Next Article in Journal
Longitudinal Analysis of Neutralizing Potency against SARS-CoV-2 in the Recovered Patients after Treatment with or without Favipiravir
Previous Article in Journal
Genomics in Plant Viral Research
Previous Article in Special Issue
Prior Methamphetamine Use Disorder History Does Not Impair Interoceptive Processing of Soft Touch in HIV Infection
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Viruses
Volume 14
Issue 4
10.3390/v14040669
viruses-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Escalated (Dependent) Oxycodone Self-Administration Is Associated with Cognitive Impairment and Transcriptional Evidence of Neurodegeneration in Human Immunodeficiency Virus (HIV) Transgenic Rats

by
Yu Fu
1,2,†,
Irene Lorrai
1,†,
Barry Zorman
3,
Daniele Mercatelli
4,
Chase Shankula
1,
Jorge Marquez Gaytan
1,
Celine Lefebvre
1,5,
Giordano de Guglielmo
6,
Hyunjae Ryan Kim
3,
Pavel Sumazin
3,
Federico M. Giorgi
4,
Vez Repunte-Canonigo
1,* and
Pietro Paolo Sanna
1,*
1
Department of Immunology and Microbiology, The Scripps Research Institute, La Jolla, San Diego, CA 92037, USA
2
European Bioinformatics Institute (EMBL-EBI), Hinxton CB10 1SD, UK
3
Department of Pediatrics, Dan L. Duncan Cancer Center, Baylor College of Medicine, Houston, TX 77030, USA
4
Department of Pharmacy and Biotechnology, University of Bologna, 40126 Bologna, Italy
5
92160 Antony, France
6
Department of Psychiatry, University of California, La Jolla, San Diego, CA 92093, USA
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Viruses 2022, 14(4), 669; https://doi.org/10.3390/v14040669
Submission received: 22 January 2022 / Revised: 2 March 2022 / Accepted: 9 March 2022 / Published: 24 March 2022
(This article belongs to the Special Issue HIV and Drugs of Abuse)
Browse Figures
Versions Notes

Abstract

:
Substance use disorder is associated with accelerated disease progression in people with human immunodeficiency virus (HIV; PWH). Problem opioid use, including high-dose opioid therapy, prescription drug misuse, and opioid abuse, is high and increasing in the PWH population. Oxycodone is a broadly prescribed opioid in both the general population and PWH. Here, we allowed HIV transgenic (Tg) rats and wildtype (WT) littermates to intravenously self-administer oxycodone under short-access (ShA) conditions, which led to moderate, stable, “recreational”-like levels of drug intake, or under long-access (LgA) conditions, which led to escalated (dependent) drug intake. HIV Tg rats with histories of oxycodone self-administration under LgA conditions exhibited significant impairment in memory performance in the novel object recognition (NOR) paradigm. RNA-sequencing expression profiling of the medial prefrontal cortex (mPFC) in HIV Tg rats that self-administered oxycodone under ShA conditions exhibited greater transcriptional evidence of inflammation than WT rats that self-administered oxycodone under the same conditions. HIV Tg rats that self-administered oxycodone under LgA conditions exhibited transcriptional evidence of an increase in neuronal injury and neurodegeneration compared with WT rats under the same conditions. Gene expression analysis indicated that glucocorticoid-dependent adaptations contributed to the gene expression effects of oxycodone self-administration. Overall, the present results indicate that a history of opioid intake promotes neuroinflammation and glucocorticoid dysregulation, and excessive opioid intake is associated with neurotoxicity and cognitive impairment in HIV Tg rats.

1. Introduction

Substance use disorder in people with human immunodeficiency virus (HIV; PWH) is associated with treatment non-compliance, an increase in viral transmission, and the clinical progression of HIV disease [1,2,3,4,5,6,7,8,9,10,11,12]. The nonmedical use of opioids has increased dramatically and is higher in North America than elsewhere in the world [13,14]. People with HIV have a higher prevalence of chronic pain [15,16,17] and are more likely to be prescribed opioids at higher doses and for longer periods of time than the general population [18,19,20,21]. Opioid use disorder (OUD) and problem opioid use, including high-dose opioid therapy and prescription drug misuse, are prevalent among PWH [22,23,24,25,26,27]. Oxycodone is among the most prescribed and misuse opioids in both the general population and PWH [15,28,29]. In a recent retrospective study, oxycodone accounted for the vast majority (71%) of 8744 opioid prescriptions in PWH [15]. In that study, 40% of opioid prescriptions were long-term (>365 days), and about half of them were chronic high-dose prescriptions [15].
Initial and occasional drug use is motivated by positive reinforcement [30]. The acute reinforcing effects of drugs of abuse are modeled by paradigms of short access (ShA) to drug self-administration [31]. In these models, rats are allowed to self-administer drugs of abuse for less than 3 h/day, producing stable levels and patterns of intake. Addiction is characterized by the loss of control in limiting intake and compulsion to take the drug [30], which can be modeled by paradigms of long access (LgA) to intravenous drug self-administration (12 h/day for opioids) [32,33,34,35,36], leading to escalated (dependent) drug intake [37]. This paradigm of escalated drug intake under LgA conditions is highly relevant to the human condition and has been suggested to model all seven criteria for drug addiction in the Diagnostic and Statistical Manual of Mental Disorders, 4th edition (DSM-IV), and seven of the 11 criteria for substance use disorder in the DSM-5 [37].
To model the effects of opioid misuse in HIV, we used HIV transgenic (Tg) rats that express multiple HIV products [38,39] and exhibit changes in gene expression that are consistent with human neuroHIV [40]. HIV Tg rats and wildtype (WT) littermates were tested for voluntary intravenous oxycodone self-administration under either ShA conditions (1 h/day), which is characterized by a nondependent “recreational”-like pattern of oxycodone use, and oxycodone self-administration under LgA conditions (12 h/day), which leads to escalated (dependent) oxycodone intake [32,41,42].
Here, we show that escalated oxycodone self-administration under LgA conditions induces cognitive impairment in HIV Tg rats. Impairments in medial prefrontal cortex (mPFC) function and frontostriatal connectivity are involved in the progression to compulsive drug intake and cognitive impairment in neuroHIV [43,44,45,46,47]. To better understand the molecular basis of detrimental interactions between HIV with excessive oxycodone intake, we profiled gene expression from the mPFC in HIV Tg and WT rats with a history of oxycodone self-administration under either ShA or LgA conditions and control littermate rats. Previous studies from our group showed that changes in gene expression that are associated with escalated cocaine, heroin, and alcohol self-administration are considerably different from changes in gene expression that are induced by a moderate “recreational”-like pattern of self-administration [31,36,48,49,50,51,52,53,54]. Gene expression analysis of the mPFC in HIV Tg rats that self-administered oxycodone under ShA conditions showed evidence of greater neuroinflammation than WT littermates that self-administered oxycodone under the same conditions. HIV Tg rats that escalated their oxycodone self-administration under LgA conditions exhibited transcriptional evidence of greater neuronal damage and neurodegeneration than WT littermates that self-administered oxycodone at comparable levels under the same conditions. Differential expression of the glucocorticoid-responsive genes Tsc22d3 (Gilz) and serum/glucocorticoid-regulated kinase 1 (Sgk1) indicated that glucocorticoid dysregulation and the neurotoxic actions of HIV products likely contribute to neurodegeneration and cognitive impairment in HIV Tg rats with a history of oxycodone self-administration.
Altogether, the present results indicate that voluntary oxycodone intake and HIV result in an increase in neuroinflammation in the mPFC in rats with a history of nondependent oxycodone self-administration under ShA conditions and neurotoxicity and neurodegeneration in rats with a history of dependent oxycodone self-administration under LgA conditions.

2. Materials and Methods

2.1. Animals

Male HIV Tg rats (n = 27) and WT littermate control rats (n = 28) that were backcrossed on a Wistar background were housed two per cage on a reverse 12 h/12 h light/dark cycle (lights off at 8:00 a.m.) in a temperature (20–22 °C) and humidity (45–55%) controlled vivarium with ad libitum access to tap water and food pellets (PJ Noyes, Lancaster, NH, USA). All of the procedures were conducted in strict adherence to the National Institutes of Health Guide for the Care and Use of Laboratory Animals and were approved by the Institutional Animal Care and Use Committee of The Scripps Research Institute. At the time of testing, the rats’ body weights ranged between 350 and 400 g.

2.2. Intravenous Catheterization

The animals were anesthetized by the inhalation of a mixture of isoflurane/oxygen, and intravenous catheters were aseptically inserted in the right jugular vein using a modified version of a procedure that was described previously [55,56]. The vein was punctured with a 22-gauge needle, and the tubing was inserted and secured inside the vein by tying the vein with suture thread. The catheter assembly consisted of an 18-cm length of Micro-Renathane tubing (0.023-inch inner diameter, 0.037-inch outer diameter; Braintree Scientific, Braintree, MA, USA) that was attached to a guide cannula (Plastics One, Roanoke, VA, USA). The guide cannula was bent at a near right angle, embedded in dental acrylic, and anchored with 2-cm square mesh. The catheter exited through a small incision on the back, and the base was sealed with a small plastic cap and metal cover cap. This design helped keep the catheter base sterile and protected. The catheters were flushed daily with heparinized saline (10 U/mL of heparin sodium; American Pharmaceutical Partners, Schaumburg, IL, USA) in 0.9% bacteriostatic sodium chloride (Hospira, Lake Forest, IL, USA) that contained 20 mg/0.2 mL of the antibiotic Timentin (GlaxoSmithKline, Middlesex, UK).

2.3. Drugs

Oxycodone HCl (National Institute on Drug Abuse, Bethesda, MD, USA) was dissolved in 0.9% saline (Hospira, Lake Forest, IL, USA) and self-administered intravenously at a dose of 0.15 mg/kg/infusion [33].

2.4. Oxycodone Self-Administration

Self-administration sessions were performed in operant conditioning chambers (Med Associates, St. Albans, VT, USA) that were enclosed in lit, sound-attenuating, ventilated environmental cubicles. The back wall of each operant chamber was illuminated by a white house light. The front panel had two retractable response levers and two cue lights above them. At the beginning of each self-administration session, the white house light was on, and the two levers were extended. Responses on the right (active) lever resulted in the delivery of 0.1 mL of oxycodone solution by the activation of an infusion pump that was outside the operant chamber. A 20 s timeout (TO) period, signaled by illumination of the cue light above the active lever, was interposed between each active lever response to avoid possible oxycodone overdose. Responses on the left (inactive) lever were recorded but did not have any scheduled consequences. Fluid delivery and responses on both levers were controlled and recorded by a computer that interfaced with each operant chamber. In the present study, the rats had access to oxycodone under a fixed-ratio 1 (FR1) schedule of reinforcement. Oxycodone was delivered at 0.15 mg/kg/0.1 mL.
After 1 week of recovery from intravenous catheterization surgery, the rats were trained to lever-press for oxycodone over 10 consecutive 1-h self-administration sessions. The rats were then allowed to self-administer oxycodone in 1 h (ShA group) or 12 h (LgA group) sessions for 21 consecutive days. The animals were then subjected to periods of forced abstinence, followed by the resumption of oxycodone self-administration under the same conditions.

2.5. Novel Object Recognition Test

The novel object recognition (NOR) test was conducted on two consecutive days in a black square arena (60 × 60 cm). On Day 1 (habituation), the rats were individually placed in the empty arena and allowed to freely explore it for 5 min. The next day (Day 2, training), two identical objects (A and A’) were placed in the arena, and the rat was allowed to freely interact with both objects for 10 min. On the same day, 1 h after training (Day 2, test), one of the familiar objects was changed to a novel object (A and B). The Recognition Index (RI), defined as the ratio between the time spent with the novel object/time spent with both objects [novel + familiar] × 100, was calculated over the 5 min test. The arena and objects were cleaned with a 70% alcohol solution before each rat underwent the NOR test.

2.6. Total RNA Isolation and RNA-Sequencing

HIV Tg and WT rats (Figure 1A–C) were sacrificed 48 h after last self-administration session. Microdissected tissue from the mPFC was processed for total RNA isolation using the mirVana miRNA Isolation Kit (ThermoFisher Scientific, Waltham, MA, USA) and Zymo Purification Kit (Zymo Research, Irvine, CA, USA). Libraries were prepared with the KAPA mRNA HyperPrep Kit for Illumina sequencing (KAPABiosystems, Wilmington, MA, USA) for mRNA capture with magnetic oligo-dT beads, cDNA synthesis, and library construction and amplification. The Poly-A libraries were subsequently sequenced on an Illumina HiSeq4000 sequencer at 30-million-read target coverage (100 bp paired-end reads).

2.7. Gene Expression Profiling and Gene Set Enrichment Analysis

The sequences were first trimmed using Trimmomatic with default setting (version 0.39). All samples passed the quality control by fastQC (version 0.11.9). Fastq files were aligned to combined rat (RatBN7.2) and HIV-1 (NC_001802) using Bowtie2 [57] with default settings. Transcript expression was normalized using RSEM (version 1.3.0) [58]. The two transcriptomes were combined as described previously [59]. The rat genome was humanized using the biomaRt package from R software. Differential expression analysis was performed using the DESeq2 package in R software (the Wald method was used). Gene Set Enrichment Analysis (GSEA) [60] was performed in R software for MSigDB-curated gene sets but excluding perturbation-based gene sets for a total of 1452 MSigDB gene sets. Multiple testing adjustment was performed using the False Discovery Rate. Fastq files were deposited in the European Nucleotide Archive project (PRJEB49963).

2.8. Quantitative Polymerase Chain Reaction Validation

Differentially expressed genes in the mPFC were validated in HIV and WT rats with or without a history of oxycodone exposure using the SYBR Green fluorescence detection kit with the CFX96 Touch real-time PCR detection system (Bio-Rad, Hercules, CA, USA). A set of optimized real-time polymerase chain reaction (RT-PCR) primer assays was designed, and the following sequences were used: TSC22D3 (GGC CCT AGA CAA GAT TGA [sense] and GCT CAC GAA TCT GCT CCT TTA [antisense]) and β-actin (AGATTACTGCCCTGGCTCCT [sense] and CAGTGAGGCCAGGATAGAGC [antisense]). Gene expression was normalized to β-actin and analyzed based on the ΔΔCT method.

3. Results

3.1. Oxycodone Self-Administration in HIV Transgenic Rats

HIV Tg rats and WT littermates were allowed to intravenously self-administer oxycodone under an FR1 schedule whereby one lever press resulted in one oxycodone injection under ShA conditions (1-h daily sessions) or under LgA conditions (12-h daily sessions; Figure 1A). HIV Tg and WT rats exhibited similar patterns of the acquisition of self-administration and oxycodone intake under both ShA (two-way repeated-measures analysis of variance [ANOVA]; genotype: F1,13 = 4.72, p > 0.05; session: F20,260 = 13.73, p < 0.0001; interaction: F20,260 = 1.060, p > 0.05) and LgA conditions (two-way repeated-measures ANOVA; genotype: F1,13 = 0.4767, p > 0.05; session: F20,260 = 13.36, p < 0.0001; interaction: F20,260 = 0.988, p > 0.05). Moreover, as expected, HIV Tg and WT rats progressively escalated their oxycodone intake over the 21 consecutive sessions of LgA (Figure 1A). After 21 sessions of oxycodone self-administration, HIV Tg and WT rats with histories of either ShA or LgA self-administration underwent a period of enforced abstinence to model the intermittent pattern of opioid misuse in humans, in which oxycodone was unavailable for 2 weeks. Following the restoration of access to self-administration, HIV Tg and WT rats under both ShA and LgA conditions promptly resumed their previous levels of self-administration, which did not differ between genotypes (two-way repeated-measure ANOVA for ShA: genotype: F1,13 = 2.013, p > 0.05; session: F9,117 = 1.525, p > 0.05; interaction: F9,117 = 0.839, p > 0.05; two-way repeated-measure ANOVA for LgA: genotype: F1,13 = 0.445, p > 0.05; session: F9,117 = 4.25, p < 0.0001; interaction: F9,117 = 1.339, p > 0.05; Figure 1B). Similar results were observed after a second period of 2 weeks of enforced abstinence (two-way repeated-measure ANOVA for ShA: genotype: F1,12 = 0.874, p > 0.05; session: F9,108 = 3.309, p > 0.05; interaction: F9,108 = 0.807, p > 0.05; two-way repeated-measures ANOVA for LgA: genotype: F1,13 = 0.257, p > 0.05; session: F9,117 = 2.219, p < 0.05; interaction: F9,117 = 1.754, p > 0.05; Figure 1C). Oxycodone self-administration was replicated in an independent set of HIV Tg and WT rats (Figure 1D). The statistical analysis indicated that both groups escalated their oxycodone intake when exposed to 21 consecutive sessions of self-administration (Figure 1), and no difference was found between genotypes (two-way repeated-measures ANOVA: genotype: F1,23 = 1.47, p > 0.05; session: F20,460 = 21.40, p < 0.0001; interaction: F20,460 = 1.13, p > 0.05; Figure 1D). Subsequently, after 4 weeks of forced abstinence, the rats were re-allowed to self-administer oxycodone, again confirming the lack of difference in drug intake over 10 consecutive sessions of LgA (two-way repeated-measures ANOVA: genotype: F1,23 = 0.3275, p > 0.05; session: F9,207 = 6.18, p < 0.0001; interaction: F9,207 = 0.721, p > 0.05; Figure 1E).
To investigate the cognitive consequences of a history of escalated (dependent) oxycodone self-administration in HIV Tg rats, we tested the rats in the NOR task [61,62] in protracted withdrawal (2 weeks) during the period of enforced abstinence after the initial 21 sessions of self-administration under LgA conditions (Figure 1F). The NOR paradigm was performed with a 1 h delay after exposure to the familiar objects. The two-way ANOVA indicated a significant effect of genotype (F1,42 = 11.25, p < 0.005) and a significant genotype × treatment interaction (F1,42 = 4.338, p < 0.05) but no effect of treatment (F1,42 = 0.878, p > 0.05). A history of escalated oxycodone self-administration did not affect the RI in WT rats. Conversely, HIV Tg rats had a lower RI compared with naive HIV Tg, naive WT rats, and WT rats with a history of oxycodone self-administration (Figure 1F).
These data indicate that a history of escalated (dependent) oxycodone self-administration is associated with impairments in working memory in the NOR paradigm in HIV Tg rats but not in WT rats, despite their comparable levels of oxycodone intake.

3.2. Gene Expression Profiling in the mPFC in HIV Tg and WT Rats That Self-Administered Oxycodone under Nondependent (ShA) and Dependent (LgA) Conditions

Genes that significantly increased in HIV Tg rats vs. WT rats that self-administered oxycodone under ShA conditions included complement component 4A and B (C4a, C4b; which is implicated in neuroinflammation and Alzheimer’s disease) [63,64], annexin A2 (Anxa2; a proinflammatory factor [65] that has been implicated in immune-mediated diseases and viral infections) [66,67], the transforming growth factor β (TGF-β) family member Bmp7, interferon-induced transmembrane protein 2 (Ifitm2), CXXC finger protein 4 (Cxxc4/Idax; a negative regulator of WNT signaling and epigenetic regulator), Igf2 (a mitogenic and neuroprotective peptide that is associated with inflammation in different settings) [68,69], insulin-like growth factor-binding protein 2 (Igfbp2), and Slc6a20 (a regulator of brain glycine and N-methyl-D-aspartate [NMDA] receptor function) [70]; Figure 2A–D, Supplemental Tables S1–S6).
The glucocorticoid-responsive gene Tsc22d3 (glucocorticoid-induced leucine zipper [Gilz]) [71] was increased in both HIV Tg rats and WT rats with histories of oxycodone self-administration under ShA conditions compared with their respective oxycodone-naive controls (Figure 3).
Genes that significantly decreased in HIV Tg rats vs. WT rats that self-administered oxycodone under ShA conditions included the epigenetic factor Mbd1, Pak6 (a member of the group B family of PAK serine/threonine kinases), Kcnt1 (which encodes a sodium-gated potassium channel that is implicated in cellular excitability and seizures) [72], and Tmem25 (a regulator of NMDA receptor function and excitability) [73].
Genes that significantly increased in HIV Tg rats vs. WT rats that escalated their oxycodone self-administration under LgA conditions included potassium voltage-gated channel interacting protein 1 (Kcnip1/Kchip1) [74], Daam2 (which encodes a protein that contributes to Wnt signaling and regenerative myelination) [75], and glial fibrillary acidic protein (Gfap; which is indicative of astrogliosis).
Genes that significantly decreased in HIV Tg rats vs. WT rats that escalated their oxycodone self-administration under LgA conditions included F-Box and WD repeat domain containing 11 (Fbxw11; also known as β-transducin repeat containing protein 2 [βTrCP2]), homolog of Slimb (Hos)), Rgs19 (G-α-interacting protein [Gaip]; a modulator of dopaminergic signaling) [76], the γ-1 isoform of casein kinase 1 (Csnk1g1; which is associated with syndromic developmental delay and autism spectrum disorder) [77], Pcdh19 (the causal gene of a form of clustering epilepsy [PCDH19-CE]) [78], the novel scaffolding receptor Dcbld2 [79], Sec31a (which was recently identified as an ortholog of the Drosophila gene by the same name, the null mutation of which was shown to cause a severe neurological syndrome) [80], the γ-aminobutyric acid receptor subunit γ-2 (Gabrg2), neurofilament medium polypeptide (NF-M), microtubule minus-end binding protein (Camsap2; which controls axon and dendrite morphogenesis) [81], and the neuronal pentraxin receptor (Nptxr).
Viruses 14 00669 g002 550
Figure 2. Gene expression profiling in the mPFC in HIV Tg and WT rats that self-administered oxycodone under nondependent (ShA) and dependent (LgA) conditions. (A) Volcano plot of changes in gene expression in the mPFC in HIV Tg rats with a history of oxycodone self-administration under ShA conditions compared with oxycodone-self-administering WT rats under the same conditions. The plots show significance (Log10 of p value) vs. fold-change (Log2) on the y and x axes, respectively. Genes that significantly increased in HIV Tg rats vs. WT rats with oxycodone self-administration under ShA conditions are indicated in red. Genes that significantly decreased are indicated in blue. (B) Volcano plot of changes in gene expression in the mPFC in HIV Tg rats with a history of oxycodone self-administration under LgA conditions compared with oxycodone-self-administering WT rats under the same conditions. Genes that significantly increased in HIV Tg rats vs. WT rats that self-administered oxycodone under LgA conditions are indicated in red. Genes that significantly decreased are indicated in blue. (C) Volcano plot of changes in gene expression in the mPFC in HIV Tg rats with a history of oxycodone self-administration under LgA conditions compared with oxycodone-naive HIV Tg rats and (D) volcano plot of changes in gene expression in the mPFC in WT rats with a history of oxycodone self-administration under LgA conditions compared with oxycodone-naive WT rats. (E) Pathway analysis by GSEA [60] of HIV Tg rats vs. WT rats that self-administered oxycodone under ShA conditions. Transcriptional evidence of an increase in neuroinflammation was seen in HIV Tg rats compared with WT rats that self-administered oxycodone under the same conditions. (F) Pathway analysis of HIV Tg rats vs. WT rats that self-administered oxycodone under LgA conditions. Transcriptional evidence of an increase in neuronal injury and neurodegeneration was seen in HIV Tg rats compared with WT rats under the same conditions. NES, normalized enrichment score [60].
Figure 2. Gene expression profiling in the mPFC in HIV Tg and WT rats that self-administered oxycodone under nondependent (ShA) and dependent (LgA) conditions. (A) Volcano plot of changes in gene expression in the mPFC in HIV Tg rats with a history of oxycodone self-administration under ShA conditions compared with oxycodone-self-administering WT rats under the same conditions. The plots show significance (Log10 of p value) vs. fold-change (Log2) on the y and x axes, respectively. Genes that significantly increased in HIV Tg rats vs. WT rats with oxycodone self-administration under ShA conditions are indicated in red. Genes that significantly decreased are indicated in blue. (B) Volcano plot of changes in gene expression in the mPFC in HIV Tg rats with a history of oxycodone self-administration under LgA conditions compared with oxycodone-self-administering WT rats under the same conditions. Genes that significantly increased in HIV Tg rats vs. WT rats that self-administered oxycodone under LgA conditions are indicated in red. Genes that significantly decreased are indicated in blue. (C) Volcano plot of changes in gene expression in the mPFC in HIV Tg rats with a history of oxycodone self-administration under LgA conditions compared with oxycodone-naive HIV Tg rats and (D) volcano plot of changes in gene expression in the mPFC in WT rats with a history of oxycodone self-administration under LgA conditions compared with oxycodone-naive WT rats. (E) Pathway analysis by GSEA [60] of HIV Tg rats vs. WT rats that self-administered oxycodone under ShA conditions. Transcriptional evidence of an increase in neuroinflammation was seen in HIV Tg rats compared with WT rats that self-administered oxycodone under the same conditions. (F) Pathway analysis of HIV Tg rats vs. WT rats that self-administered oxycodone under LgA conditions. Transcriptional evidence of an increase in neuronal injury and neurodegeneration was seen in HIV Tg rats compared with WT rats under the same conditions. NES, normalized enrichment score [60].
Viruses 14 00669 g002
Viruses 14 00669 g003 550
Figure 3. Differential expression of the glucocorticoid-responsive gene Tsc22d3 (Gilz) by histories of nondependent (ShA) and dependent (LgA) oxycodone self-administration in HIV Tg rats and WT rats. (A) RNA-sequencing expression of the glucocorticoid-responsive gene Tsc22d3 (Gilz) increased in both HIV Tg rats and WT rats with histories of oxycodone self-administration under ShA conditions compared with their respective oxycodone-naive controls, which was indicative of dysregulation of glucocorticoid-dependent gene expression associated with oxycodone self-administration. Tsc22d3 expression did not increase in HIV Tg rats or WT rats with histories of oxycodone self-administration under LgA conditions, consistent with adaptations that occur under conditions of chronic elevations of glucocorticoids [82,83] (F2,34 = 21.91, p < 0.0001, n = 6–7/group). (B) Consistent results were obtained by RT-PCR (F2,36 = 19.64, p < 0.0001, n = 7–8 /group). * p < 0.05, ** p < 0.01, *** p < 0.001 (Newman–Keuls post hoc test).
Figure 3. Differential expression of the glucocorticoid-responsive gene Tsc22d3 (Gilz) by histories of nondependent (ShA) and dependent (LgA) oxycodone self-administration in HIV Tg rats and WT rats. (A) RNA-sequencing expression of the glucocorticoid-responsive gene Tsc22d3 (Gilz) increased in both HIV Tg rats and WT rats with histories of oxycodone self-administration under ShA conditions compared with their respective oxycodone-naive controls, which was indicative of dysregulation of glucocorticoid-dependent gene expression associated with oxycodone self-administration. Tsc22d3 expression did not increase in HIV Tg rats or WT rats with histories of oxycodone self-administration under LgA conditions, consistent with adaptations that occur under conditions of chronic elevations of glucocorticoids [82,83] (F2,34 = 21.91, p < 0.0001, n = 6–7/group). (B) Consistent results were obtained by RT-PCR (F2,36 = 19.64, p < 0.0001, n = 7–8 /group). * p < 0.05, ** p < 0.01, *** p < 0.001 (Newman–Keuls post hoc test).
Viruses 14 00669 g003
Sgk1, a glucocorticoid-responsive gene that has been implicated in Alzheimer’s disease and Parkinson’s disease [84,85], was elevated in HIV Tg rats vs. WT rats that escalated their oxycodone self-administration under LgA conditions (Figure 1B). Sgk1 was also elevated in both HIV and WT rats that self-administered oxycodone under ShA conditions compared with their respective oxycodone-naive control littermates (Supplemental Tables). Tsc22d3 (GILZ) was not differentially regulated in HIV Tg rats and WT rats with histories of oxycodone self-administration under LgA conditions (Figure 3), presumably indicating an adaptation to chronic glucocorticoid dysregulation, consistent with conditions that are characterized by chronically elevated glucocorticoids [82,83]. Differential regulation of the glucocorticoid-responsive genes Tsc22d3 and Sgk1 suggests a role for glucocorticoids in changes in gene expression that are caused by a history of oxycodone self-administration.

3.3. Transcriptional Evidence of Increases in Neuroinflammation, Neuronal Injury, and Neurodegeneration in HIV Tg Rats with a History of Oxycodone Self-Administration

Pathway analysis was conducted by GSEA [60]. This method determines whether a gene set shows a significant concordant expression difference between two conditions, demonstrated by asymmetric distribution toward one of the two experimental conditions of the running enrichment score plot [60]. Pathways that are indicative of general immune activation, inflammation, and greater cytokine signaling were differentially activated in HIV Tg rats vs. WT rats that self-administered oxycodone under ShA conditions (Figure 2E and Figure 4). GSEA demonstrated differences in the regulation of pathways that are involved in neurodegeneration between HIV Tg rats and WT rats that self-administered oxycodone under LgA conditions, suggesting the differential activation of pathogenic mechanisms (Figure 2F, Figure 5 and Figure 6). Glucocorticoid-regulated genes showed greater adaptations in HIV Tg rats with a history of dependent (LgA) oxycodone self-administration (Figure 6A). We also observed the broad downregulation of neurodegeneration-related genes, including genes that are regulated by Nfat3, which is implicated in neuronal survival [86,87], synaptodendritic genes, and other genes that are involved in neuronal communication and neural plasticity (Figure 6B–E).

4. Discussion

Opioid use disorder has been shown to be associated with impairments in various cognitive domains, including working memory, executive function, and impulsivity [89,90]. Clinical evidence indicates that opioid misuse can promote cognitive impairment in PWH [91,92,93,94]. In the CNS HIV Antiretroviral Therapy Effects Research (CHARTER) study, lifetime heroin use was associated with worse recall and working memory [94].
Oxycodone and hydrocodone are the most prescribed Schedule II opioids [95,96]. Oxycodone and hydrocodone are powerful painkillers and among the most widely misused prescription drugs [95,96,97,98]. Oxycodone is among the most prescribed opioids in PWH [15].
Here, we found that HIV Tg rats that self-administered oxycodone under LgA conditions that led to escalated (dependent) drug intake exhibited significant impairments in working memory performance in the NOR paradigm compared with WT rats that self-administered oxycodone under the same conditions. However, oxycodone had comparable reinforcing potential in HIV Tg and WT rats, unlike methamphetamine self-administration, whereby HIV Tg rats exhibited an increase in methamphetamine intake under LgA conditions [99].
Working memory is the most commonly affected cognitive executive function among PWH [100]. The NOR paradigm is an established working memory paradigm that is sensitive to impairments in brain regions that are involved in memory, including the hippocampus and entorhinal, perirhinal, parahippocampal, and prefrontal cortices, among others [61,62]. The NOR paradigm does not involve rewards; instead, animals explore the novel object as part of their natural propensity toward novelty [61]. The NOR paradigm has been used to study working memory deficits that are induced by HIV products, such as Tat [101,102], and working memory deficits in HIV Tg rats [103].
The mPFC in rodents is a key region in working memory and cognitive flexibility [104,105,106]. Here, we found that gene expression profiling of the mPFC showed transcriptional evidence of an increase in inflammation in HIV Tg rats that self-administered oxycodone under ShA conditions compared with WT rats that self-administered oxycodone under the same conditions. In HIV Tg rats that self-administered oxycodone under LgA conditions, gene expression profiling showed transcriptional evidence of an increase in neuronal injury compared with WT rats that self-administered oxycodone under the same conditions.
Opioids have complex actions on inflammation and immune system activation. Morphine exposure has been shown to amplify microglial activation by lipopolysaccharide [107,108]. Morphine exposure exacerbates Tat-induced microglial activation in vitro [109] and in vivo [110] following short-term exposure. Morphine potentiates the release of cytokines by microglia and other cells that are exposed in vitro to lipopolysaccharide [107,108,111,112] or Tat [109]. The morphine-induced potentiation of cytokine production has been shown to be dose-dependent, and it was reduced at higher morphine concentrations [111,112]. The latter is consistent with the dose-dependent immunosuppressive actions of opioids [113,114].
We found that mRNA expression of the glucocorticoid responsive gene Tsc22d3 (Gilz) increased in nondependent HIV Tg rats and WT rats under ShA conditions but was not different from control values in both oxycodone-dependent HIV Tg and WT rats under LgA conditions. Tsc22d3 is induced by glucocorticoids [71]. However, brain Tsc22d3 is not increased in conditions that are associated with chronic glucocorticoid activation, such as chronic stress [82] and major depressive disorder [83]. Tsc22d3 contributes to the anti-inflammatory effects of glucocorticoids by inhibiting key proinflammatory transcription factors, such as nuclear factor-κB and adaptor protein-1, and modulates macrophage polarization [71,115,116,117,118,119]. Lower Tsc22d3 and inflammatory gene expression in oxycodone-dependent rats in the present study may be a glucocorticoid-related adaptive response in rats with escalated oxycodone intake that are exposed to high levels of the drug. Consistent with this view, the glucocorticoid-responsive gene Sgk1 was elevated in both HIV Tg and WT rats that self-administered oxycodone under both LgA and ShA conditions compared with their respective oxycodone-naive control littermates.
Cognitive impairment and evidence of an increase in neuronal injury in HIV Tg rats that self-administered oxycodone under LgA conditions may result from the interaction between HIV products and high doses of opioids and glucocorticoid dysregulation. Elevated glucocorticoid levels were also seen in Tat Tg mice that were exposed to oxycodone [120]. An increase in neuronal toxicity by exposure to morphine and Tat has been shown in in vitro model systems [121,122]. Moreover, opioid misuse is associated with cognitive impairments in the general population [89,90] and PWH [91,92,93,94]. Elevated plasma glucocorticoids are also associated with impairments in working memory in humans [123,124,125]. Prolonged hypercortisolemia induces mPFC and hippocampal impairments [126,127,128,129,130,131,132,133,134,135] and memory deficits [136,137,138]. Elevated cortisol levels are seen in neurodegenerative conditions, including Alzheimer’s disease, Parkinson’s disease, and Huntington’s disease, suggesting a general role for chronic activation of the hypothalamic–pituitary–adrenal (HPA) axis in neurodegeneration [139,140,141,142,143]. In human Alzheimer’s disease, plasma cortisol levels correlate with the degree of cognitive impairment, suggesting that HPA axis hyperactivity contributes to the progression of cognitive decline [142,144,145]. The glucocorticoid-responsive gene SGK1 has been implicated in Alzheimer’s disease and Parkinson’s disease [84,85]. Aging is also associated with an increase in cortisol [146]. Rodents that are exposed to chronic stress exhibit reductions of glutamate receptor expression, reductions of markers of synaptic plasticity, and the atrophy of pyramidal cell dendrites in the mPFC [106,147,148,149].
Thus, an increase in inflammation in HIV Tg rats vs. WT rats that self-administered oxycodone under ShA conditions likely resulted from the combination of proinflammatory actions of HIV products with proinflammatory actions of opioids at lower levels of exposure [111,112]. In rats with escalated oxycodone intake under LgA conditions, the immunosuppressive [113,114] and neurotoxic [121,122] effects of high doses of opioids may predominate and be additive with the neurotoxic [123,124,125,126,127,128,129,130,131,132,133,134,135,136,137,138,139,140,141,142,143,144,145] and immunosuppressive [150] actions of glucocorticoids.
In conclusion, we provide transcriptional evidence of an increase in immune activation and neuroinflammation in HIV Tg rats vs. WT littermate control rats with histories of oxycodone self-administration under limited access (ShA) conditions, which leads to a moderate, stable, “recreational”-like level of oxycodone intake. In HIV Tg rats with histories of oxycodone self-administration under conditions of extended (LgA) access to self-administration, which led to considerably higher levels of oxycodone intake, we found transcriptional evidence of an increase in neuronal injury and neurodegeneration and significant impairments in memory performance in the NOR paradigm compared with WT rats that self-administered oxycodone under the same conditions. Transcriptional evidence of glucocorticoid dysregulation was seen in both HIV Tg rats and WT rats that self-administered oxycodone. The neurotoxic actions of HIV products, together with glucocorticoid-dependent adaptations, likely contribute to cognitive impairments in oxycodone-dependent HIV Tg rats.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/v14040669/s1: Supplemental Table S1: Differential expression of oxycodone-dependent HIV Tg rats vs. WT rats (DE_HIV_D_WT_D), Supplemental Table S2: Differential expression of oxycodone nondependent HIV Tg rats vs. WT rats (DE_HIV_ND_WT_ND), Supplemental Table S3: Differential expression of oxycodone nondependent WT rats vs. oxycodone-naive WT rats (DE_WT_ND_WT_N), Supplemental Table S4: Differential expression of oxycodone nondependent (ND) HIV Tg rats vs. oxycodone-naive (N) HIV Tg rats (DE_HIV_ND_HIV_N), Supplemental Table S5: Differential expression of oxycodone-dependent WT rats vs. oxycodone-naive WT rats (DE_WT_D_WT_N), Supplemental Table S6: Differential expression of oxycodone-dependent HIV Tg rats vs. oxycodone-naive HIV Tg rats (DE_HIV_D_HIV_N).

Author Contributions

Conceptualization, P.P.S. and V.R.-C.; methodology and analysis, Y.F., I.L., B.Z., D.M., C.S., J.M.G., G.d.G., H.R.K., P.S., F.M.G. and C.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by National Institutes of Health grants DA043268, DA048882, DA046170, DA053801, and DA046204.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Fastq files were deposited in the European Nucleotide Archive project PRJEB49963.

Acknowledgments

Supported by National Institutes of Health grants DA043268, DA048882, DA046170, DA053801, and DA046204. The authors thank Michael Arends for proofreading the manuscript.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Nath, A. Human immunodeficiency virus-associated neurocognitive disorder: Pathophysiology in relation to drug addiction. Ann. N. Y. Acad. Sci. 2010, 1187, 122–128. [Google Scholar] [CrossRef] [PubMed]
  2. Goodkin, K.; Shapshak, P.; Metsch, L.R.; McCoy, C.B.; Crandall, K.A.; Kumar, M.; Fujimura, R.K.; McCoy, V.; Zhang, B.T.; Reyblat, S.; et al. Cocaine abuse and HIV-1 infection: Epidemiology and neuropathogenesis. J. Neuroimmunol. 1998, 83, 88–101. [Google Scholar] [CrossRef]
  3. Bing, E.G.; Burnam, M.A.; Longshore, D.; Fleishman, J.A.; Sherbourne, C.D.; London, A.S.; Turner, B.J.; Eggan, F.; Beckman, R.; Vitiello, B.; et al. Psychiatric Disorders and Drug Use among Human Immunodeficiency Virus–Infected Adults in the United States. Arch. Gen. Psychiatry 2001, 58, 721–728. [Google Scholar] [CrossRef]
  4. Galvan, F.H.; Bing, E.G.; Fleishman, J.A.; London, A.S.; Caetano, R.; Burnam, M.A.; Longshore, D.; Morton, S.C.; Orlando, M.; Shapiro, M. The prevalence of alcohol consumption and heavy drinking among people with HIV in the United States: Results from the HIV Cost and Services Utilization Study. J. Stud. Alcohol 2002, 63, 179–186. [Google Scholar] [CrossRef] [PubMed]
  5. Lucas, G.M.; Cheever, L.W.; Chaisson, R.E.; Moore, R.D. Detrimental effects of continued illicit drug use on the treatment of HIV-1 infection. J. Acquir. Immune. Defic. Syndr. 2001, 27, 251–259. [Google Scholar] [CrossRef] [PubMed]
  6. Lucas, G.M.; Gebo, K.A.; Chaisson, R.E.; Moore, R.D. Longitudinal assessment of the effects of drug and alcohol abuse on HIV-1 treatment outcomes in an urban clinic. AIDS 2002, 16, 767–774. [Google Scholar] [CrossRef]
  7. Lucas, G.M.; Griswold, M.; Gebo, K.A.; Keruly, J.; Chaisson, R.E.; Moore, R.D. Illicit Drug Use and HIV-1 Disease Progression: A Longitudinal Study in the Era of Highly Active Antiretroviral Therapy. Am. J. Epidemiol. 2006, 163, 412–420. [Google Scholar] [CrossRef] [Green Version]
  8. Volkow, N.D.; Wang, G.-J.; Fowler, J.S.; Telang, F.; Jayne, M.; Wong, C. Stimulant-Induced Enhanced Sexual Desire as a Potential Contributing Factor in HIV Transmission. Am. J. Psychiatry 2007, 164, 157–160. [Google Scholar] [CrossRef]
  9. Nelson, K.E.; Galai, N.; Safaeian, M.; Strathdee, S.A.; Celentano, D.D.; Vlahov, D. Temporal trends in the incidence of human immunodeficiency virus infection and risk behavior among injection drug users in Baltimore, Maryland, 1988–1998. Am. J. Epidemiol. 2002, 156, 641–653. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  10. Scott, J.C.; Woods, S.P.; Matt, G.E.; Meyer, R.A.; Heaton, R.K.; Atkinson, J.H.; Grant, I. Neurocognitive Effects of Methamphetamine: A Critical Review and Meta-analysis. Neuropsychol. Rev. 2007, 17, 275–297. [Google Scholar] [CrossRef]
  11. Chana, G.; Everall, I.P.; Crews, L.; Langford, D.; Adame, A.; Grant, I.; Cherner, M.; Lazzaretto, D.; Heaton, R.; Ellis, R.; et al. Cognitive deficits and degeneration of interneurons in HIV+ methamphetamine users. Neurology 2006, 67, 1486–1489. [Google Scholar] [CrossRef] [PubMed]
  12. Cadet, J.L.; Krasnova, I.N. Interactions of HIV and methamphetamine: Cellular and molecular mechanisms of toxicity potentiation. Neurotox. Res. 2007, 12, 181–204. [Google Scholar] [CrossRef] [PubMed]
  13. Volkow, N.D.; McLellan, T.A. Curtailing diversion and abuse of opioid analgesics without jeopardizing pain treatment. JAMA 2011, 305, 1346–1347. [Google Scholar] [CrossRef]
  14. Han, B.; Volkow, N.D.; Compton, W.M.; McCance-Katz, E.F. Reported Heroin Use, Use Disorder, and Injection among Adults in the United States, 2002–2018. JAMA 2020, 323, 568–571. [Google Scholar] [CrossRef] [PubMed]
  15. Ventuneac, A.; Hecht, G.; Forcht, E.; Duah, B.A.; Tarar, S.; Langenbach, B.; Gates, J.; Cain, D.; Rendina, H.J.; Aberg, J.A.; et al. Chronic High Risk Prescription Opioid Use among Persons with HIV. Front. Sociol. 2021, 6, 104. [Google Scholar] [CrossRef]
  16. Parker, R.; Stein, D.J.; Jelsma, J. Pain in people living with HIV/AIDS: A systematic review. J. Int. AIDS Soc. 2014, 17, 18719. [Google Scholar] [CrossRef]
  17. Miaskowski, C.; Penko, J.M.; Guzman, D.; Mattson, J.E.; Bangsberg, D.R.; Kushel, M.B. Occurrence and Characteristics of Chronic Pain in a Community-Based Cohort of Indigent Adults Living with HIV Infection. J. Pain 2011, 12, 1004–1016. [Google Scholar] [CrossRef] [Green Version]
  18. Merlin, J.S.; Long, D.; Becker, W.C.; Cachay, E.R.; Christopoulos, K.A.; Claborn, K.; Crane, H.M.; Edelman, E.J.; Harding, R.; Kertesz, S.G.; et al. Brief Report: The Association of Chronic Pain and Long-Term Opioid Therapy with HIV Treatment Outcomes. JAIDS J. Acquir. Immune Defic. Syndr. 2018, 79, 77–82. [Google Scholar] [CrossRef]
  19. Lemons, A.; DeGroote, N.; Peréz, A.; Craw, J.; Nyaku, M.; Broz, D.; Mattson, C.L.; Beer, L. Opioid Misuse among HIV-Positive Adults in Medical Care: Results from the Medical Monitoring Project, 2009–2014. JAIDS J. Acquir. Immune Defic. Syndr. 2019, 80, 127–134. [Google Scholar] [CrossRef]
  20. Canan, C.E.; Chander, G.; Monroe, A.K.; Gebo, K.A.; Moore, R.D.; Agwu, A.L.; Alexander, G.C.; Lau, B.; For the HIV Research Network. High-Risk Prescription Opioid Use among People Living with HIV. JAIDS J. Acquir. Immune Defic. Syndr. 2018, 78, 283–290. [Google Scholar] [CrossRef]
  21. Canan, C.; Alexander, G.C.; Moore, R.; Murimi, I.; Chander, G.; Lau, B. Medicaid trends in prescription opioid and non-opioid use by HIV status. Drug Alcohol Depend. 2019, 197, 141–148. [Google Scholar] [CrossRef] [PubMed]
  22. Becker, W.C.; Gordon, K.; Jennifer Edelman, E.; Kerns, R.D.; Crystal, S.; Dziura, J.D.; Fiellin, L.E.; Gordon, A.J.; Goulet, J.L.; Justice, A.C.; et al. Trends in Any and High-Dose Opioid Analgesic Receipt among Aging Patients with and without HIV. AIDS Behav. 2016, 20, 679–686. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Vijayaraghavan, M.; Freitas, D.; Bangsberg, D.R.; Miaskowski, C.; Kushel, M.B. Non-medical use of non-opioid psychotherapeutic medications in a community-based cohort of HIV-infected indigent adults. Drug Alcohol Depend. 2014, 143, 263–267. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Robinson-Papp, J.; Elliott, K.; Simpson, D.M.; Morgello, S.; Manhattan HIV Brain Bank. Problematic prescription opioid use in an HIV-infected cohort: The importance of universal toxicology testing. J. Acquir. Immune. Defic. Syndr. 2012, 61, 187–193. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  25. Tsao, J.C.I.; Plankey, M.W.; Young, M.A. Pain, psychological symptoms and prescription drug misuse in HIV: A literature review. J. Pain Manag. 2012, 5, 111–118. [Google Scholar] [PubMed]
  26. Hartzler, B.; Dombrowski, J.C.; Crane, H.M.; Eron, J.J.; Geng, E.H.; Mathews, W.C.; Mayer, K.H.; Moore, R.D.; Mugavero, M.J.; Napravnik, S.; et al. Prevalence and Predictors of Substance Use Disorders among HIV Care Enrollees in the United States. AIDS Behav. 2016, 21, 1138–1148. [Google Scholar] [CrossRef] [PubMed]
  27. Edelman, E.J.; Gordon, K.; Becker, W.C.; Goulet, J.L.; Skanderson, M.; Gaither, J.R.; Braden, J.B.; Gordon, A.J.; Kerns, R.D.; Justice, A.C.; et al. Receipt of Opioid Analgesics by HIV-Infected and Uninfected Patients. J. Gen. Intern. Med. 2012, 28, 82–90. [Google Scholar] [CrossRef] [Green Version]
  28. Bose, J.; Hedden, S.; Lipari, R.; Park-Lee, E. Substance Abuse and Mental Health Services Administration. In Key Substance Use and Mental Health Indicators in the United States: Results from the 2017 National Survey on Drug Use and Health (HHS Publication No. SMA 18-5068, NSDUH Series H-53); Center for Behavioral Health Statistics and Quality, Substance Abuse and Mental Health Services Administration: Rockville, MD, USA, 2018. [Google Scholar]
  29. Tarasuk, J.; Ogunnaike-Cooke, S.; Archibald, C.; MacLean, R.; Bennett, R.; Kim, J.; Malloch, L. I-Track Principal Investigators Key findings from a national enhanced HIV surveillance system: 2010–2012. Can. Commun. Dis. Rep. 2014, 40, 397–407. [Google Scholar] [CrossRef] [PubMed]
  30. Koob, G.F.; Le Moal, M. Plasticity of reward neurocircuitry and the ’dark side’ of drug addiction. Nat. Neurosci. 2005, 8, 1442–1444. [Google Scholar] [CrossRef] [PubMed]
  31. Koob, G.F.; Ahmed, S.H.; Boutrel, B.; Chen, S.A.; Kenny, P.J.; Markou, A.; O’Dell, L.E.; Parsons, L.H.; Sanna, P.P. Neurobiological mechanisms in the transition from drug use to drug dependence. Neurosci. Biobehav. Rev. 2004, 27, 739–749. [Google Scholar] [CrossRef] [PubMed]
  32. De Guglielmo, G.; Kallupi, M.; Sedighim, S.; Newman, A.H.; George, O. Dopamine D3 Receptor Antagonism Reverses the Escalation of Oxycodone Self-administration and Decreases Withdrawal-Induced Hyperalgesia and Irritability-Like Behavior in Oxycodone-Dependent Heterogeneous Stock Rats. Front. Behav. Neurosci. 2020, 13, 292. [Google Scholar] [CrossRef] [Green Version]
  33. Wade, C.L.; Vendruscolo, L.F.; Schlosburg, J.E.; Hernandez, D.O.; Koob, G.F. Compulsive-Like Responding for Opioid Analgesics in Rats with Extended Access. Neuropsychopharmacology 2014, 40, 421–428. [Google Scholar] [CrossRef] [Green Version]
  34. Vendruscolo, L.F.; Schlosburg, J.E.; Misra, K.K.; Chen, S.A.; Greenwell, T.N.; Koob, G.F. Escalation patterns of varying periods of heroin access. Pharmacol. Biochem. Behav. 2011, 98, 570–574. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  35. Ahmed, S.H.; Walker, J.R.; Koob, G.F. Persistent Increase in the Motivation to Take Heroin in Rats with a History of Drug Escalation. Neuropsychopharmacology 2000, 22, 413–421. [Google Scholar] [CrossRef] [Green Version]
  36. Francesconi, W.; Berton, F.; Repunte-Canonigo, V.; Hagihara, K.; Thurbon, D.; Lekic, D.; Specio, S.E.; Greenwell, T.; Chen, S.A.; Rice, K.C.; et al. Protracted Withdrawal from Alcohol and Drugs of Abuse Impairs Long-Term Potentiation of Intrinsic Excitability in the Juxtacapsular Bed Nucleus of the Stria Terminalis. J. Neurosci. 2009, 29, 5389–5401. [Google Scholar] [CrossRef] [Green Version]
  37. George, O.; Koob, G.F.; Vendruscolo, L.F. Negative reinforcement via motivational withdrawal is the driving force behind the transition to addiction. Psychopharmacology 2014, 231, 3911–3917. [Google Scholar] [CrossRef] [Green Version]
  38. Reid, W.; Sadowska, M.; Denaro, F.; Rao, S.; Foulke, J., Jr.; Hayes, N.; Jones, O.; Doodnauth, D.; Davis, H.; Sill, A.; et al. An HIV-1 transgenic rat that develops HIV-related pathology and immunologic dysfunction. Proc. Natl. Acad. Sci. USA 2001, 98, 9271–9276. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  39. Royal, W., III; Zhang, L.; Guo, M.; Jones, O.; Davis, H.; Bryant, J.L. Immune activation, viral gene product expression and neurotoxicity in the HIV-1 transgenic rat. J. Neuroimmunol. 2012, 247, 16–24. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  40. Repunte-Canonigo, V.; Lefebvre, C.; George, O.; Kawamura, T.; Morales, M.; Koob, G.F.; Califano, A.; Masliah, E.; Sanna, P.P. Gene expression changes consistent with neuroAIDS and impaired working memory in HIV-1 transgenic rats. Mol. Neurodegener. 2014, 9, 26. [Google Scholar] [CrossRef] [Green Version]
  41. Kallupi, M.; Carrette, L.L.G.; Kononoff, J.; Solberg Woods, L.C.; Palmer, A.A.; Schweitzer, P.; George, O.; de Guglielmo, G. Nociceptin attenuates the escalation of oxycodone self-administration by normalizing CeA-GABA transmission in highly addicted rats. Proc. Natl. Acad. Sci. USA 2020, 117, 2140–2148. [Google Scholar] [CrossRef] [Green Version]
  42. Kimbrough, A.; Kononoff, J.; Simpson, S.; Kallupi, M.; Sedighim, S.; Palomino, K.; Conlisk, D.; Momper, J.D.; de Guglielmo, G.; George, O. Oxycodone self-administration and withdrawal behaviors in male and female Wistar rats. Psychopharmacology 2020, 237, 1545–1555. [Google Scholar] [CrossRef] [PubMed]
  43. Ipser, J.C.; Brown, G.G.; Bischoff-Grethe, A.; Connolly, C.G.; Ellis, R.J.; Heaton, R.K.; Grant, I. Translational Methamphetamine AIDS Research Center (TMARC) Group HIV Infection Is Associated with Attenuated Frontostriatal Intrinsic Connectivity: A Preliminary Study. J. Int. Neuropsychol. Soc. 2015, 21, 203–213. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  44. Volkow, N.D.; Morales, M. The Brain on Drugs: From Reward to Addiction. Cell 2015, 162, 712–725. [Google Scholar] [CrossRef] [Green Version]
  45. Plessis, S.D.; Vink, M.; Joska, J.A.; Koutsilieri, E.; Stein, D.J.; Emsley, R. HIV infection and the fronto-striatal system: A systematic review and meta-analysis of fMRI studies. AIDS 2014, 28, 803–811. [Google Scholar] [CrossRef]
  46. Feil, J.; Sheppard, D.; Fitzgerald, P.B.; Yücel, M.; Lubman, D.I.; Bradshaw, J.L. Addiction, compulsive drug seeking, and the role of frontostriatal mechanisms in regulating inhibitory control. Neurosci. Biobehav. Rev. 2010, 35, 248–275. [Google Scholar] [CrossRef] [PubMed]
  47. Koob, G.F.; Volkow, N.D. Neurobiology of addiction: A neurocircuitry analysis. Lancet Psychiatry 2016, 3, 760–773. [Google Scholar] [CrossRef]
  48. Ahmed, S.H.; Lutjens, R.; van der Stap, L.D.; Lekic, D.; Romano-Spica, V.; Morales, M.; Koob, G.F.; Repunte-Canonigo, V.; Sanna, P.P. Gene expression evidence for remodeling of lateral hypothalamic circuitry in cocaine addiction. Proc. Natl. Acad. Sci. USA 2005, 102, 11533–11538. [Google Scholar] [CrossRef] [Green Version]
  49. Chen, J.; Repunte-Canonigo, V.; Kawamura, T.; Lefebvre, C.; Shin, W.; Howell, L.L.; Hemby, S.E.; Harvey, B.K.; Califano, A.; Morales, M.; et al. Hypothalamic proteoglycan syndecan-3 is a novel cocaine addiction resilience factor. Nat. Commun. 2013, 4, 1955. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  50. Repunte-Canonigo, V.; Chen, J.; Lefebvre, C.; Kawamura, T.; Kreifeldt, M.; Basson, O.; Roberts, A.J.; Sanna, P.P. MeCP2 regulates ethanol sensitivity and intake. Addict. Biol. 2013, 19, 791–799. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  51. Repunte-Canonigo, V.; Berton, F.; Cottone, P.; Reifel-Miller, A.; Roberts, A.J.; Morales, M.; Francesconi, W.; Sanna, P.P. A potential role for adiponectin receptor 2 (AdipoR2) in the regulation of alcohol intake. Brain Res. 2010, 1339, 11–17. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  52. Repunte-Canonigo, V.; Lutjens, R.; van der Stap, L.D.; Sanna, P.P. Increased expression of protein kinase A inhibitor α (PKI-α) and decreased PKA-regulated genes in chronic intermittent alcohol exposure. Brain Res. 2007, 1138, 48–56. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  53. Repunte-Canonigo, V.; Shin, W.; Vendruscolo, L.F.; Lefebvre, C.; Van Der Stap, L.; Kawamura, T.; Schlosburg, J.E.; Alvarez, M.; Koob, G.F.; Califano, A.; et al. Identifying candidate drivers of alcohol dependence-induced excessive drinking by assembly and interrogation of brain-specific regulatory networks. Genome Biol. 2015, 16, 68. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  54. Repunte-Canonigo, V.; van der Stap, L.D.; Chen, J.; Sabino, V.; Wagner, U.; Zorrilla, E.P.; Schumann, G.; Roberts, A.J.; Sanna, P.P. Genome-wide gene expression analysis identifies K-ras as a regulator of alcohol intake. Brain Res. 2010, 1339, 1–10. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  55. Caine, S.B.; Koob, G.F. Modulation of Cocaine Self-Administration in the Rat Through D-3 Dopamine Receptors. Science 1993, 260, 1814–1816. [Google Scholar] [CrossRef] [Green Version]
  56. De Guglielmo, G.; Cippitelli, A.; Somaini, L.; Gerra, G.; Li, H.; Stopponi, S.; Ubaldi, M.; Kallupi, M.; Ciccocioppo, R. Pregabalin reduces cocaine self-administration and relapse to cocaine seeking in the rat. Addict. Biol. 2012, 18, 644–653. [Google Scholar] [CrossRef]
  57. Langmead, B.; Trapnell, C.; Pop, M.; Salzberg, S.L. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol. 2009, 10, R25. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  58. Li, B.; Dewey, C.N. RSEM: Accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinform. 2011, 12, 323. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  59. Fu, Y.; Zorman, B.; Sumazin, P.; Sanna, P.P.; Repunte-Canonigo, V. Epitranscriptomics: Correlation of N6-methyladenosine RNA methylation and pathway dysregulation in the hippocampus of HIV transgenic rats. PLoS ONE 2019, 14, e0203566. [Google Scholar] [CrossRef] [Green Version]
  60. Subramanian, A.; Tamayo, P.; Mootha, V.K.; Mukherjee, S.; Ebert, B.L.; Gillette, M.A.; Paulovich, A.; Pomeroy, S.L.; Golub, T.R.; Lander, E.S.; et al. Gene set enrichment analysis: A knowledge-based approach for interpreting genome-wide expression profiles. Proc. Natl. Acad. Sci. USA 2005, 102, 15545–15550. [Google Scholar] [CrossRef] [Green Version]
  61. Antunes, M.; Biala, G. The novel object recognition memory: Neurobiology, test procedure, and its modifications. Cogn. Process. 2012, 13, 93–110. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  62. Cohen, S.J.; Stackman, R.W., Jr. Assessing rodent hippocampal involvement in the novel object recognition task. A review. Behav. Brain Res. 2015, 285, 105–117. [Google Scholar] [CrossRef] [PubMed]
  63. Zorzetto, M.; Datturi, F.; Divizia, L.; Pistono, C.; Campo, I.; De Silvestri, A.; Cuccia, M.; Ricevuti, G. Complement C4A and C4B Gene Copy Number Study in Alzheimer’s Disease Patients. Curr. Alzheimer. Res. 2017, 14, 303–308. [Google Scholar] [CrossRef]
  64. Bennett, S.; Grant, M.; Creese, A.J.; Mangialasche, F.; Cecchetti, R.; Cooper, H.J.; Mecocci, P.; Aldred, S. Plasma levels of complement 4a protein are increased in Alzheimer’s disease. Alzheimer. Dis. Assoc. Disord. 2012, 26, 329–334. [Google Scholar] [CrossRef]
  65. Haridas, V.; Shetty, P.; Sarathkumar, E.; Bargale, A.; Vishwanatha, J.; Patil, V.; Dinesh, U.S. Reciprocal regulation of pro-inflammatory Annexin A2 and anti-inflammatory Annexin A1 in the pathogenesis of rheumatoid arthritis. Mol. Biol. Rep. 2018, 46, 83–95. [Google Scholar] [CrossRef] [PubMed]
  66. Dallacasagrande, V.; Hajjar, K.A. Annexin A2 in Inflammation and Host Defense. Cells 2020, 9, 1499. [Google Scholar] [CrossRef] [PubMed]
  67. Liu, N.; Han, J.; Li, Y.; Jiang, Y.; Shi, S.X.; Lok, J.; Whalen, M.; Dumont, A.S.; Wang, X. Recombinant annexin A2 inhibits peripheral leukocyte activation and brain infiltration after traumatic brain injury. J. Neuroinflamm. 2021, 18, 173. [Google Scholar] [CrossRef] [PubMed]
  68. Zieker, J.; Zieker, D.; Jatzko, A.; Dietzsch, J.; Nieselt, K.; Schmitt, A.; Bertsch, T.; Fassbender, K.; Spanagel, R.; Northoff, H.; et al. Differential gene expression in peripheral blood of patients suffering from post-traumatic stress disorder. Mol. Psychiatry 2007, 12, 116–118. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  69. Pardo, M.; Cheng, Y.; Sitbon, Y.; Lowell, J.; Grieco, S.; Worthen, R.; Desse, S.; Barreda-Diaz, A. Insulin growth factor 2 (IGF2) as an emergent target in psychiatric and neurological disorders. Review. Neurosci. Res. 2018, 149, 1–13. [Google Scholar] [CrossRef] [PubMed]
  70. Bae, M.; Roh, J.D.; Kim, Y.; Kim, S.S.; Han, H.M.; Yang, E.; Kang, H.; Lee, S.; Kim, J.Y.; Kang, R.; et al. SLC6A20 transporter: A novel regulator of brain glycine homeostasis and NMDAR function. EMBO Mol. Med. 2021, 13, e12632. [Google Scholar] [CrossRef]
  71. Fan, H.; Morand, E.F. Targeting the side effects of steroid therapy in autoimmune diseases: The role of GILZ. Discov. Med. 2012, 13. [Google Scholar]
  72. Bonardi, C.M.; Heyne, H.O.; Fiannacca, M.; Fitzgerald, M.P.; Gardella, E.; Gunning, B.; Olofsson, K.; Lesca, G.; Verbeek, N.; Stamberger, H.; et al. KCNT1-related epilepsies and epileptic encephalopathies: Phenotypic and mutational spectrum. Brain 2021, 144, 3635–3650. [Google Scholar] [CrossRef] [PubMed]
  73. Zhang, H.; Tian, X.; Lu, X.; Xu, D.; Guo, Y.; Dong, Z.; Li, Y.; Ma, Y.; Chen, C.; Yang, Y.; et al. TMEM25 modulates neuronal excitability and NMDA receptor subunit NR2B degradation. J. Clin. Investig. 2019, 129, 3864–3876. [Google Scholar] [CrossRef] [PubMed]
  74. An, W.F.; Bowlby, M.R.; Betty, M.; Cao, J.; Ling, H.-P.; Mendoza, G.; Hinson, J.W.; Mattsson, K.I.; Strassle, B.W.; Trimmer, J.S.; et al. Modulation of A-type potassium channels by a family of calcium sensors. Nature 2000, 403, 553–556. [Google Scholar] [CrossRef] [PubMed]
  75. Lee, H.K.; Chaboub, L.S.; Zhu, W.; Zollinger, D.; Rasband, M.; Fancy, S.P.; Deneen, B. Daam2-PIP5K Is a Regulatory Pathway for Wnt Signaling and Therapeutic Target for Remyelination in the CNS. Neuron 2015, 85, 1227–1243. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  76. Jeanneteau, F.; Guillin, O.; Diaz, J.; Griffon, N.; Sokoloff, P. GIPC Recruits GAIP (RGS19) To Attenuate Dopamine D2Receptor Signaling. Mol. Biol. Cell 2004, 15, 4926–4937. [Google Scholar] [CrossRef] [Green Version]
  77. Gold, N.B.; Li, D.; Chassevent, A.; Kaiser, F.J.; Parenti, I.; Strom, T.M.; Ramos, F.J.; Puisac, B.; Pie, J.; McWalter, K.; et al. Heterozygous de novo variants in CSNK1G1 are associated with syndromic developmental delay and autism spectrum disorder. Clin. Genet. 2020, 98, 571–576. [Google Scholar] [CrossRef]
  78. Mincheva-Tasheva, S.; Guil, A.F.N.; Homan, C.C.; Gecz, J.; Thomas, P.Q. Disrupted Excitatory Synaptic Contacts and Altered Neuronal Network Activity Underpins the Neurological Phenotype in PCDH19-Clustering Epilepsy (PCDH19-CE). Mol. Neurobiol. 2021, 58, 2005–2018. [Google Scholar] [CrossRef] [PubMed]
  79. Schmoker, A.M.; Weinert, J.L.; Kellett, K.J.; Johnson, H.E.; Joy, R.M.; Weir, M.E.; Ebert, A.M.; Ballif, B.A. Dynamic multi-site phosphorylation by Fyn and Abl drives the interaction between CRKL and the novel scaffolding receptors DCBLD1 and DCBLD2. Biochem. J. 2017, 474, 3963–3984. [Google Scholar] [CrossRef] [PubMed]
  80. Halperin, D.; Kadir, R.; Perez, Y.; Drabkin, M.; Yogev, Y.; Wormser, O.; Berman, E.M.; Eremenko, E.; Rotblat, B.; Shorer, Z.; et al. SEC31A mutation affects ER homeostasis, causing a neurological syndrome. J. Med. Genet. 2018, 56, 139–148. [Google Scholar] [CrossRef] [PubMed]
  81. Yau, K.W.; van Beuningen, S.F.; Cunha-Ferreira, I.; Cloin, B.M.; van Battum, E.Y.; Will, L.; Schätzle, P.; Tas, R.P.; van Krugten, J.; Katrukha, E.A.; et al. Microtubule Minus-End Binding Protein CAMSAP2 Controls Axon Specification and Dendrite Development. Neuron 2014, 82, 1058–1073. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  82. Brivio, P.; Sbrini, G.; Tarantini, L.; Parravicini, C.; Gruca, P.; Lason, M.; Litwa, E.; Favero, C.; Riva, M.; Eberini, I.; et al. Stress Modifies the Expression of Glucocorticoid-Responsive Genes by Acting at Epigenetic Levels in the Rat Prefrontal Cortex: Modulatory Activity of Lurasidone. Int. J. Mol. Sci. 2021, 22, 6197. [Google Scholar] [CrossRef] [PubMed]
  83. Frodl, T.; Carballedo, A.; Hughes, M.M.; Saleh, K.; Fagan, A.J.; Skokauskas, N.; McLoughlin, D.; Meaney, J.F.; O’Keane, V.; Connor, T.J. Reduced expression of glucocorticoid-inducible genes GILZ and SGK-1: High IL-6 levels are associated with reduced hippocampal volumes in major depressive disorder. Transl. Psychiatry 2012, 2, e88. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  84. Kwon, O.C.; Song, J.J.; Yang, Y.; Kim, S.H.; Kim, J.Y.; Seok, M.J.; Hwang, I.; Yu, J.W.; Karmacharya, J.; Maeng, H.J.; et al. SGK1 inhibition in glia ameliorates pathologies and symptoms in Parkinson disease animal models. EMBO Mol. Med. 2021, 13, e13076. [Google Scholar] [CrossRef] [PubMed]
  85. Elahi, M.; Motoi, Y.; Shimonaka, S.; Ishida, Y.; Hioki, H.; Takanashi, M.; Ishiguro, K.; Imai, Y.; Hattori, N. High-fat diet-induced activation of SGK1 promotes Alzheimer’s disease-associated tau pathology. Hum. Mol. Genet. 2021, 30, 1693–1710. [Google Scholar] [CrossRef] [PubMed]
  86. Benedito, A.B.; Lehtinen, M.; Massol, R.; Lopes, U.G.; Kirchhausen, T.; Rao, A.; Bonni, A. The Transcription Factor NFAT3 Mediates Neuronal Survival. J. Biol. Chem. 2005, 280, 2818–2825. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  87. Vashishta, A.; Habas, A.; Pruunsild, P.; Zheng, J.J.; Timmusk, T.; Hetman, M. Nuclear factor of activated T-cells isoform c4 (NFATc4/NFAT3) as a mediator of antiapoptotic transcription in NMDA receptor-stimulated cortical neurons. J. Neurosci. 2009, 29, 15331–15340. [Google Scholar] [CrossRef] [PubMed]
  88. Warwick, C.A.; Keyes, A.L.; Woodruff, T.M.; Usachev, Y.M. The complement cascade in the regulation of neuroinflammation, nociceptive sensitization, and pain. J. Biol. Chem. 2021, 297, 101085. [Google Scholar] [CrossRef] [PubMed]
  89. Roberts, D.; Wolfarth, A.; Sanchez, C.; Pehrson, A.L. Frontal cortex dysfunction as a target for remediation in opiate use disorder: Role in cognitive dysfunction and disordered reward systems. Prog. Brain Res. 2018, 239, 179–227. [Google Scholar] [CrossRef] [PubMed]
  90. Arias, F.; Arnsten, J.H.; Cunningham, C.O.; Coulehan, K.; Batchelder, A.; Brisbane, M.; Segal, K.; Rivera-Mindt, M. Neurocognitive, psychiatric, and substance use characteristics in opioid dependent adults. Addict. Behav. 2016, 60, 137–143. [Google Scholar] [CrossRef] [PubMed]
  91. Meyer, V.J.; Rubin, L.H.; Martin, E.; Weber, K.M.; Cohen, M.H.; Golub, E.T.; Valcour, V.; Young, M.A.; Crystal, H.; Anastos, K.; et al. HIV and Recent Illicit Drug Use Interact to Affect Verbal Memory in Women. JAIDS J. Acquir. Immune Defic. Syndr. 2013, 63, 67–76. [Google Scholar] [CrossRef] [Green Version]
  92. Tamargo, J.A.; Campa, A.; Martinez, S.S.; Li, T.; Sherman, K.E.; Zarini, G.; Meade, C.S.; Mandler, R.N.; Baum, M.K. Cognitive Impairment among People Who Use Heroin and Fentanyl: Findings from the Miami Adult Studies on HIV (MASH) Cohort. J. Psychoact. Drugs 2020, 53, 215–223. [Google Scholar] [CrossRef]
  93. Martin-Thormeyer, E.M.; Paul, R.H. Drug Abuse and Hepatitis C Infection as Comorbid Features of HIV Associated Neurocognitive Disorder: Neurocognitive and Neuroimaging Features. Neuropsychol. Rev. 2009, 19, 215–231. [Google Scholar] [CrossRef] [PubMed]
  94. Byrd, D.A.; Fellows, R.P.; Morgello, S.; Franklin, D.; Heaton, R.K.; Deutsch, R.; Atkinson, J.H.; Clifford, D.B.; Collier, A.C.; Marra, C.M.; et al. Neurocognitive Impact of Substance Use in HIV Infection. JAIDS J. Acquir. Immune Defic. Syndr. 2011, 58, 154–162. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  95. Mundkur, M.L.; Rough, K.; Huybrechts, K.F.; Levin, R.; Gagne, J.J.; Desai, R.J.; Patorno, E.; Choudhry, N.K.; Bateman, B.T. Patterns of opioid initiation at first visits for pain in United States primary care settings. Pharmacoepidemiol. Drug Saf. 2017, 27, 495–503. [Google Scholar] [CrossRef] [PubMed]
  96. Harris, R.A.; Kranzler, H.R.; Chang, K.-M.; Doubeni, C.A.; Gross, R. Long-term use of hydrocodone vs. oxycodone in primary care. Drug Alcohol Depend. 2019, 205, 107524. [Google Scholar] [CrossRef] [PubMed]
  97. Remillard, D.; Kaye, A.D.; McAnally, H. Oxycodone’s Unparalleled Addictive Potential: Is it Time for a Moratorium? Curr. Pain Headache Rep. 2019, 23, 15. [Google Scholar] [CrossRef]
  98. Kibaly, C.; Alderete, J.A.; Liu, S.H.; Nasef, H.S.; Law, P.Y.; Evans, C.J.; Cahill, C.M. Oxycodone in the Opioid Epidemic: High ’Liking’, ’Wanting’, and Abuse Liability. Cell Mol. Neurobiol. 2021, 41, 899–926. [Google Scholar] [CrossRef] [PubMed]
  99. De Guglielmo, G.; Fu, Y.; Chen, J.; Larrosa, E.; Hoang, I.; Kawamura, T.; Lorrai, I.; Zorman, B.; Bryant, J.; George, O.; et al. Increases in compulsivity, inflammation, and neural injury in HIV transgenic rats with escalated methamphetamine self-administration under extended-access conditions. Brain Res. 2019, 1726, 146502. [Google Scholar] [CrossRef]
  100. Walker, K.A.; Brown, G.G. HIV-associated executive dysfunction in the era of modern antiretroviral therapy: A systematic review and meta-analysis. J. Clin. Exp. Neuropsychol. 2017, 40, 357–376. [Google Scholar] [CrossRef]
  101. Harricharan, R.; Thaver, V.; Russell, V.A.; Daniels, W.M.U. Tat-induced histopathological alterations mediate hippocampus-associated behavioural impairments in rats. Behav. Brain Funct. 2015, 11, 3. [Google Scholar] [CrossRef] [Green Version]
  102. Marks, W.D.; Paris, J.J.; Schier, C.J.; Denton, M.D.; Fitting, S.; McQuiston, A.R.; Knapp, P.E.; Hauser, K.F. HIV-1 Tat causes cognitive deficits and selective loss of parvalbumin, somatostatin, and neuronal nitric oxide synthase expressing hippocampal CA1 interneuron subpopulations. J. NeuroVirol. 2016, 22, 747–762. [Google Scholar] [CrossRef] [PubMed]
  103. Rowson, S.A.; Harrell, C.S.; Bekhbat, M.; Gangavelli, A.; Wu, M.J.; Kelly, S.D.; Reddy, R.; Neigh, G.N. Neuroinflammation and Behavior in HIV-1 Transgenic Rats Exposed to Chronic Adolescent Stress. Front. Psychiatry 2016, 7, 102. [Google Scholar] [CrossRef] [Green Version]
  104. De Brabander, J.M.; de Bruin, J.P.; van Eden, C.G. Comparison of the effects of neonatal and adult medial prefrontal cortex lesions on food hoarding and spatial delayed alternation. Behav. Brain Res. 1991, 42, 67–75. [Google Scholar] [CrossRef]
  105. Dunnett, S.B.; Nathwani, F.; Brasted, P.J. Medial prefrontal and neostriatal lesions disrupt performance in an operant delayed alternation task in rats. Behav. Brain Res. 1999, 106, 13–28. [Google Scholar] [CrossRef]
  106. Jett, J.D.; Bulin, S.E.; Hatherall, L.C.; McCartney, C.M.; Morilak, D.A. Deficits in cognitive flexibility induced by chronic unpredictable stress are associated with impaired glutamate neurotransmission in the rat medial prefrontal cortex. Neuroscience 2017, 346, 284–297. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  107. Gessi, S.; Borea, P.A.; Bencivenni, S.; Fazzi, D.; Varani, K.; Merighi, S. The activation of mu-opioid receptor potentiates LPS-induced NF-kB promoting an inflammatory phenotype in microglia. FEBS Lett. 2016, 590, 2813–2826. [Google Scholar] [CrossRef] [Green Version]
  108. Merighi, S.; Gessi, S.; Varani, K.; Fazzi, D.; Stefanelli, A.; Borea, P.A. Morphine mediates a proinflammatory phenotype via mu-opioid receptor-PKCvarepsilon-Akt-ERK1/2 signaling pathway in activated microglial cells. Biochem. Pharmacol. 2013, 86, 487–496. [Google Scholar] [CrossRef] [PubMed]
  109. Bokhari, S.M.; Yao, H.; Bethel-Brown, C.; Fuwang, P.; Williams, R.; Dhillon, N.K.; Hegde, R.; Kumar, A.; Buch, S.J. Morphine enhances Tat-induced activation in murine microglia. J. NeuroVirol. 2009, 15, 219–228. [Google Scholar] [CrossRef]
  110. Bruce-Keller, A.J.; Turchan-Cholewo, J.; Smart, E.J.; Geurin, T.; Chauhan, A.; Reid, R.; Xu, R.; Nath, A.; Knapp, P.E.; Hauser, K.F. Morphine causes rapid increases in glial activation and neuronal injury in the striatum of inducible HIV-1 tat transgenic mice. Glia 2008, 56, 1414–1427. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  111. Kapasi, A.A.; Gibbons, N.; Mattana, J.; Singhal, P.C. Morphine Stimulates Mesangial Cell TNF-α and Nitrite Production. Inflammation 2000, 24, 463–476. [Google Scholar] [CrossRef]
  112. Chao, C.C.; Gekker, G.; Sheng, W.S.; Hu, S.; Tsang, M.; Peterson, P.K. Priming effect of morphine on the production of tumor necrosis factor-alpha by microglia: Implications in respiratory burst activity and human immunodeficiency virus-1 expression. J. Pharmacol. Exp. Ther. 1994, 269, 198–203. [Google Scholar] [PubMed]
  113. Vallejo, R.; de Leon-Casasola, O.; Benyamin, R. Opioid therapy and immunosuppression: A review. Am. J. Ther. 2004, 11, 354–365. [Google Scholar] [CrossRef] [PubMed]
  114. Franchi, S.; Moschetti, G.; Amodeo, G.; Sacerdote, P. Do All Opioid Drugs Share the Same Immunomodulatory Properties? A Review from Animal and Human Studies. Front. Immunol. 2019, 10, 2914. [Google Scholar] [CrossRef] [PubMed]
  115. Bereshchenko, O.; Migliorati, G.; Bruscoli, S.; Riccardi, C. Glucocorticoid-Induced Leucine Zipper: A Novel Anti-inflammatory Molecule. Front. Pharmacol. 2019, 10, 308. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  116. Vago, J.P.; Tavares, L.P.; Garcia, C.C.; Lima, K.M.; Perucci, L.O.; Vieira, E.L.; Nogueira, C.R.C.; Soriani, F.M.; Martins, J.O.; Silva, P.M.R.; et al. The Role and Effects of Glucocorticoid-Induced Leucine Zipper in the Context of Inflammation Resolution. J. Immunol. 2015, 194, 4940–4950. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  117. Vago, J.P.; Galvão, I.; Negreiros-Lima, G.L.; Teixeira, L.C.; Lima, K.M.; Sugimoto, M.A.; Moreira, I.Z.; Jones, S.A.; Lang, T.; Riccardi, C.; et al. Glucocorticoid-induced leucine zipper modulates macrophage polarization and apoptotic cell clearance. Pharmacol. Res. 2020, 158, 104842. [Google Scholar] [CrossRef] [PubMed]
  118. Cannarile, L.; Delfino, D.V.; Adorisio, S.; Riccardi, C.; Ayroldi, E. Implicating the Role of GILZ in Glucocorticoid Modulation of T-Cell Activation. Front. Immunol. 2019, 10, 1823. [Google Scholar] [CrossRef]
  119. Pinheiro, I.; Dejager, L.; Petta, I.; Vandevyver, S.; Puimège, L.; Mahieu, T.; Ballegeer, M.; Van Hauwermeiren, F.; Riccardi, C.; Vuylsteke, M.; et al. LPS resistance of SPRET/Ei mice is mediated by Gilz, encoded by the Tsc22d3 gene on the X chromosome. EMBO Mol. Med. 2013, 5, 456–470. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  120. Salahuddin, M.; Mahdi, F.; Paris, J. HIV-1 Tat Dysregulates the Hypothalamic-Pituitary-Adrenal Stress Axis and Potentiates Oxycodone-Mediated Psychomotor and Anxiety-Like Behavior of Male Mice. Int. J. Mol. Sci. 2020, 21, 8212. [Google Scholar] [CrossRef] [PubMed]
  121. Zou, S.; Fitting, S.; Hahn, Y.K.; Welch, S.P.; El-Hage, N.; Hauser, K.F.; Knapp, P.E. Morphine potentiates neurodegenerative effects of HIV-1 Tat through actions at mu-opioid receptor-expressing glia. Brain 2011, 134 Pt 12, 3616–3631. [Google Scholar] [CrossRef] [Green Version]
  122. Fitting, S.; Knapp, P.E.; Zou, S.; Marks, W.D.; Bowers, M.S.; Akbarali, H.I.; Hauser, K.F. Interactive HIV-1 Tat and morphine-induced synaptodendritic injury is triggered through focal disruptions in Na+ influx, mitochondrial instability, and Ca2+ overload. J. Neurosci. 2014, 34, 12850–12864. [Google Scholar] [CrossRef] [Green Version]
  123. Lupien, S.J.; Gillin, C.J.; Hauger, R.L. Working memory is more sensitive than declarative memory to the acute effects of corticosteroids: A dose-response study in humans. Behav. Neurosci. 1999, 113, 420–430. [Google Scholar] [CrossRef] [PubMed]
  124. Young, A.H.; Sahakian, B.J.; Robbins, T.W.; Cowen, P.J. The effects of chronic administration of hydrocortisone on cognitive function in normal male volunteers. Psychopharmacology 1999, 145, 260–266. [Google Scholar] [CrossRef] [PubMed]
  125. Herrera, A.Y.; Hodis, H.N.; Mack, W.J.; Mather, M. Estradiol Therapy After Menopause Mitigates Effects of Stress on Cortisol and Working Memory. J. Clin. Endocrinol. Metab. 2017, 102, 4457–4466. [Google Scholar] [CrossRef] [PubMed]
  126. Lehner, M.; Wisłowska-Stanek, A.; Skórzewska, A.; Płaźnik, A. Chronic restraint increases apoptosis in the hippocampus of rats with high responsiveness to fear stimuli. Neurosci. Lett. 2015, 586, 55–59. [Google Scholar] [CrossRef] [PubMed]
  127. Wellman, C.L. Dendritic reorganization in pyramidal neurons in medial prefrontal cortex after chronic corticosterone administration. J. Neurobiol. 2001, 49, 245–253. [Google Scholar] [CrossRef] [PubMed]
  128. Liston, C.; Miller, M.M.; Goldwater, D.S.; Radley, J.J.; Rocher, A.B.; Hof, P.R.; Morrison, J.H.; McEwen, B.S. Stress-induced alterations in prefrontal cortical dendritic morphology predict selective impairments in perceptual attentional set-shifting. J. Neurosci. 2006, 26, 7870–7874. [Google Scholar] [CrossRef] [Green Version]
  129. Liu, R.-J.; Aghajanian, G.K. Stress blunts serotonin- and hypocretin-evoked EPSCs in prefrontal cortex: Role of corticosterone-mediated apical dendritic atrophy. Proc. Natl. Acad. Sci. USA 2008, 105, 359–364. [Google Scholar] [CrossRef] [Green Version]
  130. Hains, A.B.; Vu, M.A.T.; Maciejewski, P.K.; van Dyck, C.H.; Gottron, M.; Arnsten, A.F.T. Inhibition of protein kinase C signaling protects prefrontal cortex dendritic spines and cognition from the effects of chronic stress. Proc. Natl. Acad. Sci. USA 2009, 106, 17957–17962. [Google Scholar] [CrossRef] [Green Version]
  131. Gourley, S.L.; Swanson, A.M.; Koleske, A.J. Corticosteroid-Induced Neural Remodeling Predicts Behavioral Vulnerability and Resilience. J. Neurosci. 2013, 33, 3107–3112. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  132. McEwen, B.S.; Stellar, E. Stress and the individual. Mechanisms leading to disease. Arch. Intern. Med. 1993, 153, 2093–2101. [Google Scholar] [CrossRef] [PubMed]
  133. Goldstein, D.S.; McEwen, B. Allostasis, homeostats, and the nature of stress. Stress 2002, 5, 55–58. [Google Scholar] [CrossRef] [PubMed]
  134. McEwen, B.S. Sex, stress and the hippocampus: Allostasis, allostatic load and the aging process. Neurobiol. Aging 2002, 23, 921–939. [Google Scholar] [CrossRef]
  135. McEwen, B.S. From molecules to mind. Stress, individual differences, and the social environment. Ann. N. Y. Acad. Sci. 2001, 935, 42–49. [Google Scholar] [CrossRef]
  136. Wolkowitz, O.M. Prospective controlled studies of the behavioral and biological effects of exogenous corticosteroids. Psychoneuroendocrinology 1994, 19, 233–255. [Google Scholar] [CrossRef]
  137. Sandeep, T.C.; Yau, J.L.; MacLullich, A.M.; Noble, J.; Deary, I.J.; Walker, B.R.; Seckl, J.R. 11Beta-hydroxysteroid dehydrogenase inhibition improves cognitive function in healthy elderly men and type 2 diabetics. Proc. Natl. Acad. Sci. USA 2004, 101, 6734–6739. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  138. Wingenfeld, K.; Wolf, O.T. Effects of cortisol on cognition in major depressive disorder, posttraumatic stress disorder and borderline personality disorder—2014 Curt Richter Award Winner. Psychoneuroendocrinology 2015, 51, 282–295. [Google Scholar] [CrossRef] [PubMed]
  139. Vyas, S.; Maatouk, L. Contribution of glucocorticoids and glucocorticoid receptors to the regulation of neurodegenerative processes. CNS Neurol. Disord. Drug Targets 2013, 12, 1175–1193. [Google Scholar] [CrossRef] [PubMed]
  140. Djamshidian, A.; Lees, A.J. Can stress trigger Parkinson’s disease? J. Neurol. Neurosurg. Psychiatry 2014, 85, 878–881. [Google Scholar] [CrossRef] [PubMed]
  141. Hou, G.; Tian, R.; Li, J.; Yuan, T.F. Chronic stress and Parkinson’s disease. CNS Neurosci. Ther. 2014, 20, 1–2. [Google Scholar] [CrossRef]
  142. Hartmann, A.; Veldhuis, J.D.; Deuschle, M.; Standhardt, H.; Heuser, I. Twenty-four hour cortisol release profiles in patients with Alzheimer’s and Parkinson’s disease compared to normal controls: Ultradian secretory pulsatility and diurnal variation. Neurobiol. Aging 1997, 18, 285–289. [Google Scholar] [CrossRef]
  143. Notarianni, E. Hypercortisolemia and Glucocorticoid Receptor-Signaling Insufficiency in Alzheimer’ s Disease Initiation and Development. Curr. Alzheimer Res. 2013, 10, 714–731. [Google Scholar] [CrossRef] [PubMed]
  144. Raboch, J.; Zvěřová, M.; Fišar, Z.; Jirák, R.; Kitzlerová, E.; Hroudová, J.; Raboch, J. Plasma cortisol in Alzheimer’s disease with or without depressive symptoms. Med. Sci. Monit. 2013, 19, 681–689. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  145. Popp, J.; Wolfsgruber, S.; Heuser, I.; Peters, O.; Hull, M.; Schroder, J.; Moller, H.J.; Lewczuk, P.; Schneider, A.; Jahn, H.; et al. Cerebrospinal fluid cortisol and clinical disease progression in MCI and dementia of Alzheimer’s type. Neurobiol. Aging 2015, 36, 601–607. [Google Scholar] [CrossRef] [PubMed]
  146. Roelfsema, F.; Van Heemst, D.; Iranmanesh, A.; Takahashi, P.; Yang, R.; Veldhuis, J.D. Impact of age, sex and body mass index on cortisol secretion in 143 healthy adults. Endocr. Connect. 2017, 6, 500–509. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  147. Cook, S.C.; Wellman, C.L. Chronic stress alters dendritic morphology in rat medial prefrontal cortex. J. Neurobiol. 2004, 60, 236–248. [Google Scholar] [CrossRef]
  148. Yuen, E.Y.; Wei, J.; Liu, W.; Zhong, P.; Li, X.; Yan, Z. Repeated Stress Causes Cognitive Impairment by Suppressing Glutamate Receptor Expression and Function in Prefrontal Cortex. Neuron 2012, 73, 962–977. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  149. Luczynski, P.; Moquin, L.; Gratton, A. Chronic stress alters the dendritic morphology of callosal neurons and the acute glutamate stress response in the rat medial prefrontal cortex. Stress 2015, 18, 654–667. [Google Scholar] [CrossRef]
  150. Shimba, A.; Ikuta, K. Control of immunity by glucocorticoids in health and disease. Semin. Immunopathol. 2020, 42, 669–680. [Google Scholar] [CrossRef] [PubMed]
Viruses 14 00669 g001 550
Figure 1. Intravenous oxycodone self-administration in HIV Tg rats and WT rats under nondependent (short access (ShA)) and dependent (long access (LgA)) conditions. (A) HIV Tg rats and WT littermates self-administering oxycodone under a fixed-ratio 1 (FR1) schedule under short-access (ShA) conditions in 1-h daily sessions or under long-access (LgA) conditions in 12-h daily sessions. HIV Tg rats and WT littermates escalated oxycodone self-administration under LgA conditions. Oxycodone intake did not differ between HIV Tg and WT rats under either ShA or LgA conditions. * p < 0.05, ** p < 0.005, *** p < 0.0005, **** p < 0.0001 vs. Session 1 (Newman–Keuls post hoc test). (B) Following a period of enforced abstinence to model the intermittent pattern of opioid abuse in humans, HIV Tg and WT rats both under ShA and LgA conditions promptly resumed their previous levels of self-administration, which did not differ between genotypes. (C) Oxycodone self-administration under ShA and LgA conditions did not differ between genotypes after a second period of enforced abstinence. (D) The pattern of oxycodone self-administration in HIV Tg and WT rats under LgA conditions was highly reproducible and closely replicated in an independent set of rats. * p < 0.05, ** p < 0.005, *** p < 0.0005, **** p < 0.0001 vs. Session 1 (Newman–Keuls post hoc test). (E) Following a period of enforced abstinence, rats of both genotypes promptly resumed their previous levels of self-administration, which did not differ between genotypes. (F) HIV Tg rats with a history of escalated oxycodone self-administration under LgA conditions performed significantly worse than WT littermates in the NOR task during protracted withdrawal. HIV Tg rats vs. naive HIV Tg rats: * p < 0.05; HIV Tg rats vs. naive WT rats: * p < 0.05; HIV Tg rats vs. WT rats: ** p < 0.005; Newman–Keuls post hoc test.
Figure 1. Intravenous oxycodone self-administration in HIV Tg rats and WT rats under nondependent (short access (ShA)) and dependent (long access (LgA)) conditions. (A) HIV Tg rats and WT littermates self-administering oxycodone under a fixed-ratio 1 (FR1) schedule under short-access (ShA) conditions in 1-h daily sessions or under long-access (LgA) conditions in 12-h daily sessions. HIV Tg rats and WT littermates escalated oxycodone self-administration under LgA conditions. Oxycodone intake did not differ between HIV Tg and WT rats under either ShA or LgA conditions. * p < 0.05, ** p < 0.005, *** p < 0.0005, **** p < 0.0001 vs. Session 1 (Newman–Keuls post hoc test). (B) Following a period of enforced abstinence to model the intermittent pattern of opioid abuse in humans, HIV Tg and WT rats both under ShA and LgA conditions promptly resumed their previous levels of self-administration, which did not differ between genotypes. (C) Oxycodone self-administration under ShA and LgA conditions did not differ between genotypes after a second period of enforced abstinence. (D) The pattern of oxycodone self-administration in HIV Tg and WT rats under LgA conditions was highly reproducible and closely replicated in an independent set of rats. * p < 0.05, ** p < 0.005, *** p < 0.0005, **** p < 0.0001 vs. Session 1 (Newman–Keuls post hoc test). (E) Following a period of enforced abstinence, rats of both genotypes promptly resumed their previous levels of self-administration, which did not differ between genotypes. (F) HIV Tg rats with a history of escalated oxycodone self-administration under LgA conditions performed significantly worse than WT littermates in the NOR task during protracted withdrawal. HIV Tg rats vs. naive HIV Tg rats: * p < 0.05; HIV Tg rats vs. naive WT rats: * p < 0.05; HIV Tg rats vs. WT rats: ** p < 0.005; Newman–Keuls post hoc test.
Viruses 14 00669 g001
Viruses 14 00669 g004 550
Figure 4. Transcriptional evidence of an increase in neuroinflammation in HIV Tg rats that self-administered oxycodone under nondependent (short access (ShA)) conditions. Pathway analysis by GSEA provided evidence of (A,B) broad immune activation and (C) the induction of cytokine signaling, including (D) interferon (IFN) signaling, (E) Toll signaling, (F) TGFβ, (G) SHP2 signaling, and (H) complement and coagulation cascades. Each bar represents a gene in the gene set [60]. HIV ND, HIV Tg rats that self-administered oxycodone under nondependent (ShA) conditions; WT ND, wildtype rats that self-administered oxycodone under nondependent conditions. NES = normalized enrichment score [60].
Figure 4. Transcriptional evidence of an increase in neuroinflammation in HIV Tg rats that self-administered oxycodone under nondependent (short access (ShA)) conditions. Pathway analysis by GSEA provided evidence of (A,B) broad immune activation and (C) the induction of cytokine signaling, including (D) interferon (IFN) signaling, (E) Toll signaling, (F) TGFβ, (G) SHP2 signaling, and (H) complement and coagulation cascades. Each bar represents a gene in the gene set [60]. HIV ND, HIV Tg rats that self-administered oxycodone under nondependent (ShA) conditions; WT ND, wildtype rats that self-administered oxycodone under nondependent conditions. NES = normalized enrichment score [60].
Viruses 14 00669 g004
Viruses 14 00669 g005 550
Figure 5. Transcriptional evidence of increases in neuronal injury and neurodegeneration in HIV Tg rats that self-administered oxycodone under dependent (LgA) conditions. Representative pathways that were differentially activated by GSEA are indicative of an increase in the expression of (A) interferon (IFN) signaling and (B) complement (which has been implicated in increases in inflammation and neurodegeneration [88]) and the broad downregulation of (C) neuronal genes, including genes that are involved in (D) neuronal communication, (E) neural plasticity, and (F,G) signaling and (H) genes that are involved in neurodegenerative conditions (e.g., Alzheimer’s disease) and (I,J) trophism. Each bar represents a gene in the gene set [60]. NES, normalized enrichment score [60]; HIV D, HIV Tg rats that self-administered oxycodone under dependent (long access (LgA)) conditions; WT D, wildtype rats that self-administered oxycodone under dependent conditions. NES = normalized enrichment score [60].
Figure 5. Transcriptional evidence of increases in neuronal injury and neurodegeneration in HIV Tg rats that self-administered oxycodone under dependent (LgA) conditions. Representative pathways that were differentially activated by GSEA are indicative of an increase in the expression of (A) interferon (IFN) signaling and (B) complement (which has been implicated in increases in inflammation and neurodegeneration [88]) and the broad downregulation of (C) neuronal genes, including genes that are involved in (D) neuronal communication, (E) neural plasticity, and (F,G) signaling and (H) genes that are involved in neurodegenerative conditions (e.g., Alzheimer’s disease) and (I,J) trophism. Each bar represents a gene in the gene set [60]. NES, normalized enrichment score [60]; HIV D, HIV Tg rats that self-administered oxycodone under dependent (long access (LgA)) conditions; WT D, wildtype rats that self-administered oxycodone under dependent conditions. NES = normalized enrichment score [60].
Viruses 14 00669 g005
Viruses 14 00669 g006 550
Figure 6. Differential regulation of selected pathways by histories of nondependent (ShA) and dependent (LgA) oxycodone self-administration in HIV Tg rats and WT rats. The figure shows the differential regulation of gene sets that are relevant to neurodegeneration in HIV Tg rats and WT rats with histories of nondependent (ShA) and dependent (LgA) oxycodone self-administration. (A) Glucocorticoid regulated genes showed greater adaptations in HIV Tg rats with a history of dependent (LgA) oxycodone self-administration. (B) Nfat3 regulated genes, (C) genes that are involved in neuronal communication, including synaptodendritic genes, (D) genes that are related to signaling, such as DARPP32 regulated events, and (E) genes that are related to axonal function were downregulated in HIV Tg rats with a history of dependent (LgA) oxycodone self-administration. * p < 0.05, ** p < 0.01, vs. oxycodone-naive control rats of the respective genotype. NES = normalized enrichment score [60].
Figure 6. Differential regulation of selected pathways by histories of nondependent (ShA) and dependent (LgA) oxycodone self-administration in HIV Tg rats and WT rats. The figure shows the differential regulation of gene sets that are relevant to neurodegeneration in HIV Tg rats and WT rats with histories of nondependent (ShA) and dependent (LgA) oxycodone self-administration. (A) Glucocorticoid regulated genes showed greater adaptations in HIV Tg rats with a history of dependent (LgA) oxycodone self-administration. (B) Nfat3 regulated genes, (C) genes that are involved in neuronal communication, including synaptodendritic genes, (D) genes that are related to signaling, such as DARPP32 regulated events, and (E) genes that are related to axonal function were downregulated in HIV Tg rats with a history of dependent (LgA) oxycodone self-administration. * p < 0.05, ** p < 0.01, vs. oxycodone-naive control rats of the respective genotype. NES = normalized enrichment score [60].
Viruses 14 00669 g006
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Fu, Y.; Lorrai, I.; Zorman, B.; Mercatelli, D.; Shankula, C.; Marquez Gaytan, J.; Lefebvre, C.; de Guglielmo, G.; Kim, H.R.; Sumazin, P.; et al. Escalated (Dependent) Oxycodone Self-Administration Is Associated with Cognitive Impairment and Transcriptional Evidence of Neurodegeneration in Human Immunodeficiency Virus (HIV) Transgenic Rats. Viruses 2022, 14, 669. https://doi.org/10.3390/v14040669

AMA Style

Fu Y, Lorrai I, Zorman B, Mercatelli D, Shankula C, Marquez Gaytan J, Lefebvre C, de Guglielmo G, Kim HR, Sumazin P, et al. Escalated (Dependent) Oxycodone Self-Administration Is Associated with Cognitive Impairment and Transcriptional Evidence of Neurodegeneration in Human Immunodeficiency Virus (HIV) Transgenic Rats. Viruses. 2022; 14(4):669. https://doi.org/10.3390/v14040669

Chicago/Turabian Style

Fu, Yu, Irene Lorrai, Barry Zorman, Daniele Mercatelli, Chase Shankula, Jorge Marquez Gaytan, Celine Lefebvre, Giordano de Guglielmo, Hyunjae Ryan Kim, Pavel Sumazin, and et al. 2022. "Escalated (Dependent) Oxycodone Self-Administration Is Associated with Cognitive Impairment and Transcriptional Evidence of Neurodegeneration in Human Immunodeficiency Virus (HIV) Transgenic Rats" Viruses 14, no. 4: 669. https://doi.org/10.3390/v14040669

APA Style

Fu, Y., Lorrai, I., Zorman, B., Mercatelli, D., Shankula, C., Marquez Gaytan, J., Lefebvre, C., de Guglielmo, G., Kim, H. R., Sumazin, P., Giorgi, F. M., Repunte-Canonigo, V., & Sanna, P. P. (2022). Escalated (Dependent) Oxycodone Self-Administration Is Associated with Cognitive Impairment and Transcriptional Evidence of Neurodegeneration in Human Immunodeficiency Virus (HIV) Transgenic Rats. Viruses, 14(4), 669. https://doi.org/10.3390/v14040669

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop