First Detection of SARS-CoV-2 B.1.1.7 Variant of Concern in an Asymptomatic Dog in Spain
Abstract
:1. Introduction
2. Materials and Methods
2.1. Detection of SARS-CoV-2 Infection by Reverse Transcription-Quantitative PCR (RT-qPCR) and Virus Isolation
2.2. Neutralizing Antibody Detection by Virus Neutralization Test (VNT)
2.3. Phylogenetic Analysis of SARS-CoV-2 Spike Protein by PCR Amplification and DNA Sequencing
3. Results
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Guan, W.J.; Ni, Z.Y.; Hu, Y.; Liang, W.H.; Ou, C.Q.; He, J.X.; Liu, L.; Shan, H.; Lei, C.L.; Hui, D.S.C.; et al. Clinical Characteristics of Coronavirus Disease 2019 in China. N. Engl. J. Med. 2020, 382, 1708–1720. [Google Scholar] [CrossRef]
- Pérez-Campos, L.M.; Hernández-Huerta, M.T.; Mayoral-Andrade, G.; Pérez-Campos, E.M.; Pérez-Campos, E. A letter to the editor on “World Health Organization declares global emergency: A review of the 2019 novel Coronavirus (COVID-19)”. Int. J. Surg. 2020, 79, 163–164. [Google Scholar] [CrossRef] [PubMed]
- Kirby, T. New variant of SARS-CoV-2 in UK causes surge of COVID-19. Lancet Respir. Med. 2021, 9, e20–e21. [Google Scholar] [CrossRef]
- Happi, A.N.; Ugwu, C.A.; Happi, C.T. Tracking the emergence of new SARS-CoV-2 variants in South Africa. Nat. Med. 2021, 27, 372–373. [Google Scholar] [CrossRef]
- Davies, N.G.; Abbott, S.; Barnard, R.C.; Jarvis, C.I.; Kucharski, A.J.; Munday, J.D.; Pearson, C.A.B.; Russell, T.W.; Tully, D.C.; Washburne, A.D.; et al. Estimated transmissibility and impact of SARS-CoV-2 lineage B.1.1.7 in England. Science 2021, 372, eabg3055. [Google Scholar] [CrossRef] [PubMed]
- Challen, R.; Brooks-Pollock, E.; Read, J.M.; Dyson, L.; Tsaneva-Atanasova, K.; Danon, L. Risk of mortality in patients infected with SARS-CoV-2 variant of concern 202012/1: Matched cohort study. BMJ 2021, 372, n579. [Google Scholar] [CrossRef] [PubMed]
- Altmann, D.M.; Boyton, R.J.; Beale, R. Immunity to SARS-CoV-2 variants of concern. Science 2021, 371, 1103–1104. [Google Scholar] [CrossRef]
- Jia, Z.; Gong, W. Will Mutations in the Spike Protein of SARS-CoV-2 Lead to the Failure of COVID-19 Vaccines? J. Korean Med. Sci. 2021, 36, e124. [Google Scholar] [CrossRef] [PubMed]
- Bal, A.; Destras, G.; Gaymard, A.; Stefic, K.; Marlet, J.; Eymieux, S.; Regue, H.; Semanas, Q.; d’Aubarede, C.; Billaud, G.; et al. Two-step strategy for the identification of SARS-CoV-2 variant of concern 202012/01 and other variants with spike deletion H69-V70, France, August to December 2020. Eurosurveillance 2021, 26, 2100008. [Google Scholar] [CrossRef] [PubMed]
- Shi, J.; Wen, Z.; Zhong, G.; Yang, H.; Wang, C.; Huang, B.; Liu, R.; He, X.; Shuai, L.; Sun, Z.; et al. Susceptibility of ferrets, cats, dogs, and other domesticated animals to SARS-coronavirus 2. Science 2020, 368, 1016–1020. [Google Scholar] [CrossRef] [Green Version]
- Wu, K.; Peng, G.; Wilken, M.; Geraghty, R.J.; Li, F. Mechanisms of host receptor adaptation by severe acute respiratory syndrome coronavirus. J. Biol. Chem. 2012, 287, 8904–8911. [Google Scholar] [CrossRef] [Green Version]
- Zhang, J.; Zhang, Y.; Kang, J.; Chen, S.; He, Y.; Han, B.; Liu, M.; Lu, L.; Li, L.; Yi, Z.; et al. Potential transmission chains of variant B.1.1.7 and co-mutations of SARS-CoV-2. bioRxiv 2021. [Google Scholar] [CrossRef]
- Hobbs, E.C.; Reid, T.J. Animals and SARS-CoV-2: Species susceptibility and viral transmission in experimental and natural conditions, and the potential implications for community transmission. Transbound. Emerg. Dis. 2020. [Google Scholar] [CrossRef]
- Ruiz-Arrondo, I.; Portillo, A.; Palomar, A.M.; Santibáñez, S.; Santibáñez, P.; Cervera, C.; Oteo, J.A. Detection of SARS-CoV-2 in pets living with COVID-19 owners diagnosed during the COVID-19 lockdown in Spain: A case of an asymptomatic cat with SARS-CoV-2 in Europe. Transbound. Emerg. Dis. 2020. [Google Scholar] [CrossRef]
- Fritz, M.; Rosolen, B.; Krafft, E.; Becquart, P.; Elguero, E.; Vratskikh, O.; Denolly, S.; Boson, B.; Vanhomwegen, J.; Gouilh, M.A.; et al. High prevalence of SARS-CoV-2 antibodies in pets from COVID-19+ households. One Health 2020, 11, 100192. [Google Scholar] [CrossRef] [PubMed]
- Gortázar, C.; Barroso-Arévalo, S.; Ferreras-Colino, E.; Isla, J.; de la Fuente, G.; Rivera, B.; Domínguez, L.; de la Fuente, J.; Sánchez-Vizcaíno, J. Natural SARS-CoV-2 Infection in Kept Ferrets, Spain. Emerg. Infect. Dis. J. 2021, 27, 1994. [Google Scholar] [CrossRef] [PubMed]
- Sanjuán, R.; Domingo-Calap, P. Mechanisms of viral mutation. Cell Mol. Life Sci. 2016, 73, 4433–4448. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Corman, V.M.; Landt, O.; Kaiser, M.; Molenkamp, R.; Meijer, A.; Chu, D.K.; Bleicker, T.; Brünink, S.; Schneider, J.; Schmidt, M.L.; et al. Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR. Eurosurveillance 2020, 25, 2000045. [Google Scholar] [CrossRef] [Green Version]
- Tamura, K. Estimation of the number of nucleotide substitutions when there are strong transition-transversion and G + C-content biases. Mol. Biol. Evol. 1992, 9, 678–687. [Google Scholar] [CrossRef] [Green Version]
- System, G.I.S.a.R. CoVariants (GISAID). Available online: https://covariants.org/ (accessed on 1 July 2021).
- Ferasin, L.; Fritz, M.; Ferasin, H.; Becquart, P.; Legros, V.; Leroy, E.M. Myocarditis in naturally infected pets with the British variant of COVID-19. bioRxiv 2021. [Google Scholar] [CrossRef]
- Hamer, S.A.; Ghai, R.R.; Zecca, I.B.; Auckland, L.D.; Roundy, C.M.; Davila, E.; Busselman, R.E.; Tang, W.; Pauvolid-Corrêa, A.; Killian, M.L.; et al. SARS-CoV-2 B.1.1.7 variant of concern detected in a pet dog and cat after exposure to a person with COVID-19, USA. Transbound. Emerg. Dis. 2021. [Google Scholar] [CrossRef]
- Temmam, S.; Barbarino, A.; Maso, D.; Behillil, S.; Enouf, V.; Huon, C.; Jaraud, A.; Chevallier, L.; Backovic, M.; Pérot, P.; et al. Absence of SARS-CoV-2 infection in cats and dogs in close contact with a cluster of COVID-19 patients in a veterinary campus. One Health 2020, 10, 100164. [Google Scholar] [CrossRef] [PubMed]
- Bosco-Lauth, A.M.; Hartwig, A.E.; Porter, S.M.; Gordy, P.W.; Nehring, M.; Byas, A.D.; VandeWoude, S.; Ragan, I.K.; Maison, R.M.; Bowen, R.A. Experimental infection of domestic dogs and cats with SARS-CoV-2: Pathogenesis, transmission, and response to reexposure in cats. Proc. Natl. Acad. Sci. USA 2020, 117, 26382. [Google Scholar] [CrossRef] [PubMed]
- WHO. SARS-CoV-2 Mink-Associated Variant Strain—Denmark. Available online: https://www.who.int/csr/don/06-november-2020-mink-associated-sars-cov2-denmark/en/ (accessed on 1 May 2021).
- Oude Munnink, B.B.; Sikkema, R.S.; Nieuwenhuijse, D.F.; Molenaar, R.J.; Munger, E.; Molenkamp, R.; van der Spek, A.; Tolsma, P.; Rietveld, A.; Brouwer, M.; et al. Transmission of SARS-CoV-2 on mink farms between humans and mink and back to humans. Science 2021, 371, 172. [Google Scholar] [CrossRef] [PubMed]
- Zhou, P.; Shi, Z.L. SARS-CoV-2 spillover events. Science 2021, 371, 120–122. [Google Scholar] [CrossRef]
- Center for Disease Control and Prevention—CDC. Pets and Other Animals. COVID-19. Available online: https://www.cdc.gov/coronavirus/2019-ncov/animals/pets-other-animals.html (accessed on 1 January 2021).
Primer Pairs | Forward Primer | Reverse Primer | Product Size |
---|---|---|---|
Spike-1 | TGCGTCATCATCTGAAGCAT | CGAAAAACCCTGAGGGAGAT | 973 |
Spike-2 | GGACCTTGAAGGAAAACAGG | CCTGGAGCGATTTGTCTGA | 708 |
Spike-3 | CCGCATCATTTTCCACTTTT | CGCATATACCTGCACCAATG | 903 |
Spike-4 | GCACAGAAGTCCCTGTTGCT | GGTTGGCAATCAATTTTTGG | 957 |
Spike-5 | CTGCACTGTTAGCGGGTACA | GGCGGTCAATTTCTTTTTGA | 933 |
Spike-6 | ATGATCCTTTGCAACCTGAA | ATGATTTTGGAAGCGCTCTG | 606 |
Animal ID, Date of Sample Collection | RT-qPCR Ct Values for Swab Testing | Viral Neutralization Endpoint Titer | Viral Isolation | |
---|---|---|---|---|
+D-7, 24.03.2021 | Nasal swab | Rectal swab | Negative | Yes |
20.05 | 26.34 | |||
+D-7, 26.03.2021 | Nasal swab | Rectal swab | Negative | NP |
20.21 | 33.55 | |||
+D-7, 13.04.2021 | Nasal swab | Rectal swab | 1/256 | NA |
ND | ND |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Barroso-Arévalo, S.; Rivera, B.; Domínguez, L.; Sánchez-Vizcaíno, J.M. First Detection of SARS-CoV-2 B.1.1.7 Variant of Concern in an Asymptomatic Dog in Spain. Viruses 2021, 13, 1379. https://doi.org/10.3390/v13071379
Barroso-Arévalo S, Rivera B, Domínguez L, Sánchez-Vizcaíno JM. First Detection of SARS-CoV-2 B.1.1.7 Variant of Concern in an Asymptomatic Dog in Spain. Viruses. 2021; 13(7):1379. https://doi.org/10.3390/v13071379
Chicago/Turabian StyleBarroso-Arévalo, Sandra, Belén Rivera, Lucas Domínguez, and José M. Sánchez-Vizcaíno. 2021. "First Detection of SARS-CoV-2 B.1.1.7 Variant of Concern in an Asymptomatic Dog in Spain" Viruses 13, no. 7: 1379. https://doi.org/10.3390/v13071379