Comprehensive Surveillance of Virus Infection among Captive African Pygmy Hedgehogs in Japan
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. Detection of Herpesvirus, Adenovirus, and Coronavirus from Hedgehog Swab Samples
2.3. Phylogenetic Analysis
2.4. Specific PCR for the Detected Viruses
2.5. Virus Isolation
2.6. Statistical Analysis
3. Results
3.1. Detection of Herpesvirus and Adenovirus from Oral Swab Samples of Hedgehogs
3.2. Molecular Epidemiology of the Detected Viruses
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Okada, K.; Kondo, H.; Sumi, A.; Kagawa, Y. A retrospective study of disease incidence in African pygmy hedgehogs (Atelerix albiventris). J. Vet. Med. Sci. 2018, 80, 1504–1510. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ochiai, H.; Tamukai, K.; Akabane, Y.; Oba, M.; Omatsu, T.; Okumura, A.; Mizutani, T.; Madarame, H. An African pygmy hedgehog adenovirus 1 (AhAdV-1) outbreak in an African pygmy hedgehog (Atelerix albiventris) colony in Japan. Vet. Anim. Sci. 2019, 9, 100083. [Google Scholar] [CrossRef] [PubMed]
- Stack, M.J.; Higgins, R.J.; Challoner, D.J.; Gregory, M.W. Herpesvirus in the liver of a hedgehog (Erinaceus europaeus). Vet. Rec. 1990, 127, 620–621. [Google Scholar] [PubMed]
- Widén, F.; Gavier-Widén, D.; Nikiila, T.; Mörner, T. Fatal herpesvirus infection in a hedgehog (Erinaceus europaeus). Vet. Rec. 1996, 139, 237–238. [Google Scholar] [CrossRef]
- Allison, N.; Chang, T.C.; Steele, K.E.; Hilliard, J.K. Fatal herpes simplex infection in a pygmy African hedgehog (Atelerix albiventris). J. Comp. Pathol. 2002, 126, 76–78. [Google Scholar] [CrossRef]
- Corman, V.M.; Kallies, R.; Philipps, H.; Göpner, G.; Müller, M.A.; Eckerle, I.; Brünink, S.; Drosten, C.; Drexler, J.F. Characterization of a novel betacoronavirus related to middle East respiratory syndrome coronavirus in European hedgehogs. J. Virol. 2014, 88, 717–724. [Google Scholar] [CrossRef] [Green Version]
- Monchatre-Leroy, E.; Boué, F.; Boucher, J.M.; Renault, C.; Moutou, F.; Ar Gouilh, M.; Umhang, G. Identification of Alpha and Beta Coronavirus in Wildlife Species in France: Bats, Rodents, Rabbits, and Hedgehogs. Viruses 2017, 9, 364. [Google Scholar] [CrossRef] [Green Version]
- Saldanha, I.F.; Lawson, B.; Goharriz, H.; Rodriguez-Ramos, F.J.; John, S.K.; Fooks, A.R.; Cunningham, A.A.; Johnson, N.; Horton, D.L. Extension of the known distribution of a novel clade C betacoronavirus in a wildlife host. Epidemiol. Infect. 2019, 147, e169. [Google Scholar] [CrossRef] [Green Version]
- Delogu, M.; Cotti, C.; Lelli, D.; Sozzi, E.; Trogu, T.; Lavazza, A.; Garuti, G.; Castrucci, M.R.; Vaccari, G.; De Marco, M.A.; et al. Eco-Virological Preliminary Study of Potentially Emerging Pathogens in Hedgehogs (Erinaceus europaeus) Recovered at a Wildlife Treatment and Rehabilitation Center in Northern Italy. Animals 2020, 10, 407. [Google Scholar] [CrossRef] [Green Version]
- Lau, S.K.P.; Luk, H.K.H.; Wong, A.C.P.; Fan, R.Y.Y.; Lam, C.S.F.; Li, K.S.M.; Ahmed, S.S.; Chow, F.W.N.; Cai, J.P.; Zhu, X.; et al. Identification of a Novel Betacoronavirus (Merbecovirus) in Amur Hedgehogs from China. Viruses 2019, 11, 980. [Google Scholar] [CrossRef] [Green Version]
- Madarame, H.; Ogihara, K.; Kimura, M.; Nagai, M.; Omatsu, T.; Ochiai, H.; Mizutani, T. Detection of a pneumonia virus of mice (PVM) in an African hedgehog (Atelerix arbiventris) with suspected wobbly hedgehog syndrome (WHS). Vet. Microbiol. 2014, 173, 136–140. [Google Scholar] [CrossRef]
- VanDevanter, D.R.; Warrener, P.; Bennett, L.; Schultz, E.R.; Coulter, S.; Garber, R.L.; Rose, T.M. Detection and analysis of diverse herpesviral species by consensus primer PCR. J. Clin. Microbiol. 1996, 34, 1666–1671. [Google Scholar] [CrossRef] [Green Version]
- Wellehan, J.F.; Johnson, A.J.; Harrach, B.; Benkö, M.; Pessier, A.P.; Johnson, C.M.; Garner, M.M.; Childress, A.; Jacobson, E.R. Detection and analysis of six lizard adenoviruses by consensus primer PCR provides further evidence of a reptilian origin for the atadenoviruses. J. Virol. 2004, 78, 13366–13369. [Google Scholar] [CrossRef] [Green Version]
- Poon, L.L.; Chu, D.K.; Chan, K.H.; Wong, O.K.; Ellis, T.M.; Leung, Y.H.; Lau, S.K.; Woo, P.C.; Suen, K.Y.; Yuen, K.Y.; et al. Identification of a novel coronavirus in bats. J. Virol. 2005, 79, 2001–2009. [Google Scholar] [CrossRef] [Green Version]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
- Madarame, H.; Uchiyama, J.; Tamukai, K.; Katayama, Y.; Osawa, N.; Suzuki, K.; Mizutani, T.; Ochiai, H. Complete Genome Sequence of an Adenovirus-1 Isolate from an African Pygmy Hedgehog (Atelerix albiventris) Exhibiting Respiratory Symptoms in Japan. Microbiol. Resour. Announc. 2019, 8, e00695-19. [Google Scholar] [CrossRef] [Green Version]
- Hydeskov, H.B.; Dastjerdi, A.; Hopkins, K.P.; Ryser-Degiorgis, M.P.; Widén, F.; Cunningham, A.A.; Lawson, B. Detection and characterisation of multiple herpesviruses in free-living Western European hedgehogs (Erinaceus europaeus). Sci. Rep. 2018, 8, 13942. [Google Scholar] [CrossRef]
- Graesser, D.; Spraker, T.R.; Dressen, P.; Garner, M.M.; Raymond, J.T.; Terwilliger, G.; Kim, J.; Madri, J.A. Wobbly Hedgehog Syndrome in African Pygmy Hedgehogs (Atelerix spp.). J. Exot. Pet. Med. 2006, 15, 59–65. [Google Scholar] [CrossRef] [Green Version]
- Peauroi, J.R.; Lowenstine, L.J.; Munn, R.J.; Wilson, D.W. Multicentric skeletal sarcomas associated with probable retrovirus particles in two African hedgehogs (Atelerix albiventris). Vet. Pathol. 1994, 31, 481–484. [Google Scholar] [CrossRef]
- Varghese, S.; Rabkin, S.D. Oncolytic herpes simplex virus vectors for cancer virotherapy. Cancer Gene Ther. 2002, 9, 967–978. [Google Scholar] [CrossRef] [Green Version]
- Liu, B.L.; Robinson, M.; Han, Z.Q.; Branston, R.H.; English, C.; Reay, P.; McGrath, Y.; Thomas, S.K.; Thornton, M.; Bullock, P.; et al. ICP34.5 deleted herpes simplex virus with enhanced oncolytic, immune stimulating, and anti-tumour properties. Gene Ther. 2003, 10, 292–303. [Google Scholar] [CrossRef] [Green Version]
- Lichty, B.D.; Breitbach, C.J.; Stojdl, D.F.; Bell, J.C. Going viral with cancer immunotherapy. Nat. Rev. Cancer 2014, 14, 559–567. [Google Scholar] [CrossRef]
- Needle, D.B.; Selig, M.K.; Jackson, K.A.; Delwart, E.; Tighe, E.; Leib, S.L.; Seuberlich, T.; Pesavento, P.A. Fatal bronchopneumonia caused by skunk adenovirus 1 in an African pygmy hedgehog. J. Vet. Diagn. Investig. 2019, 31, 103–106. [Google Scholar] [CrossRef] [Green Version]
Target Virus | Primer Name * | Primer Sequence (5′->3′) | Product Size (bp) | Reference |
---|---|---|---|---|
Herpesvirus (universal) | DFA (1st) | GAYTTYGCNAGYYTNTAYCC | 215–315 | [12] |
ILK (1st) | TCCTGGACAAGCAGCARNYSGCNMTNAA | |||
KG1 (1st) | GTCTTGCTCACCAGNTCNACNCCYTT | |||
IYG (2nd) | CACAGAGTCCGTRTCNCCRTADAT | |||
TGV (2nd) | TGTAACTCGGTGTAYGGNTTYACNGGNGT | 168 | ||
African pygmy hedgehog herpesvirus | HHHeV_3F (1st) | GTTACCTTGTTTGCCTGTGGC | This study | |
HHHeV_9F (2nd) | GCTTCGGTGACGAAAATCGG | |||
HHHeV_9R (1st, 2nd) | TTCATCGTTTGTCTCTGTGGT | |||
Adenovirus (universal) | polFouter (1st) | TNMGNGGNGGNMGNTGYTAYCC | 318–324 | [13] |
polRouter (1st) | GTDGCRAANSHNCCRTABARNGMRTT | |||
polFinner(2nd) | GTNTWYGAYATHTGYGGHATGTAYGC | |||
polRinner (2nd) | CCANCCBCDRTTRTGNARNGTRA | |||
African pygmy hedgehog adenovirus | AhAdV-pol-1523F (1st) | CTGGCATACATCCCGCARAT | 287 | This study |
AhAdV-pol-1976R (1st) | CAGATGGGTTTCCCGCTCTT | |||
AhAdV-pol-1601F (2nd) | CCTCGGATACTGGACCTGAC | |||
AhAdV-pol-1887R (2nd) | TACGACATCATCCAGCACACC | |||
Coronavirus (universal) | IN-6 | GGTTGGGACTATCCTAAGTGTGA | 440 | [14] |
IN-7 | CCATCATCACATAGAATCATCAT |
Universal Primer | Specific Primer | ||||
---|---|---|---|---|---|
Herpesvirus | Adenovirus | Coronavirus | HHHeV | AhAdV-1 | |
No. of tested samples | 50 | 50 | 50 | 150 | 150 |
No. of positive samples | 2 | 2 | 0 | 14 | 3 |
% of positive samples | 4% | 4% | 0% | 9.3% | 2.0% |
Characteristic | Status | No. of Tested Samples | No. of Positive Samples * | p Value | ||
---|---|---|---|---|---|---|
AAHeV | AhAdV | AAHeV | AhAdV | |||
sex | Male | 83 | 8 (10%) | 0 (0%) | 0.813 | 0.091 |
Female | 59 | 5 (8%) | 2 (3%) | |||
Age class | Juvenile (<6 months) | 13 | 1 (8%) | 2 (15%) | 0.796 | 0.0004 |
Adult (≥6 months) | 131 | 13 (9.9%) | 1 (0.8%) | |||
Neurological disease | Yes | 27 | 6 (22%) | 0 (0%) | 0.016 | 0.410 |
No | 122 | 8 (6.6%) | 3 (2.5%) | |||
Neoplastic disease | Yes | 49 | 0 (0%) | 1 (2%) | 0.006 | 0.987 |
No | 100 | 14 (14.0%) | 2 (2.0%) | |||
Respiratory disease | Yes | 9 | 1 (11%) | 1 (11%) | 0.856 | 0.045 |
No | 140 | 13 (9.3%) | 2 (1.4%) | |||
Digestive disease | Yes | 17 | 2 (12%) | 1 (6%) | 0.730 | 0.231 |
No | 131 | 12 (9.2%) | 2 (1.5%) | |||
Oral disease | Yes | 33 | 3 (9%) | 0 (0%) | 0.957 | 0.353 |
No | 117 | 11 (9.4%) | 3 (2.6%) | |||
Skin disease | Yes | 40 | 4 (10%) | 1 (3%) | 0.878 | 0.798 |
No | 109 | 10 (9.2%) | 2 (1.8%) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Koizumi, I.; Tsukada, H.; Hayasaka, D.; Shimoda, H. Comprehensive Surveillance of Virus Infection among Captive African Pygmy Hedgehogs in Japan. Viruses 2022, 14, 857. https://doi.org/10.3390/v14050857
Koizumi I, Tsukada H, Hayasaka D, Shimoda H. Comprehensive Surveillance of Virus Infection among Captive African Pygmy Hedgehogs in Japan. Viruses. 2022; 14(5):857. https://doi.org/10.3390/v14050857
Chicago/Turabian StyleKoizumi, Iori, Hina Tsukada, Daisuke Hayasaka, and Hiroshi Shimoda. 2022. "Comprehensive Surveillance of Virus Infection among Captive African Pygmy Hedgehogs in Japan" Viruses 14, no. 5: 857. https://doi.org/10.3390/v14050857