Design of a US28 ORF Deletion Virus in a Temperature-Sensitive Cytomegalovirus Strain Fails to Promote Lytic Replication in Hematopoietic Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cells
2.2. Viruses
2.3. Multistep Growth Analyses
2.4. Infection of Kasumi-3 and CD34+ Cells
2.5. Extreme Limiting Dilution Assay
3. Results
3.1. tsC510G Displays Impaired Lytic Growth at the Non-Permissive Temperature
3.2. tsC510G-Infected Primary CD34+ Hematopoietic Progenitor Cells Reactivate from Latency
3.3. tsC510G-US28Δ-Infected Kasumi-3 Cells Have a Significantly Reduced Infectious Center Frequency When Cultured at the Non-Permissive Temperature
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Boeckh, M.; Leisenring, W.; Riddell, S.R.; Bowden, R.A.; Huang, M.L.; Myerson, D.; Stevens-Ayers, T.; Flowers, M.E.; Cunningham, T.; Corey, L. Late cytomegalovirus disease and mortality in recipients of allogeneic hematopoietic stem cell transplants: Importance of viral load and T-cell immunity. Blood 2003, 101, 407–414. [Google Scholar] [CrossRef] [PubMed]
- Boeckh, M.; Nichols, W.G. The impact of cytomegalovirus serostatus of donor and recipient before hematopoietic stem cell transplantation in the era of antiviral prophylaxis and preemptive therapy. Blood 2004, 103, 2003–2008. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- George, B.; Pati, N.; Gilroy, N.; Ratnamohan, M.; Huang, G.; Kerridge, I.; Hertzberg, M.; Gottlieb, D.; Bradstock, K. Pre-transplant cytomegalovirus (CMV) serostatus remains the most important determinant of CMV reactivation after allogeneic hematopoietic stem cell transplantation in the era of surveillance and preemptive therapy. Transpl. Infect. Dis. 2010, 12, 322–329. [Google Scholar] [CrossRef] [PubMed]
- Green, M.L.; Leisenring, W.; Xie, H.; Mast, T.C.; Cui, Y.; Sandmaier, B.M.; Sorror, M.L.; Goyal, S.; Ozkok, S.; Yi, J.; et al. Cytomegalovirus viral load and mortality after haemopoietic stem cell transplantation in the era of pre-emptive therapy: A retrospective cohort study. Lancet Haematol. 2016, 3, e119–e127. [Google Scholar] [CrossRef] [Green Version]
- Dooley, A.L.; O’Connor, C.M. Regulation of the MIE Locus During HCMV Latency and Reactivation. Pathogens 2020, 9, 869. [Google Scholar] [CrossRef] [PubMed]
- Elder, E.; Sinclair, J. HCMV latency: What regulates the regulators? Med. Microbiol. Immunol. 2019, 208, 431–438. [Google Scholar] [CrossRef] [Green Version]
- Goodrum, F. Human Cytomegalovirus Latency: Approaching the Gordian Knot. Annu. Rev. Virol. 2016, 3, 333–357. [Google Scholar] [CrossRef] [Green Version]
- Smith, N.A.; Chan, G.C.; O’Connor, C.M. Modulation of host cell signaling during cytomegalovirus latency and reactivation. Virol. J. 2021, 18, 207. [Google Scholar] [CrossRef]
- Elder, E.G.; Krishna, B.A.; Poole, E.; Perera, M.; Sinclair, J. Regulation of host and viral promoters during human cytomegalovirus latency via US28 and CTCF. J. Gen. Virol. 2021, 102, 001609. [Google Scholar] [CrossRef]
- Humby, M.S.; O’Connor, C.M. Human Cytomegalovirus US28 Is Important for Latent Infection of Hematopoietic Progenitor Cells. J. Virol. 2015, 90, 2959–2970. [Google Scholar] [CrossRef] [Green Version]
- Krishna, B.A.; Humby, M.S.; Miller, W.E.; O’Connor, C.M. Human cytomegalovirus G protein-coupled receptor US28 promotes latency by attenuating c-fos. Proc. Natl. Acad. Sci. USA 2019, 116, 1755–1764. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Krishna, B.A.; Poole, E.L.; Jackson, S.E.; Smit, M.J.; Wills, M.R.; Sinclair, J.H. Latency-Associated Expression of Human Cytomegalovirus US28 Attenuates Cell Signaling Pathways To Maintain Latent Infection. MBio 2017, 8, e01754-17. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Krishna, B.A.; Wass, A.B.; Sridharan, R.; O’Connor, C.M. The Requirement for US28 During Cytomegalovirus Latency Is Independent of US27 and US29 Gene Expression. Front. Cell. Infect. Microbiol. 2020, 10, 186. [Google Scholar] [CrossRef]
- Wu, S.E.; Miller, W.E. The HCMV US28 vGPCR induces potent Galphaq/PLC-beta signaling in monocytes leading to increased adhesion to endothelial cells. Virology 2016, 497, 233–243. [Google Scholar] [CrossRef]
- Zhu, D.; Pan, C.; Sheng, J.; Liang, H.; Bian, Z.; Liu, Y.; Trang, P.; Wu, J.; Liu, F.; Zhang, C.Y.; et al. Human cytomegalovirus reprogrammes haematopoietic progenitor cells into immunosuppressive monocytes to achieve latency. Nat. Microbiol. 2018, 3, 503–513. [Google Scholar] [CrossRef]
- Elder, E.G.; Krishna, B.A.; Williamson, J.; Lim, E.Y.; Poole, E.; Sedikides, G.X.; Wills, M.; O’Connor, C.M.; Lehner, P.J.; Sinclair, J. Interferon-Responsive Genes Are Targeted during the Establishment of Human Cytomegalovirus Latency. MBio 2019, 10, e02574-19. [Google Scholar] [CrossRef] [Green Version]
- Krishna, B.A.; Miller, W.E.; O’Connor, C.M. US28: HCMV’s Swiss Army Knife. Viruses 2018, 10, 445. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Crawford, L.B.; Caposio, P.; Kreklywich, C.; Pham, A.H.; Hancock, M.H.; Jones, T.A.; Smith, P.P.; Yurochko, A.D.; Nelson, J.A.; Streblow, D.N. Human Cytomegalovirus US28 Ligand Binding Activity Is Required for Latency in CD34(+) Hematopoietic Progenitor Cells and Humanized NSG Mice. MBio 2019, 10, e01889-19. [Google Scholar] [CrossRef] [Green Version]
- Marchini, A.; Liu, H.; Zhu, H. Human cytomegalovirus with IE-2 (UL122) deleted fails to express early lytic genes. J. Virol. 2001, 75, 1870–1878. [Google Scholar] [CrossRef] [Green Version]
- Stenberg, R.M.; Fortney, J.; Barlow, S.W.; Magrane, B.P.; Nelson, J.A.; Ghazal, P. Promoter-specific trans activation and repression by human cytomegalovirus immediate-early proteins involves common and unique protein domains. J. Virol. 1990, 64, 1556–1565. [Google Scholar] [CrossRef] [Green Version]
- Li, M.; Ball, C.B.; Collins, G.; Hu, Q.; Luse, D.S.; Price, D.H.; Meier, J.L. Human cytomegalovirus IE2 drives transcription initiation from a select subset of late infection viral promoters by host RNA polymerase II. PLoS Pathog. 2020, 16, e1008402. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Heider, J.A.; Bresnahan, W.A.; Shenk, T.E. Construction of a rationally designed human cytomegalovirus variant encoding a temperature-sensitive immediate-early 2 protein. Proc. Natl. Acad. Sci. USA 2002, 99, 3141–3146. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Leng, S.X.; Kamil, J.; Purdy, J.G.; Lemmermann, N.A.; Reddehase, M.J.; Goodrum, F.D. Recent advances in CMV tropism, latency, and diagnosis during aging. Geroscience 2017, 39, 251–259. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Peppenelli, M.; Buehler, J.; Goodrum, F. Human Hematopoietic Long-Term Culture (hLTC) for Human Cytomegalovirus Latency and Reactivation. Methods Mol. Biol. 2021, 2244, 83–101. [Google Scholar] [PubMed]
- O’Connor, C.M.; Murphy, E.A. A myeloid progenitor cell line capable of supporting human cytomegalovirus latency and reactivation, resulting in infectious progeny. J. Virol. 2012, 86, 9854–9865. [Google Scholar] [CrossRef] [Green Version]
- Tischer, B.K.; von Einem, J.; Kaufer, B.; Osterrieder, N. Two-step red-mediated recombination for versatile high-efficiency markerless DNA manipulation in Escherichia coli. Biotechniques 2006, 40, 191–197. [Google Scholar]
- Warming, S.; Costantino, N.; Court, D.L.; Jenkins, N.A.; Copeland, N.G. Simple and highly efficient BAC recombineering using galK selection. Nucleic Acids Res. 2005, 33, e36. [Google Scholar] [CrossRef]
- Hu, Y.; Smyth, G.K. ELDA: Extreme limiting dilution analysis for comparing depleted and enriched populations in stem cell and other assays. J. Immunol. Methods 2009, 347, 70–78. [Google Scholar] [CrossRef]
- Miller, W.E.; Zagorski, W.A.; Brenneman, J.D.; Avery, D.; Miller, J.L.; O’Connor, C.M. US28 is a potent activator of phospholipase C during HCMV infection of clinically relevant target cells. PLoS ONE 2012, 7, e50524. [Google Scholar] [CrossRef] [Green Version]
Primer Use | Sequence (5′ to 3′) | Primer Name |
---|---|---|
Kan-I-SceI insertion (C510G mutation) | CGCTGCCACCCCCGTGGACCTGTTGGGCGCTCTCAACCTGGGCCTGCCCCTGATGCAAAAGTCGATTTATTCAACAAAGCCACG 1 | IE2 C510G I-SceI 5′ |
ACCATGACCTGTTTGGGAAACTTTTGCATCAGGGGCAGGCCCAGGTTGAGAGCGCCCAACACGCGTATATCTGGCCCGTACATCG 1 | IE2 C510G I-SceI 3′ | |
sequencing primers | GTGACACATCCACCCGAAGTGGCGCAGCGC | C510G US |
GTCTTCGGGAGGGGTCTCGGTGGGCTGCTC | C510G DS | |
galK insertion (US28Δ) | GGTGCGTGGACCAGACGGCGTCCATGCACCGAGGGCAGAACTGGTGCTATCCCTGTTGACAATTAATCATCGGCA 2 | US28Δ galK 5′ |
AGAGGGGCGGACACGGGGTTTGTATGAAAAGGCCGAGGTAGCGCTTTTTTATCAGCACTGTCCTGCTCCTT 2 | US28Δ galK 3′ | |
ds oligo | CAGACGGCGTCCATGCACCGAGGGCAGAACTGGTGCTATCTAAAAAAGCGCTACCTCGGCCTTTTCATACAAACCCCGTG | US28Δ ds oligo |
sequencing primers | CCGCACATCTATTTTTGCTAATTGC | US28 fwr |
GCGACGAAACCCACCGTCACGG | US28 rev |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Krishna, B.A.; Wass, A.B.; Murphy, E.A.; O’Connor, C.M. Design of a US28 ORF Deletion Virus in a Temperature-Sensitive Cytomegalovirus Strain Fails to Promote Lytic Replication in Hematopoietic Cells. Viruses 2022, 14, 1280. https://doi.org/10.3390/v14061280
Krishna BA, Wass AB, Murphy EA, O’Connor CM. Design of a US28 ORF Deletion Virus in a Temperature-Sensitive Cytomegalovirus Strain Fails to Promote Lytic Replication in Hematopoietic Cells. Viruses. 2022; 14(6):1280. https://doi.org/10.3390/v14061280
Chicago/Turabian StyleKrishna, Benjamin A., Amanda B. Wass, Eain A. Murphy, and Christine M. O’Connor. 2022. "Design of a US28 ORF Deletion Virus in a Temperature-Sensitive Cytomegalovirus Strain Fails to Promote Lytic Replication in Hematopoietic Cells" Viruses 14, no. 6: 1280. https://doi.org/10.3390/v14061280