Optimization and Application of a Multiplex Digital PCR Assay for the Detection of SARS-CoV-2 Variants of Concern in Belgian Influent Wastewater
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sampling
2.2. In Silico Screening dPCR Primer Sets
2.3. Sample Preparation and RNA Extraction
2.4. Molecular Assays: RT-qPCR and dPCR
2.5. Validation of the Specificity of the PCR Assays for the Different VOC Strains
2.6. Validation of Sensitivity of the dPCR Assay for the Different VOC Strains
3. Results and Discussion
3.1. Identification and In Silico Inclusivity Evaluation of Specific PCR Primer Sets
3.2. Validation of the Specificity of the PCR Primer Sets
3.2.1. RT-qPCR
3.2.2. dPCR
3.3. Validation of the Sensitivity of the dPCR Assay
3.4. Detection of the Different SARS-CoV-2 Variants of Concern in Belgian Influent Wastewaters Using the Validated dPCR Assay
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- World Health Organization (WHO). Tracking of SARS-CoV-2 Variants. Available online: https://www.who.int/en/activities/tracking-SARS-CoV-2-variants/ (accessed on 14 October 2021).
- Centers for Disease Control and Prevention. SARS-CoV-2 Variant Classifications and Definitions. Available online: https://www.cdc.gov/coronavirus/2019-ncov/variants/variant-info.html (accessed on 14 October 2021).
- Sanyaolu, A.; Okorie, C.; Marinkovic, A.; Haider, N.; Abbasi, A.F.; Jaferi, U.; Prakash, S.; Balendra, V. The emerging SARS-CoV-2 variants of concern. Ther. Adv. Infect. Dis. 2021, 8, 20499361211024372. [Google Scholar] [CrossRef] [PubMed]
- GISAID. Tracking of Variants. Available online: https://www.gisaid.org/hcov19-variants/ (accessed on 14 October 2021).
- Hadfield, J.; Bedford, T.; Neher, R.; Hodcroft, E.; Sibley, T.; Huddleston, J.; Aksamentov, I.; Lee, J.; Fay, K.; Zuber, M.; et al. Nextstrain: Real-Time Tracking of Pathogen Evolution. Available online: https://nextstrain.org/ncov/#sit-reps (accessed on 14 October 2021).
- Lopez-Rincon, A.; Perez-Romero, C.A.; Tonda, A.; Mendoza-Maldonado, L.; Claassen, E.; Garssen, J.; Kraneveld, A.D. Design of Specific Primer Sets for the Detection of B.1.1.7, B.1.351, P.1, B.1.617.2 and B.1.1.519 Variants of SARS-CoV-2 Using Artificial Intelligence. bioRxiv 2021. [Google Scholar] [CrossRef]
- Vogels, C.B.F.; Breban, M.I.; Ott, I.M.; Alpert, T.; Petrone, M.E.; Watkins, A.E.; Kalinich, C.C.; Earnest, R.; Rothman, J.E.; Goes de Jesus, J.; et al. Multiplex QPCR Discriminates Variants of Concern to Enhance Global Surveillance of SARS-CoV-2. PLoS Biol. 2021, 19, e3001236. [Google Scholar] [CrossRef] [PubMed]
- Chaintoutis, S.C.; Chassalevris, T.; Tsiolas, G.; Balaska, S.; Vlatakis, I.; Mouchtaropoulou, E.; Siarkou, V.I.; Tychala, A.; Koutsioulis, D.; Skoura, L.; et al. A One-Step Real-Time RT-PCR Assay for Simultaneous Typing of SARS-CoV-2 Mutations Associated with the E484K and N501Y Spike Protein Amino-Acid Substitutions. medRxiv 2021. [Google Scholar] [CrossRef] [PubMed]
- Bedotto, M.; Fournier, P.-E.; Houhamdi, L.; Levasseur, A.; Delerce, J.; Pinault, L.; Padane, A.; Chamieh, A.; Tissot-Dupont, H.; Brouqui, P.; et al. Implementation of an in-house real-time reverse transcription-PCR assay for the rapid detection of the SARS-CoV-2 Marseille-4 variant. J. Clin. Virol. 2021, 139, 104814. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Chen, L.; Deng, Q.; Zhang, G.; Wu, K.; Ni, L.; Yang, Y.; Liu, B.; Wang, W.; Wei, C.; et al. The presence of SARS-CoV-2 RNA in the feces of COVID-19 patients. J. Med. Virol. 2020, 92, 833–840. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lescure, F.-X.; Bouadma, L.; Nguyen, D.; Parisey, M.; Wicky, P.-H.; Behillil, S.; Gaymard, A.; Bouscambert-Duchamp, M.; Donati, F.; Le Hingrat, Q.; et al. Clinical and virological data of the first cases of COVID-19 in Europe: A case series. Lancet Infect. Dis. 2020, 20, 697–706. [Google Scholar] [CrossRef] [Green Version]
- Zhang, J.; Wang, S.; Xue, Y. Fecal specimen diagnosis 2019 novel coronavirus–infected pneumonia. J. Med. Virol. 2020, 92, 680–682. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Agrawal, S.; Orschler, L.; Lackner, S. Long-term monitoring of SARS-CoV-2 RNA in wastewater of the Frankfurt metropolitan area in Southern Germany. Sci. Rep. 2021, 11, 5372. [Google Scholar] [CrossRef]
- Medema, G.; Been, F.; Heijnen, L.; Petterson, S. Implementation of environmental surveillance for SARS-CoV-2 virus to support public health decisions: Opportunities and challenges. Curr. Opin. Environ. Sci. Health 2020, 17, 49–71. [Google Scholar] [CrossRef]
- Ahmed, W.; Angel, N.; Edson, J.; Bibby, K.; Bivins, A.; O’Brien, J.W.; Choi, P.M.; Kitajima, M.; Simpson, S.L.; Li, J.; et al. First confirmed detection of SARS-CoV-2 in untreated wastewater in Australia: A proof of concept for the wastewater surveillance of COVID-19 in the community. Sci. Total Environ. 2020, 728, 138764. [Google Scholar] [CrossRef] [PubMed]
- Kitajima, M.; Ahmed, W.; Bibby, K.; Carducci, A.; Gerba, C.P.; Hamilton, K.A.; Haramoto, E.; Rose, J.B. SARS-CoV-2 in wastewater: State of the knowledge and research needs. Sci. Total Environ. 2020, 739, 139076. [Google Scholar] [CrossRef] [PubMed]
- Prado, T.; Fumian, T.M.; Mannarino, C.F.; Resende, P.C.; Motta, F.C.; Eppinghaus, A.L.F.; Vale, V.H.C.D.; Braz, R.M.S.; Andrade, J.D.S.R.D.; Maranhão, A.G.; et al. Wastewater-based epidemiology as a useful tool to track SARS-CoV-2 and support public health policies at municipal level in Brazil. Water Res. 2021, 191, 116810. [Google Scholar] [CrossRef] [PubMed]
- Thompson, J.R.; Nancharaiah, Y.V.; Gu, X.; Lee, W.L.; Rajal, V.B.; Haines, M.B.; Girones, R.; Ng, L.C.; Alm, E.J.; Wuertz, S. Making waves: Wastewater surveillance of SARS-CoV-2 for population-based health management. Water Res. 2020, 184, 116181. [Google Scholar] [CrossRef] [PubMed]
- Ahmed, W.; Tscharke, B.; Bertsch, P.M.; Bibby, K.; Bivins, A.; Choi, P.; Clarke, L.; Dwyer, J.; Edson, J.; Nguyen, T.M.H.; et al. SARS-CoV-2 RNA monitoring in wastewater as a potential early warning system for COVID-19 transmission in the community: A temporal case study. Sci. Total Environ. 2020, 761, 144216. [Google Scholar] [CrossRef] [PubMed]
- Medema, G.; Heijnen, L.; Elsinga, G.; Italiaander, R.; Brouwer, A. Presence of SARS-Coronavirus-2 RNA in Sewage and Correlation with Reported COVID-19 Prevalence in the Early Stage of the Epidemic in The Netherlands. Environ. Sci. Technol. Lett. 2020, 7, 511–516. [Google Scholar] [CrossRef]
- Hasan, S.W.; Ibrahim, Y.; Daou, M.; Kannout, H.; Jan, N.; Lopes, A.; Alsafar, H.; Yousef, A.F. Detection and quantification of SARS-CoV-2 RNA in wastewater and treated effluents: Surveillance of COVID-19 epidemic in the United Arab Emirates. Sci. Total Environ. 2020, 764, 142929. [Google Scholar] [CrossRef]
- Hata, A.; Hara-Yamamura, H.; Meuchi, Y.; Imai, S.; Honda, R. Detection of SARS-CoV-2 in wastewater in Japan during a COVID-19 outbreak. Sci. Total Environ. 2020, 758, 143578. [Google Scholar] [CrossRef] [PubMed]
- La Rosa, G.; Iaconelli, M.; Mancini, P.; Ferraro, G.B.; Veneri, C.; Bonadonna, L.; Lucentini, L.; Suffredini, E. First detection of SARS-CoV-2 in untreated wastewaters in Italy. Sci. Total Environ. 2020, 736, 139652. [Google Scholar] [CrossRef]
- COVID19WBEC. COVID-19 WBE Publication Map. Available online: https://www.covid19wbec.org/publication-map (accessed on 7 February 2022).
- Heijnen, L.; Elsinga, G.; de Graaf, M.; Molenkamp, R.; Koopmans, M.P.; Medema, G. Droplet digital RT-PCR to detect SARS-CoV-2 signature mutations of variants of concern in wastewater. Sci. Total Environ. 2021, 799, 149456. [Google Scholar] [CrossRef]
- Yaniv, K.; Ozer, E.; Shagan, M.; Lakkakula, S.; Plotkin, N.; Bhandarkar, N.S.; Kushmaro, A. Direct RT-qPCR assay for SARS-CoV-2 variants of concern (Alpha, B.1.1.7 and Beta, B.1.351) detection and quantification in wastewater. Environ. Res. 2021, 201, 111653. [Google Scholar] [CrossRef]
- Caduff, L.; Dreifuss, D.; Schindler, T.; Devaux, A.J.; Ganesanandamoorthy, P.; Kull, A.; Stachler, E.; Fernandez-Cassi, X.; Beerenwinkel, N.; Kohn, T.; et al. Inferring Transmission Fitness Advantage of SARS-CoV-2 Variants of Concern in Wastewater Using Digital PCR. medRxiv 2021. [Google Scholar] [CrossRef]
- Yaniv, K.; Ozer, E.; Kushmaro, A. SARS-CoV-2 Variants of Concern, Gamma (P.1) and Delta (B.1.617), Sensitive Detection and Quantification in Wastewater Employing Direct RT-QPCR. medRxiv 2021. [Google Scholar] [CrossRef]
- Baaijens, J.A.; Zulli, A.; Ott, I.M.; Petrone, M.E.; Alpert, T.; Fauver, J.R.; Kalinich, C.C.; Vogels, C.B.F.; Breban, M.I.; Duvallet, C.; et al. Variant Abundance Estimation for SARS-CoV-2 in Wastewater Using RNA-Seq Quantification. medRxiv 2021. [Google Scholar] [CrossRef]
- Alygizakis, N.; Markou, A.N.; Rousis, N.I.; Galani, A.; Avgeris, M.; Adamopoulos, P.G.; Scorilas, A.; Lianidou, E.S.; Paraskevis, D.; Tsiodras, S.; et al. Analytical methodologies for the detection of SARS-CoV-2 in wastewater: Protocols and future perspectives. TrAC Trends Anal. Chem. 2020, 134, 116125. [Google Scholar] [CrossRef] [PubMed]
- Gibson, K.; Schwab, K.; Spencer, S.; Borchardt, M. Measuring and mitigating inhibition during quantitative real time PCR analysis of viral nucleic acid extracts from large-volume environmental water samples. Water Res. 2012, 46, 4281–4291. [Google Scholar] [CrossRef]
- Bertels, X.; Demeyer, P.; Bogaert, S.V.D.; Boogaerts, T.; van Nuijs, A.L.; Delputte, P.; Lahousse, L. Factors influencing SARS-CoV-2 RNA concentrations in wastewater up to the sampling stage: A systematic review. Sci. Total Environ. 2022, 820, 153290. [Google Scholar] [CrossRef]
- Li, B.; Deng, A.; Li, K.; Hu, Y.; Li, Z.; Shi, Y.; Xiong, Q.; Liu, Z.; Guo, Q.; Zou, L.; et al. Viral infection and transmission in a large, well-traced outbreak caused by the SARS-CoV-2 Delta variant. Nat. Commun. 2022, 13, 460. [Google Scholar] [CrossRef] [PubMed]
- Jahn, K.; Dreifuss, D.; Topolsky, I.; Kull, A.; Ganesanandamoorthy, P.; Fernandez-Cassi, X.; Bänziger, C.; Devaux, A.J.; Stachler, E.; Caduff, L.; et al. Detection and Surveillance of SARS-CoV-2 Genomic Variants in Wastewater. medRxiv 2021. [Google Scholar] [CrossRef]
- Joshi, M.; Kumar, M.; Srivastava, V.; Kumar, D.; Rathore, D.; Pandit, R.; Joshi, C.G. First Detection of SARS-CoV-2 Delta Variant (B.1.617.2) in the Wastewater of (Ahmedabad), India. medRxiv 2021. [Google Scholar] [CrossRef]
- Lin, X.; Glier, M.; Kuchinski, K.; Mierlo, T.R.-V.; McVea, D.; Tyson, J.R.; Prystajecky, N.; Ziels, R.M. Assessing Multiplex Tiling PCR Sequencing Approaches for Detecting Genomic Variants of SARS-CoV-2 in Municipal Wastewater. medRxiv 2021. [Google Scholar] [CrossRef] [PubMed]
- Pérez-Cataluña, A.; Chiner-Oms, Á.; Cuevas-Ferrando, E.; Díaz-Reolid, A.; Falcó, I.; Randazzo, W.; Girón-Guzmán, I.; Allende, A.; Bracho, M.A.; Comas, I.; et al. Detection of Genomic Variants of SARS-CoV-2 Circulating in Wastewater by High-Throughput Sequencing. medRxiv 2021. [Google Scholar] [CrossRef]
- Lee, W.L.; Gu, X.; Armas, F.; Chandra, F.; Chen, H.; Wu, F.; Leifels, M.; Xiao, A.; Desmond Chua, F.J.; Kwok, G.W.C.; et al. Quantitative SARS-CoV-2 Tracking of Variants Delta, Delta plus, Kappa and Beta in Wastewater by Allele-Specific RT-QPCR. medRxiv 2021. [Google Scholar] [CrossRef]
- Peterson, S.W.; Lidder, R.; Daigle, J.; Wonitowy, Q.; Nagasawa, A.; Mulvey, M.R.; Mangat, C.S. RT-QPCR Detection of SARS-CoV-2 Mutations S 69-70 Del, S N501Y and N D3L Associated with Variants of Concern in Canadian Wastewater Samples. medRxiv 2021. [Google Scholar] [CrossRef] [PubMed]
- Carcereny, A.; Martínez-Velázquez, A.; Bosch, A.; Allende, A.; Truchado, P.; Cascales, J.; Romalde, J.L.; Lois, M.; Polo, D.; Sánchez, G.; et al. Monitoring Emergence of SARS-CoV-2 B.1.1.7 Variant through the Spanish National SARS-CoV-2 Wastewater Surveillance System (VATar COVID-19) from December 2020 to March 2021. medRxiv 2021. [Google Scholar] [CrossRef]
- Gering, E.; Colbert, J.; Schmedes, S.; Duncan, G.; Lopez, J.; Motes, J.; Weiss, J.; Azarian, T.; Tekin, O.; Blanton, J. DdPCR Reveals SARS-CoV-2 Variants in Florida Wastewater. medRxiv 2021. [Google Scholar] [CrossRef]
- Corpuz, M.V.A.; Buonerba, A.; Vigliotta, G.; Zarra, T.; Ballesteros, F.; Campiglia, P.; Belgiorno, V.; Korshin, G.; Naddeo, V. Viruses in wastewater: Occurrence, abundance and detection methods. Sci. Total Environ. 2020, 745, 140910. [Google Scholar] [CrossRef] [PubMed]
- Boogaerts, T.; Jacobs, L.; De Roeck, N.; Bogaert, S.V.D.; Aertgeerts, B.; Lahousse, L.; van Nuijs, A.L.; Delputte, P. An alternative approach for bioanalytical assay optimization for wastewater-based epidemiology of SARS-CoV-2. Sci. Total Environ. 2021, 789, 148043. [Google Scholar] [CrossRef]
- Hokajärvi, A.-M.; Rytkönen, A.; Tiwari, A.; Kauppinen, A.; Oikarinen, S.; Lehto, K.-M.; Kankaanpää, A.; Gunnar, T.; Al-Hello, H.; Blomqvist, S.; et al. The detection and stability of the SARS-CoV-2 RNA biomarkers in wastewater influent in Helsinki, Finland. Sci. Total Environ. 2021, 770, 145274. [Google Scholar] [CrossRef]
- Korukluoglu, G.; Kolukirik, M.; Bayrakdar, F.; Ozgumus, G.G.; Altas, A.B.; Cosgun, Y.; Ketre Kolukirik, C.Z. 40 Minutes RT-QPCR Assay for Screening Spike N501Y and HV69-70del Mutations. bioRxiv 2021. [Google Scholar] [CrossRef]
- Centers for Disease Control and Prevention. Research Use Only 2019-Novel Coronavirus (2019-nCoV) Real-time RT-PCR Primers and Probes. Available online: https://www.cdc.gov/coronavirus/2019-ncov/lab/rt-pcr-panel-primer-probes.html (accessed on 6 June 2020).
- Shu, Y.; McCauley, J. GISAID: Global initiative on sharing all influenza data—From vision to reality. Eurosurveillance 2017, 22, 30494. [Google Scholar] [CrossRef] [Green Version]
- Van Poelvoorde, L.A.E.; Gand, M.; Fraiture, M.-A.; De Keersmaecker, S.C.J.; Verhaegen, B.; Van Hoorde, K.; Cay, A.B.; Balmelle, N.; Herman, P.; Roosens, N. Strategy to Develop and Evaluate a Multiplex RT-ddPCR in Response to SARS-CoV-2 Genomic Evolution. Curr. Issues Mol. Biol. 2021, 43, 1937–1949. [Google Scholar] [CrossRef] [PubMed]
- Uhlig, S.; Frost, K.; Colson, B.; Simon, K.; Mäde, D.; Reiting, R.; Gowik, P.; Grohmann, L. Validation of qualitative PCR methods on the basis of mathematical-statistical modelling of the probability of detection. Accredit. Qual. Assur. 2015, 20, 75–83. [Google Scholar] [CrossRef]
- National Reference Laboratory (UZ Leuven & KU Leuven). Genomic Surveillance of SARS-CoV-2 in Belgium; National Reference Laboratory: Brussels, Belgium, 2022. [Google Scholar]
- Baker, M. Digital PCR hits its stride. Nat. Methods 2012, 9, 541–544. [Google Scholar] [CrossRef]
- Dingle, T.; Sedlak, R.H.; Cook, L.; Jerome, K.R. Tolerance of Droplet-Digital PCR vs. Real-Time Quantitative PCR to Inhibitory Substances. Clin. Chem. 2013, 59, 1670–1672. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Suo, T.; Liu, X.; Feng, J.; Guo, M.; Hu, W.; Guo, D.; Ullah, H.; Yang, Y.; Zhang, Q.; Wang, X.; et al. ddPCR: A more accurate tool for SARS-CoV-2 detection in low viral load specimens. Emerg. Microbes Infect. 2020, 9, 1259–1268. [Google Scholar] [CrossRef] [PubMed]
- Klein, D. Quantification using real-time PCR technology: Applications and limitations. Trends Mol. Med. 2002, 8, 257–260. [Google Scholar] [CrossRef]
- Kuypers, J.; Jerome, K.R. Applications of Digital PCR for Clinical Microbiology. J. Clin. Microbiol. 2017, 55, 1621–1628. [Google Scholar] [CrossRef] [PubMed] [Green Version]
WHO Label | Pango Lineage | GISAID Clade | Key Mutations in Spike Gene [6] | Earliest Detection in Samples * |
---|---|---|---|---|
Alpha | B.1.1.7 | GRY | N501Y D614G SΔ69/70 P681H Y144 del A570D T716I S982A D1118H | United Kingdom, September 2020 |
Beta | B.1.351 | GH/501Y.V2 | N501Y E484K K417N | South Africa, May 2020 |
Gamma | P.1 | GR/501Y.V3 | N501Y E484K K417N D614G | Brazil, November 2020 |
Delta | B.1.617.2 | G/478K.V1 | P681R L452R T478K T19R Del156-157 R158G D614G D95N | India, October 2020 |
Target Gene Fragment | Primer/Probe | Final Concentration (Nm) | 5′ | Sequence | 3′ | Targeted Mutations | Amplicon Size (Bp) | Ref |
---|---|---|---|---|---|---|---|---|
Enveloppe (E) | E_Sarbeco_F | 400 | None | ACAGGTACGTTAATAGTTAATAGCGT | None | Not Applicable | 113 | [46] |
E_Sarbeco_R | 400 | None | ATATTGCAGCAGTACGCACACA | None | ||||
E_Sarbeco_P1 | 200 | /FAM/ | ACACTAGCCATCCTTACTGCGCTTCG | /ZEN//3IaBkFQ/ | ||||
Spike (S) | Del69/70-Forward | 200 | None | TCAACTCAGGACTTGTTCTTACCT | None | SΔ69/70 (drop-out signal) | 102 | [7] |
Del69/70-Reverse | 200 | None | TGGTAGGACAGGGTTATCAAAC | None | ||||
Del69/70-probe | 200 | /5HEX/ | TTCCATGCTATACATGTCTCTGGGA | /ZEN//3IaBkFQ/ | ||||
N501YMutation-Forward | 200 | None | CATATGGTTTCCAACCCACTT | None | N501Y | 82 | [45] | |
N501YMutation-Reverse | 200 | None | GGTGCATGTAGAAGTTCAAAAGAAAGT | None | ||||
N501YMutation-Probe | 200 | /5Cy5/ | TGGTGTTGGTTACCAACCATACAGAG | /3IAbRQSp/ | ||||
B1.351_Specific-Forward | 200 | None | AGATTTGCCAATAGGTATTAACATC | None | SΔ241 | 80 | [26] | |
B1.351_Specific-Reverse | 200 | None | CTGAAGAAGAATCACCAGGAGTC | None | ||||
B1.351_Specific-Probe | 200 | /5TexRd-XN/ | CTAGGTTTCAAACTTTACATAGAAGTT | /3IAbRQSp/ | ||||
B1.1.7_Specific-Forward | 200 | None | GTTCTTACCTTTCTTTTCCAATGTTAC | None | SΔ69/70 | 99 | ||
B1.1.7_Specific-Reverse | 200 | None | CCATCATTAAATGGTAGGACAGGG | None | ||||
B1.1.7_pecific-Probe | 200 | /5HEX/ | TGGTTCCATGCTATCTCTGGGACC | /ZEN//3IaBkFQ/ | ||||
Delta-F21989 | 200 | None | GTTTATTACCACAAAAACAACAAAAG | None | SΔ157 | 95 | [28] | |
Delta-R22083 | 200 | None | GGCTGAGAGACATATTCAAAAGTG | None | ||||
S157 | 200 | /5Cy5/ | TGGATGGAAAGTGGAGTTTATTCTAGT | /ZEN//3IaBkFQ/ | ||||
ORF8/Nucleocapside (N) | P.1_specific-Forward | 200 | None | CATGACGTTCGTGTTGTTTTAG | None | Insertion in 28227–28286 region | 85 | |
P.1_Specific-Reverse | 200 | None | CATTTCGCTGATTTTGGGGTCC | None | ||||
P.1.-P | 200 | /5HEX/ | TTTCATCTA/ZEN/ AACGAACAAACAAACAAACTAAAAT | /ZEN//3IaBkFQ/ |
Del69/70 | N501Y | B.1.1.7 | B.1.351 | B.1.617.2 | |
---|---|---|---|---|---|
LOD95% [95% confidence interval] | <0.5 | 0.3 [0.1; 1.7] | <0.4 | 0.4 [0.2; 1.3] | 2.9 [0.4; 20.5] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Boogaerts, T.; Van den Bogaert, S.; Van Poelvoorde, L.A.E.; El Masri, D.; De Roeck, N.; Roosens, N.H.C.; Lesenfants, M.; Lahousse, L.; Van Hoorde, K.; van Nuijs, A.L.N.; et al. Optimization and Application of a Multiplex Digital PCR Assay for the Detection of SARS-CoV-2 Variants of Concern in Belgian Influent Wastewater. Viruses 2022, 14, 610. https://doi.org/10.3390/v14030610
Boogaerts T, Van den Bogaert S, Van Poelvoorde LAE, El Masri D, De Roeck N, Roosens NHC, Lesenfants M, Lahousse L, Van Hoorde K, van Nuijs ALN, et al. Optimization and Application of a Multiplex Digital PCR Assay for the Detection of SARS-CoV-2 Variants of Concern in Belgian Influent Wastewater. Viruses. 2022; 14(3):610. https://doi.org/10.3390/v14030610
Chicago/Turabian StyleBoogaerts, Tim, Siel Van den Bogaert, Laura A. E. Van Poelvoorde, Diala El Masri, Naomi De Roeck, Nancy H. C. Roosens, Marie Lesenfants, Lies Lahousse, Koenraad Van Hoorde, Alexander L. N. van Nuijs, and et al. 2022. "Optimization and Application of a Multiplex Digital PCR Assay for the Detection of SARS-CoV-2 Variants of Concern in Belgian Influent Wastewater" Viruses 14, no. 3: 610. https://doi.org/10.3390/v14030610