhagic disease virus strains isolated in Japan in 1985–2013: Identification of their serotypes and geographical genetic types. Infect. Genet. Evol. 2017, 53, 38–46. [Google Scholar] [CrossRef]
- Yang, H.; Li, Z.R.; Wang, J.P.; Li, Z.H.; Yang, Z.X.; Liao, D.F.; Zhu, J.B.; Li, H.C. Novel serotype of Epizootic hemorrhagic disease virus, China. Emerg. Infect. Dis. 2020, 26, 3081–3083. [Google Scholar] [CrossRef]
- Rajko-Nenow, P.; Brown-Joseph, T.; Tennakoon, C.; Flannery, J.; Oura, C.A.L.; Batten, C. Detection of a novel reassortant Epizootic hemorrhagic disease virus serotype 6 in cattle in Trinidad, West Indies, containing nine RNA segments derived from exotic EHDV strains with an Australian origin. Infect. Genet. Evol. 2019, 74, 103931. [Google Scholar] [CrossRef] [PubMed]
- Brown-Joseph, T.; Rajko-Nenow, P.; Hicks, H.; Sahadeo, N.; Harrup, L.E.; Carrington, C.V.; Batten, C.; Oura, C.A.L. Identification and characterization of Epizootic hemorrhagic disease virus serotype 6 in cattle co-infected with Bluetongue virus in Trinidad, West Indies. Vet. Microbiol. 2019, 229, 1–6. [Google Scholar] [CrossRef]
- Clavijo, A.; Sun, F.; Lester, T.; Jasperson, D.C.; Wilson, W.C. An improved real-time polymerase chain reaction for the simultaneous detection of all serotypes of Epizootic hemorrhagic disease virus. J. Vet. Diagn. Investig. 2010, 22, 588–593. [Google Scholar] [CrossRef] [Green Version]
- Viarouge, C.; Breard, E.; Zientara, S.; Vitour, D.; Sailleau, C. Duplex Real-Time RT-PCR Assays for the Detection and Typing of Epizootic haemorrhagic disease virus. PLoS ONE 2015, 10, e0132540. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Maan, N.S.; Maan, S.; Nomikou, K.; Johnson, D.J.; El Harrak, M.; Madani, H.; Yadin, H.; Incoglu, S.; Yesilbag, K.; Allison, A.B.; et al. RT-PCR Assays for Seven Serotypes of Epizootic haemorrhagic disease virus and Their Use to Type Strains from the Mediterranean Region and North America. PLoS ONE 2010, 5, e12782. [Google Scholar] [CrossRef] [PubMed]
- Maan, N.S.; Maan, S.; Potgieter, A.C.; Wright, I.M.; Belaganahalli, M.; Mertens, P.P.C. Development of Real-Time RT-PCR Assays for Detection and Typing of Epizootic haemorrhagic disease virus. Transbound. Emerg. Dis. 2017, 64, 1120–1132. [Google Scholar] [CrossRef] [PubMed]
- Wilson, W.C.; O’Hearn, E.S.; Tellgren-Roth, C.; Stallknecht, D.E.; Mead, D.G.; Mecham, J.O. Detection of all eight serotypes of Epizootic hemorrhagic disease virus by real-time reverse transcription polymerase chain reaction. J. Vet. Diagn. Investig. 2009, 21, 220–225. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Blomstrom, A.-L.; Hakhverdyan, M.; Reid, S.M.; Dukes, J.P.; King, D.P.; Belak, S.; Berg, M. A one-step reverse transcriptase loop-mediated isothermal amplification assay for simple and rapid detection of swine vesicular disease virus. J. Virol. Methods 2008, 147, 188–193. [Google Scholar] [CrossRef] [PubMed]
- Rajko-Nenow, P.; Flannery, J.; Arnold, H.; Howson, E.L.A.; Darpel, K.; Stedman, A.; Corla, A.; Batten, C. A rapid RT-LAMP assay for the detection of all four lineages of Peste des petits ruminants virus. J. Virol. Methods 2019, 274, 113730. [Google Scholar] [CrossRef] [PubMed]
- Howson, E.L.A.; Kurosaki, Y.; Yasuda, J.; Takahashi, M.; Goto, H.; Gray, A.R.; Mioulet, V.; King, D.P.; Fowler, V.L. Defining the relative performance of isothermal assays that can be used for rapid and sensitive detection of foot-and-mouth disease virus. J. Virol. Methods 2017, 249, 102–110. [Google Scholar] [CrossRef] [Green Version]
- Waters, R.A.; Fowler, V.L.; Armson, B.; Nelson, N.; Gloster, J.; Paton, D.J.; King, D.P. Preliminary validation of direct detection of foot-and-Mouth disease virus within clinical samples using reverse transcription loop-mediated isothermal amplification coupled with a simple lateral flow device for detection. PLoS ONE 2014, 9, e105630. [Google Scholar] [CrossRef] [PubMed]
- Maan, S.; Maan, N.S.; Batra, K.; Kumar, A.; Gupta, A.; Rao, P.P.; Hemadri, D.; Reddy, Y.N.; Guimera, M.; Belaganahalli, M.N.; et al. Reverse transcription loop-mediated isothermal amplification assays for rapid identification of eastern and western strains of Bluetongue virus in India. J. Virol. Methods 2016, 234, 65–74. [Google Scholar] [CrossRef]
- Fowler, V.L.; Howson, E.L.A.; Flannery, J.; Romito, M.; Lubisi, A.; Aguero, M.; Mertens, P.; Batten, C.A.; Warren, H.R.; Castillo-Olivares, J. Development of a Novel Reverse Transcription Loop-Mediated Isothermal Amplification Assay for the Rapid Detection of African horse sickness virus. Transbound. Emerg. Dis. 2017, 64, 1579–1588. [Google Scholar] [CrossRef] [Green Version]
- Rapid Evaluation of OptiGene RT-LAMP Assay (Direct and RNA Formats). Available online: https://www.gov.uk/government/publications/rapid-evaluation-of-optigene-rt-lamp-assay-direct-and-rna-formats (accessed on 29 August 2021).
- Anonymous. Clinical Evaluation Confirms Accuracy of LAMP Test. Available online: https://www.gov.uk/government/news/clinical-evaluation-confirms-accuracy-of-lamp-test (accessed on 29 August 2021).
- Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef] [Green Version]
- Thompson, J.D.; Gibson, T.J.; Plewniak, F.; Jeanmougin, F.; Higgins, D.G. The CLUSTAL_X windows interface: Flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 1997, 25, 4876–4882. [Google Scholar] [CrossRef] [Green Version]
- De Clare Bronsvoort, B.M.; Thumbi, S.M.; Poole, E.J.; Kiara, H.; Auguet, O.T.; Handel, I.G.; Jennings, A.; Conradie, I.; Mbole-Kariuki, M.N.; Toye, P.G.; et al. Design and descriptive epidemiology of the Infectious Diseases of East African Livestock (IDEAL) project, a longitudinal calf cohort study in western Kenya. BMC Vet. Res. Vol. 2013, 9, 171. [Google Scholar] [CrossRef] [Green Version]
- Reed, G.F.; Lynn, F.; Meade, B.D. Use of coefficient of variation in assessing variability of quantitative assays. Clin. Diagn. Lab. Immunol. 2002, 9, 1235–1239. [Google Scholar] [CrossRef] [Green Version]
- St. George, T.D.; Cybinski, D.H.; Standfast, H.A.; Gard, G.P.; Dellaporta, A.J. The isolation of five different viruses of the Epizootic Hemorrhagic Disease of deer serogroup. Aust. Vet. J. 1983, 60, 216–217. [Google Scholar] [CrossRef] [PubMed]
- Kamomae, Y.; Kamomae, M.; Ohta, Y.; Nabe, M.; Kagawa, Y.; Ogura, Y.; Kato, T.; Tanaka, S.; Yanase, T.; Shirafuji, H. Epizootic hemorrhagic disease virus Serotype 6 Infection in Cattle, Japan, 2015. Emerg. Infect. Dis. 2018, 24, 902–905. [Google Scholar] [CrossRef] [Green Version]
- Ohashi, S.; Yoshida, K.; Yanase, T.; Tsuda, T. Analysis of intratypic variation evident in an Ibaraki virus strain and its Epizootic hemorrhagic disease virus serogroup. J. Clin. Microbiol. 2002, 40, 3684–3688. [Google Scholar] [CrossRef] [Green Version]
- Batten, C.A.; Edwards, L.; Bin-Tarif, A.; Henstock, M.R.; Oura, C.A.L. Infection kinetics of Epizootic haemorrhagic disease virus serotype 6 in Holstein-Friesian cattle. Vet. Microbiol. 2011, 154, 23–28. [Google Scholar] [CrossRef]
- Mendiola, S.Y.; Mills, M.K.; Maki, E.; Drolet, B.S.; Wilson, W.C.; Berghaus, R.; Stallknecht, D.E.; Breitenbach, J.; McVey, D.S.; Ruder, M.G. EHDV-2 infection prevalence varies in Culicoides sonorensis after feeding on infected White-tailed deer over the course of viremia. Viruses 2019, 11, 371. [Google Scholar] [CrossRef] [Green Version]
- Gaydos, J.K.; Allison, A.B.; Hanson, B.A.; Yellin, A.S. Oral and fecal shedding of Epizootic hemorrhagic disease virus, serotype 1 from experimentally infected white-tailed deer. J. Wildl. Dis. 2002, 38, 166–168. [Google Scholar] [CrossRef] [Green Version]
- Fowler, V.L.; Armsona, B.; Gonzales, J.L.; Wise, E.L.; Howson, E.L.A.; Vincent-Mistiaena, Z.; Fouch, S.; Maltby, C.J.; Grippon, S.; Munro, S.; et al. A highly effective reverse-transcription loop-mediated isothermal amplification (RT-LAMP) assay for the rapid detection of SARS-CoV-2 infection. J. Infect. 2021, 82, 117–125. [Google Scholar] [CrossRef]
- Teoh, B.; Chin, K.; Samsudin, N.; Loong, S.; Sam, S.; Tan, K.; Khor, C.; Abd-Jamil, J.; Zainal, N.; Wilder-Smith, A.; et al. A reverse transcription loop-mediated isothermal amplification for broad coverage detection of Asian and African Zika virus lineages. BMC Infect. Dis. 2020, 20, 947. [Google Scholar] [CrossRef] [PubMed]
- Paul, R.; Ostermann, E.; Chen, Y.; Saville, A.C.; Yang, Y.; Gu, Z.; Whitfield, A.E.; Ristaino, J.B.; Wei, Q. Integrated microneedle-smartphone nucleic acid amplification platform for in-field diagnosis of plant diseases. Biosens. Bioelectron. 2021, 187, 113312. [Google Scholar] [CrossRef] [PubMed]
- Tran, D.H.; Tran, H.T.; Le, U.P.; Vu, X.D.; Trinh, T.B.N.; Do, H.D.K.; Than, V.T.; Bui, L.M.; Vu, V.V.; Nguyen, T.L.; et al. Direct colorimetric LAMP assay for rapid detection of African swine fever virus: A validation study during an outbreak in Vietnam. Transbound. Emerg. Dis. 2021, 68, 2595–2602. [Google Scholar] [CrossRef]
Set | Primer 1 | Sequence (5′-3′) | Final Reaction Concentration (µM) |
---|---|---|---|
Eastern topotype s9.E | F3 | GACGCCTGGATGTTACAG | 0.2 |
B3 | GCAGCGACTTCTCAATGT | 0.2 | |
FIP (F1c + F2) | CTTCCAGTTCCTGACGCATCATATCTAGCGACGGAGGAG | 2 | |
BIP (B1c + B2) | AATAGAGGGAGATGGGTAGTGGGTGCTCACTCCGTACCG | 2 | |
LoopF | CTCTATCTCCTCTCTTAGTCTCACT | 1 | |
LoopB | GAGTGAAGAAATCGCTCAATGTC | 1 | |
Western topotype s9.W | F3 | GATGTTCGACGCATGGAT | 0.2 |
B3 | CGTACCATTTGCTCCAGG | 0.2 | |
FIP (F1c + F2) | TCCAGTTCTTGCCGCATCATTGATCTGGAGAACGCAAGG | 2 | |
BIP (B1c + B2) | ACGGGAGGAGGAAGATGGTTGGAATACTCACTCCGTACCTA | 2 | |
LoopF | TCTATCTCCTCCCTTAACCTTA | 1 | |
LoopB | GAGCGAAGAGATAGCACAAT | 1 | |
Multiplex | F3 | GATGTTCGACGCATGGAT | 0.2 |
B3 | CGTACCATTTGCTCCAGG | 0.2 | |
FIP (F1c + F2) | TCCAGTTCTTGCCGCATCATTGATCTGGAGAACGCAAGG | 1.6 | |
BIP (B1c + B2) | ACGGGAGGAGGAAGATGGTTGGAATACTCACTCCGTACCTA | 1.6 | |
LoopF | TCTATCTCCTCCCTTAACCTTA | 0.8 | |
LoopB | GAGCGAAGAGATAGCACAAT | 0.8 | |
FIP (F1c + F2) | CTTCCAGTTCCTGACGCATCATATCTAGCGACGGAGGAG | 1.6 | |
BIP (B1c + B2) | AATAGAGGGAGATGGGTAGTGGGTGCTCACTCCGTACCG | 1.6 | |
LoopB | GAGTGAAGAAATCGCTCAATGTC | 0.8 |
Sample ID | RT-qPCR CT Value | s9.W | s9.W + s9.E FIP, BIP | s9.W + s9.E FIP, BIP, LoopF | s9.W + s9.E FIP, BIP, LoopB | s9.W + s9.E FIP, BIP, F3 | s9.W + s9.E FIP, BIP, B3 |
---|---|---|---|---|---|---|---|
RT-LAMP tp [min] (Ta [°C]) | |||||||
EHDV-1 | 20.03 | 7.50 (86.40) | 8.50 (86.45) | 10.25 (86.41) | 10.75 (86.41) | 10.75 (86.41) | 10.25 (86.41) |
EHDV-8 | 19.72 | ND | 12.25 (87.20) | 11.75 (87.15) | 8.75 (87.15) | 12.25 (87.20) | ND |
Sample ID | Serotype (Topotype) | RT-qPCR CT Value | RT-LAMP s9.E | RT-LAMP s9.W | RT-LAMP Multiplex | |||
---|---|---|---|---|---|---|---|---|
tp [min] | Ta [°C] | tp [min] | Ta [°C] | tp [min] | Ta [°C] | |||
AUS1977/01 | EHDV-5 (eastern) | 15.02 | 5.37 | 86.99 | ND | ND | 4.94 | 87.44 |
AUS1980/03 | EHDV-2 (eastern) | 15.58 | 5.67 | 87.44 | ND | ND | 9.45 | 87.29 |
AUS1981/06 | EHDV-7 (eastern) | 11.11 | 6.52 | 86.55 | ND | ND | 5.05 | 86.84 |
AUS1981/07 | EHDV-6 (eastern) | 18.76 | 3.90 | 86.99 | ND | ND | 5.70 | 87.59 |
AUS1982/05 | EHDV-8 (eastern) | 14.64 | 5.14 | 87.29 | ND | ND | 9.60 | 87.14 |
AUS1995/02 | EHDV-1 (eastern) | 12.52 | 5.62 | 87.14 | ND | ND | 10.48 | 87.74 |
ISA1988/01 | EHDV-2 (eastern) | 14.41 | 6.90 | 87.33 | ND | ND | 7.43 | 87.48 |
ISA1990/01 | EHDV-2 (eastern) | 14.43 | 6.00 | 87.18 | ND | ND | 7.44 | 87.63 |
ISA1991/03 | EHDV-10 (eastern) | 12.27 | 6.10 | 86.40 | ND | ND | 7.00 | 86.55 |
JAP1959/01 | EHDV-2 (eastern) | 17.12 | 5.86 | 87.14 | ND | ND | 7.03 | 87.59 |
TAT2013/02 | EHDV-6 (eastern) | 15.25 | 4.24 | 87.14 | ND | ND | 5.26 | 87.74 |
ALG2006/02 | EHDV-6 (western) | 14.66 | ND | ND | 4.33 | 86.84 | 5.51 | 86.84 |
BAR1983/01 | EHDV-6 (western) | 13.82 | ND | ND | 4.23 | 87.29 | 4.53 | 87.59 |
BRA2008/01 | EHDV-2 (western) | 14.88 | ND | ND | 8.65 | 86.40 | 10.96 | 86.69 |
CAN1962/01 | EHDV-2 (western) | 13.90 | ND | ND | 4.77 | 86.55 | 5.54 | 86.99 |
GLP2011/01 | EHDV-2 (western) | 11.86 | ND | ND | 5.23 | 86.55 | 8.24 | 87.29 |
GUI2011/01 | EHDV-1 (western) | 14.54 | ND | ND | 7.88 | 86.99 | 8.66 | 87.59 |
ISR2006/01 | EHDV-7 (western) | 13.12 | ND | ND | 5.47 | 86.88 | 6.22 | 87.03 |
MOR2004/03 | EHDV-7 (western) | 15.05 | ND | ND | 4.70 | 86.84 | 6.66 | 86.84 |
MOR2006/05 | EHDV-6 (western) | 15.42 | ND | ND | 4.67 | 86.99 | 4.87 | 87.74 |
NIG1967/01 | EHDV-1 (western) | ND | ND | ND | 5.39 | 87.29 | 11.98 | 87.59 |
NIG1968/01 | EHDV-4 (western) | 17.54 | ND | ND | 4.60 | 87.44 | 5.36 | 87.88 |
REU2003/03 | EHDV-6 (western) | 16.86 | ND | ND | 4.66 | 86.88 | 4.46 | 86.88 |
REU2009/01 | EHDV-6 (western) | 13.31 | ND | ND | 5.09 | 87.29 | 5.68 | 87.29 |
SND1982/04 | EHDV-6 (western) | 12.08 | ND | ND | 4.22 | 87.03 | 4.72 | 87.33 |
SND1982/05 | EHDV-6 (western) | 13.84 | ND | ND | 4.14 | 87.03 | 5.09 | 87.33 |
SND1983/02 | EHDV-6 (western) | 13.76 | ND | ND | 3.81 | 87.03 | 4.76 | 87.18 |
TUR2007/01 | EHDV-6 (western) | 13.92 | ND | ND | 5.17 | 86.99 | 5.64 | 86.99 |
USA1955/01 | EHDV-1 (western) | 19.55 | ND | ND | 7.32 | 86.69 | 7.67 | 86.69 |
USA1978/01 | EHDV-2 (western) | 15.93 | ND | ND | 6.00 | 86.55 | 5.80 | 86.99 |
USA1980/01 | EHDV-2 (western) | 15.18 | ND | ND | 5.06 | 86.40 | 6.26 | 86.55 |
USA1993/01 | EHDV-2 (western) | 13.26 | ND | ND | 6.59 | 86.25 | 6.47 | 86.84 |
USA1994/01 | EHDV-2 (western) | 14.25 | ND | ND | 5.52 | 86.69 | 10.86 | 87.14 |
USA1996/01 | EHDV-2 (western) | 12.89 | ND | ND | 6.20 | 86.69 | 8.03 | 86.69 |
USA1996/02 | EHDV-2 (western) | 13.69 | ND | ND | 5.57 | 86.55 | 6.05 | 86.99 |
USA1996/04 | EHDV-1 (western) | 9.64 | ND | ND | 5.21 | 86.10 | 7.74 | 85.80 |
USA1998/01 | EHDV-2 (western) | 11.10 | ND | ND | 4.93 | 86.69 | 6.09 | 86.55 |
USA1999/01 | EHDV-2 (western) | 12.87 | ND | ND | 6.64 | 86.84 | 7.89 | 87.14 |
USA1999/04 | EHDV-1 (western) | 12.73 | ND | ND | 5.13 | 86.10 | 8.02 | 85.95 |
USA2000/01 | EHDV-2 (western) | 14.38 | ND | ND | 5.95 | 87.14 | 7.67 | 87.14 |
USA2001/01 | EHDV-1 (western) | 13.93 | ND | ND | 4.73 | 86.69 | 11.89 | 86.69 |
USA2001/07 | EHDV-2 (western) | 12.45 | ND | ND | 4.93 | 85.95 | 7.38 | 85.65 |
USA2006/05 | EHDV-6 (western) | 13.00 | ND | ND | 6.00 | 86.25 | 6.18 | 86.69 |
Sample ID | Dilution | Mean CT Value | Mean Ta [°C] | Mean tp [min] | Standard Deviation | %CV |
---|---|---|---|---|---|---|
TAT2013/02 | 10−1 | 15.00 | 87.21 | 3.77 | 0.01 | 0.22 |
10−2 | 18.77 | 87.36 | 4.63 | 0.02 | 0.46 | |
1 in 2 of 10−2 | 20.38 | 87.21 | 5.64 | 1.05 | 18.59 | |
1 in 4 of 10−2 | 22.02 | 87.51 | 7.04 | 0.37 | 5.30 | |
1 in 8 of 10−2 | 23.53 | 87.36 | 7.12 | 1.11 | 15.54 | |
1 in 16 of 10−2 | 24.36 | 87.07 | 7.73 | 1.78 | 22.97 |
Sample ID | Dilution | Mean CT Value | Mean Ta [°C] | Mean tp [min] | Standard Deviation | %CV |
---|---|---|---|---|---|---|
TUR2007/01 | 10−1 | 16.27 | 87.63 | 3.96 | 0.02 | 0.55 |
10−2 | 20.15 | 87.48 | 4.79 | 0.01 | 0.26 | |
10−3 | 24.07 | 87.25 | 6.45 | 0.47 | 7.22 | |
1 in 2 of 10−3 | 26.19 | 87.36 | 6.24 | 0.63 | 10.17 | |
1 in 4 of 10−3 | 27.51 | 87.66 | 7.45 | 1.33 | 17.80 | |
1 in 8 of 10−3 | 29.37 | 87.36 | 12.86 | 5.15 | 40.05 |
Sample ID | RT-qPCR CT Value | RT-LAMP s9.W | RT-LAMP Multiplex | ||
---|---|---|---|---|---|
tp [min] | Ta [°C] | tp [min] | Ta [°C] | ||
W19/17 104 | 31.13 | ND | ND | ND | ND |
W19/17 109 | 24.56 | 5.20 | 87.14 | 7.82 | 87.44 |
W19/17 129 | 29.10 | 5.67 | 87.14 | 14.34 | 87.29 |
W19/17 133 | 26.87 | 9.41 | 87.14 | 8.97 | 87.29 |
W19/17 138 | 28.01 | 15.12 | 86.99 | ND | ND |
W19/17 140 | 31.45 | 7.02 | 87.14 | ND | ND |
W19/17 145 | 24.58 | 7.79 | 86.99 | 9.69 | 86.84 |
W19/17 165 | 28.89 | 13.63 | 86.69 | 9.14 | 86.69 |
W19/17 169 | 31.82 | ND | ND | ND | ND |
W19/17 175 | 30.48 | 9.68 | 86.99 | ND | ND |
W19/17 186 | ND | ND | ND | ND | ND |
W19/17 192 | ND | ND | ND | ND | ND |
W19/17 195 | 26.80 | 9.23 | 87.29 | 10.18 | 87.14 |
W19/17 206 | ND | 14.98 | 86.84 | ND | ND |
W19/17 211 | 28.29 | 12.17 | 86.69 | ND | ND |
W19/17 226 | 27.12 | ND | ND | ND | ND |
W19/17 233 | 26.64 | 8.98 | 86.99 | ND | ND |
W19/17 260 | 27.39 | ND | ND | ND | ND |
W19/17 275 | 28.17 | ND | ND | ND | ND |
W19/17 277 | 28.97 | 5.93 | 87.44 | ND | ND |
PCR Panel | RT-qPCR CT Value | RT-LAMP s9.E | RT-LAMP s9.W | ||
---|---|---|---|---|---|
tp [min] | Ta [°C] | tp [min] | Ta [°C] | ||
S01 | 17.51 | ND | ND | 4.41 | 86.84 |
ND | ND | 4.72 | 86.99 | ||
S02 | ND | ND | ND | ND | ND |
ND | ND | ND | ND | ||
S03 | 19.12 | ND | ND | 3.50 | 86.69 |
ND | ND | 3.56 | 86.69 | ||
S04 | ND | ND | ND | ND | ND |
ND | ND | ND | ND | ||
S05 | 34.25 | ND | ND | ND | ND |
ND | ND | ND | ND | ||
S06 | ND | ND | ND | ND | ND |
ND | ND | ND | ND | ||
S07 | 18.63 | ND | ND | 6.93 | 87.14 |
ND | ND | 6.79 | 86.99 | ||
S08 | ND | ND | ND | ND | ND |
ND | ND | ND | ND | ||
S09 | 35.17 | ND | ND | ND | ND |
ND | ND | ND | ND | ||
S10 | 35.22 | ND | ND | ND | ND |
ND | ND | ND | ND |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rajko-Nenow, P.; Howson, E.L.A.; Clark, D.; Hilton, N.; Ambagala, A.; Svitek, N.; Flannery, J.; Batten, C. Development of a Novel Loop Mediated Isothermal Amplification Assay (LAMP) for the Rapid Detection of Epizootic Haemorrhagic Disease Virus. Viruses 2021, 13, 2187. https://doi.org/10.3390/v13112187
Rajko-Nenow P, Howson ELA, Clark D, Hilton N, Ambagala A, Svitek N, Flannery J, Batten C. Development of a Novel Loop Mediated Isothermal Amplification Assay (LAMP) for the Rapid Detection of Epizootic Haemorrhagic Disease Virus. Viruses. 2021; 13(11):2187. https://doi.org/10.3390/v13112187
Chicago/Turabian StyleRajko-Nenow, Paulina, Emma L. A. Howson, Duncan Clark, Natasha Hilton, Aruna Ambagala, Nicholas Svitek, John Flannery, and Carrie Batten. 2021. "Development of a Novel Loop Mediated Isothermal Amplification Assay (LAMP) for the Rapid Detection of Epizootic Haemorrhagic Disease Virus" Viruses 13, no. 11: 2187. https://doi.org/10.3390/v13112187