Next Article in Journal
Characterisation of the RNA Virome of Nine Ochlerotatus Species in Finland
Previous Article in Journal
Cellular and Humoral Immune Responses after Immunisation with Low Virulent African Swine Fever Virus in the Large White Inbred Babraham Line and Outbred Domestic Pigs
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Viruses
Volume 14
Issue 7
10.3390/v14071488
viruses-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Arboviral Infections in Neurological Disorders in Hospitalized Patients in São José do Rio Preto, São Paulo, Brazil

by
Bruno H. G. A. Milhim
1,
Leonardo C. da Rocha
1,
Ana C. B. Terzian
1,2,3,
Carolina C. P. Mazaro
1,
Marcos T. Augusto
1,
Adriana Luchs
4,
Nathalia Zini
1,
Livia Sacchetto
1,
Barbara F. dos Santos
1,
Pedro H. C. Garcia
1,
Rodrigo S. Rocha
1,
Elisabete Liso
5,
Vânia M. S. Brienze
5,
Gislaine C. D. da Silva
1,
Nikos Vasilakis
6,7,8,9,10,11,
Cássia F. Estofolete
1 and
Maurício L. Nogueira
1,6,*
1
Laboratório de Pesquisas em Virologia [LPV], Faculdade de Medicina de São José do Rio Preto [FAMERP], Avenida Brigadeiro Faria Lima, 5544, Vila São Jose, São José do Rio Preto 15090-000, SP, Brazil
2
Laboratório de Imunologia Celular e Molecular (LICM), Avenida Augusto de Lima, 1715, Centro, Belo Horizonte 30190-002, MG, Brazil
3
Instituto René Rachou Fundação Oswaldo Cruz, Avenida Augusto de Lima, 1715, Centro, Belo Horizonte 30190-002, MG, Brazil
4
Enteric Disease Laboratory, Department of Virology, Adolfo Lutz Institute, Avenida Dr. Arnaldo, 355, São Paulo 01246-902, SP, Brazil
5
Hospital de Base, Avenida Brigadeiro Faria Lima, 5544-Vila São Jose, São José do Rio Preto 15090-000, SP, Brazil
6
Department of Pathology, University of Texas Medical Branch, 301 University Blvd., Galveston, TX 77555-0609, USA
7
Department of Preventive Medicine and Population Health, The University of Texas Medical Branch, Galveston, TX 77555-1150, USA
8
Center for Vector-Borne and Zoonotic Diseases, The University of Texas Medical Branch, Galveston, TX 77555-0609, USA
9
Center for Biodefense and Emerging Infectious Diseases, University of Texas Medical Branch, 301 University Blvd., Galveston, TX 77555-0609, USA
10
Center for Tropical Diseases, University of Texas Medical Branch, 301 University Blvd., Galveston, TX 77555-0609, USA
11
Institute for Human Infection and Immunity, University of Texas Medical Branch, 301 University Blvd., Galveston, TX 77555-0610, USA
 
add Show full affiliation list
 
remove Hide full affiliation list
*
Author to whom correspondence should be addressed.
Viruses 2022, 14(7), 1488; https://doi.org/10.3390/v14071488
Submission received: 8 April 2022 / Revised: 3 July 2022 / Accepted: 5 July 2022 / Published: 7 July 2022
(This article belongs to the Section Human Virology and Viral Diseases)
Versions Notes

Abstract

:
Arbovirus infections are increasingly important causes of disease, whose spectrum of neurological manifestations are not fully known. This study sought to retrospectively assess the incidence of arboviruses in cerebrospinal fluid samples of patients with neurological symptoms to inform diagnosis of central and peripheral nervous system disorders. A total of 255 cerebrospinal fluid (CSF) samples collected from January 2016 to December 2017 were tested for dengue virus (DENV 1-4), Zika virus (ZIKV), and Chikungunya virus (CHIKV) in addition to other neurotropic arboviruses of interest, using genetic and serologic assays. Of the 255 CSF samples analyzed, 3.53% (09/255) were positive for arboviruses presenting mainly as meningitis, encephalitis, and cerebrovascular events, of which ZIKV was detected in 2.74% (7/255), DENV in 0.78% (2/255), in addition to an identified ILHV infection that was described previously. All the cases were detected in adults aged 18 to 74 years old. Our findings highlight the scientific and clinical importance of neurological syndromes associated with arboviruses and demonstrate the relevance of specific laboratory methods to achieve accurate diagnoses as well as highlight the true dimension of these diseases to ultimately improve public health planning and medical case management.

1. Introduction

Arthropod-borne viruses [arboviruses] are a diverse array of viruses that are the cause of major epidemic worldwide with significant public health consequences [1]. They are maintained in nature by hematophagous arthropod vectors and vertebrate hosts in ecologically and phylogenetically distinct transmission cycles [2]. Arboviruses are members of seven virus families—Togaviridae, Flaviviridae, Bunyaviridae, Reoviridae, Rhabdoviridae, Orthomyxoviridae, and Asfarviridae. Arbovirus infections manifest in a broad spectrum of illness ranging from asymptomatic to severe and fatal disease. While most infections result in a non-specific febrile illness that resolves, severe manifestations of disease are often manifest as systemic febrile illness, hemorrhagic fever, and/or invasive neurological disease [3]. For the latter, the most common etiologic agents in South America are members of the Togaviridae and Flaviviridae families, such as chikungunya (CHIKV), Venezuelan equine encephalitis (VEEV), Madariaga (MADV), Mayaro (MAYV) and dengue (DENV), Zika (ZIKV), Rocio (ROCV), and Ilheus (ILHV) viruses, respectively [4,5,6,7,8,9,10,11].
Although the incidence rate remains uncertain [12], neurological manifestations in DENV infections have been widely reported [13,14,15,16], reviewed in [10], and have ranged from encephalitis [17,18]–the most commonly reported neurological symptom–to seizures [19], mononeuropathy [20,21], cerebrovascular events [14], meningitis [22,23], and Guillain-Barré syndrome (GBS) or Miller-Fisher syndrome [15,24]. The explosive global spread of ZIKV and its introduction in South America was associated with neurological manifestations [25,26] such as congenital Zika syndrome (CZS) [26,27,28,29], neuropathy [30], GBS [31,32], stroke [33], and ocular manifestations [34,35]. Human ILHV infections have been documented throughout Central America, the Caribbean, and South America. Symptoms usually resolve within a week of onset and include fever, headaches, myalgia, muscular weakness, nausea, and photophobia [36]. However, a recent report documented severe manifestations presented as cerebral encephalitis characterized by intraparenchymal hemorrhage in the parietal lobe, surrounding brain edema and intraventricular hemorrhage [9].
The identification of viral etiologic agents causing neurologic disease can be challenging in hyperendemic areas of arbovirus circulation [7]. Currently, a diagnosis of an arboviral neuroinvasive disease is recommended to include an association between clinical and laboratory criteria. Clinical criteria include meningitis, encephalitis, acute flaccid paralysis, or other acute signs of central or peripheral neurologic dysfunction, as documented by the attending physician. Laboratory criteria are based on serum detection of viral RNA or IgM antibodies, and especially in the CSF to establish a diagnosis [37]. Often, public health agencies require diagnoses based on clinical data. However, these viruses have a large overlap of symptoms, which makes it difficult for health care professionals to establish a reliable diagnosis [38,39].
Starting in 2006, an arbovirus surveillance network for encephalitides has been established in the city of São José do Rio Preto (SJdRP), SP, Brazil. The city is located at the northwest corner of the state and is hyperendemic for various arboviruses of significant public health concern, including DENV [38,40,41,42,43,44,45,46,47,48], Saint Louis encephalitis [49,50], ZIKV [38], CHIKV [51], ILHV [9], and others. Herein, we report several cases of neurological disorders in patients hospitalized with arbovirus infections in São José do Rio Preto, SP, Brazil.

2. Materials and Methods

2.1. Study Design

This study was performed based on samples collected between January 2016 and December 2017 based on cerebrospinal fluid (CSF) samples from hospitalized patients at Hospital de Base de São José do Rio Preto, a tertiary referral center in the prefecture of São José do Rio Preto, SP, Brazil, that includes two million inhabitants and 102 municipalities. The inclusion criterion for the selection of cases was CSF samples collected from suspected CNS infections, whereas exclusion criteria included CNS infections due to bacterial and fungal infections, CNS clinical syndromes without suspected CNS infection, and presence of cranial trauma. CSF samples were stored at −70 °C.
Demographic, clinical, and laboratory data were collected from the electronic records of all patients included in the study. Confidentiality was ensured by de-identifying questionnaires and samples. The criteria adopted to confirm arbovirus infection associated with neurological involvement were CSF with viral infection patterns (e.g., increase in cell counts with a predominance of lymphocytes and monocytes, and elevated CSF protein levels), a PCR that was positive for an arbovirus or arbovirus-specific IgM antibodies detected in the presence of neurological signs, and symptoms such as meningitis, encephalitis, acute flaccid paralysis, or other acute signs of central or peripheral neurologic dysfunction, as documented by a physician.

2.2. Molecular Testing

The selected CSF samples were screened for the presence of DENV 1–4, ZIKV, CHIKV, ROCV, SLEV, WNV, MAYV, ILHV, YFV, BSQV, IGUV, and MADV. Viral RNA (vRNA) was extracted from 140 μL of sample using the QIAmp® Viral RNA (QIAGEN, Germantown, MD, USA) following the manufacturer’s recommendations.
The Trioplex real-time reverse transcriptase-polymerase chain reaction (RT-qPCR) assay was performed using the kit provided by the Centers for Disease Control and Prevention specific for Zika, Chikungunya, and all dengue serotypes [52]. A total of 10 µL of vRNA, 0.5 µM of each probe (DENV-P: FAM-CGYCTWTCAATATGC TGAAACGCG-BHQ-1; CHIKV-P: HEX-ACAGTGGTTTCGTGTGAGGGCTAC-BHQ-1; ZIKV-P: TAMRA-AGCCTACCTTGACAAGCAGTCAGACACTCAA-BHQ-1) and primers (DENV-F: TAGTCTRCGTGGACCGACAAG; DENV-R1: CAGTTGACACRCGGTTTCTC; DENV-R2: GGGTTGATACGCGGTTTCTC; CHIKV-F: ACCATCGGTGTTCCATCTAAAG; CHIKV-R: GCCTGGGCTCATCGTTATT; ZIKV-F: CCGCTGCCCAACACAAG; ZIKV-R: CCACTAACGTTCTTTTGCAGACAT), 12.5 µL of the 2X PCR Master Mix, and 0.5 µL of Superscript III RT/Platinum Taq enzyme mix (SuperScript® III Platinum® One-Step qRT-PCR System, Invitrogen, Carlsbad, CA, USA) were applied to a 96-well plate and analyzed in QuantStudio™ Dx instrument (Thermo Fisher Scientific, Waltham, MA, USA) with the following conditions: 50 °C for 30 m, followed by 45 cycles of 95 °C for 15 s, and 60 °C for 1 min. The results were interpreted as being positive when the cycle threshold (Ct) values were less than 36.
One-Step Real time multiplex PCR assays were performed using the GoTaq® Kit (Promega, Madison, WI, USA). In fourplex reaction mixtures, 50 pmol each of DENV-1- and DENV-3-specific primers, 25 pmol each of DENV-2- and DENV-4-specific primers (DENV-1 F: CAAAAGGAAGTCGTGCAATA; DENV-1 C: CTGAGTGAATTCTCTCTACTGAACC; DENV-2 F: CAGGTTATGGCACTGTCACGAT; DENV-2 C: CCATCTGCAGCAACACCATCTC; DENV-3 F: GGACTGGACACACGCACTCA; DENV-3 C: CATGTCTCTACCTTCTCGAC TTGTCT; DENV-4 F: TTGTCCTAATGATGCTGGTCG; DENV-4 C: TCCACCTGAGAC TCCTTCCA), and 9 pmol of each probe (DENV-1 P: FAM-CATGTGGTTGGGAGCACGC-BHQ-1; DENV-2 P: HEX-CTCTCCGAGAACAGGCCTCGACTTCAA-BHQ-1; DENV-3 P- TAMRA-ACCTGGATGTCGGCTGAAGGAGCTTG-BHQ-2; DENV-4 P- Cy5-TTCCTACTCCTACGCATCGCATTCCG-BHQ-3) were combined in a 50-µL volume total reaction mixture. Real-time PCR was performed on a 96-well plate and analyzed in QuantStudio™ Dx instrument (Thermo Fisher Scientific, Waltham, MA, USA) with the following conditions: 50 °C for 30 m, followed by 45 cycles of 95 °C for 15 s, and 60 °C for 1 min. Ct values of less than 36 were interpreted as positive [53].
To identify Brazilian alphaviruses and flaviviruses (MAYV, MADV and ROCV, SLEV, WNV, ILHV, YFV, BSQV, IGUV, respectively), we performed the duplex-nested PCR assay targeting a conserved domain of the nonstructural protein 1 (nsp1) and 5 (NS5) genes of Brazilian alphaviruses and flaviviruses, respectively [54]. The primers M2W-YAGAGCDTTTTCGCAYSTRGCHW and cM3W-ACATRAANKGNGTNGTRTCRAANCCDAYCC) anneal to the alphavirus nsp1 and primers FG1-TCAAGGAACTCCACACATGAGATGTACT and FG2-GTGTCCCATCCTGCTGTGTCATCAGCATACA anneal to the flavivirus NS5 gene. Precautions taken to avoid contamination have been described previously [55].

2.3. Serological Testing

Cerebrospinal fluid samples were screened for exposure to DENV, ZIKV, and CHIKV infection using the anti-Dengue IgM-ABCAM kit (Abcam plc, Cambridge, UK—ab108729), EUROIMMUN human anti-ZIKV IgM ELISA kit (EUROIMMUN, EURO-AG, Luebeck, Germany—EI 2668-9601 M), and EUROIMMUN human anti-CHIKV IgM kit (EUROIMMUN, EURO-AG, Luebeck, Germany—EI 293a-9601 M). All assays were performed according to the manufacturer’s recommendations using the corresponding positive and negative controls. ELISA plates were read using a Spectramax Plus ELISA reader at 450 nm (Molecular Devices, LLC, San Jose, CA, USA). Results were expressed in Standard Units (PU) and interpreted as <0.8 negative, >0.8 and <1.1 equivocal and >1.1 positive.

2.4. Ethical Approval

Ethics Committee approval was granted by the São José do Rio Preto School of Medicine (FAMERP), protocol number 81649317.5.0000.5415, approved on 24 May 2019.

3. Results

3.1. General Characteristics

We selected from the biobank of the Hospital de Base de São José do Rio Preto; 299 samples collected between January 2016 and December 2017 for further analysis. Based on the exclusion criteria defined above (Section 2.1) 44 samples were excluded, resulting in 255 samples for analysis, for which we have included demographic data (age and gender) and their clinical diagnoses. The age mean of the sample cohort was 30.2 years (±28.0) (range: 1 day old to 90 years), of which 60.4% (n = 154) were male. Meningitis was the most common clinical syndrome (n = 107, 42.0%) observed, followed by cerebrovascular events, recorded as bleeding or stroke (n = 42, 16.5%), and meningoencephalitis (n = 57, 22.4%); there was 1 case each of venous thrombosis (0.4%) and demyelinating polyneuropathy (0.4%).

3.2. Arboviral Infection Diagnosis

Through molecular and serological analyses, arboviruses were detected in 9 out of 255 samples, representing a rate of 3.53%. Of these, 8 (3.13%) were determined to be positive by RNA detection, 6 positive for ZIKV, and 2 for DENV. Neither CHIKV, ROCV, SLEV, WNV, MAYV, YFV, BSQV, MADV, nor IGUV were identified in the samples tested. During the study, a case of ILHV was identified and has already been described previously [9] and not included herein. Serological diagnosis was positive for 1/255 samples (0.39%), by the ZIKV IgM ELISA. Neither anti-dengue nor anti-CHIKV IgM antibodies were detected in any of the examined samples.

3.3. Clinical Findings

Table 1 summarizes the clinical findings of the nine arbovirus-positive patients. The age of the patients ranged from 18 to 74 years, seven of whom were adults [18–65 years old] and two of whom were elderly (older than 65). Of the positive cases, 55.5% (5/9) were women. Meningitis (3/9; 33.33%) and encephalitis (3/9; 33.33%) were the main clinical symptoms observed, followed by brain bleeding (2/9; 22.22%) and, in one case, demyelinating polyneuropathy (1/9; 11.11%).
Among the ZIKV-infected patients, three meningitis cases were identified, two of which were diagnosed by molecular testing (a ZIKV-positive PCR), and the third was identified by antibody detection (anti-ZIKV IgM positive). Three of these patients had underlying comorbidities, patients 253 and 257 were HIV positive, and patient 272 had hyper-IgD syndrome. In addition, one case of encephalitis (ID 194), two cases with brain bleeding (ID177 and ID 248), and one case of demyelinating polyneuropathy (ID 257) was associated with ZIKV (Table 1).

4. Discussion

Herein, we describe the incidence of arboviruses as a collective cause of neuroinvasive disorders in a region where they cocirculate and where DENV and ZIKV transmission is dominant. The study emerged from the need to identify such serious manifestations in a region of complex arbovirus transmission dynamics that is hyperendemic for all DENV serotypes [42,44,45,47], has had a previous ZIKV outbreak [51,56], CHIKV and SLEV [40,49] have been detected, and with high levels of YFV vaccination [57]. Such aspects have become crucial to the understanding of how arboviruses spread worldwide.
Globally, arboviruses with the potential for neuroinvasion cause neurological disease at a rate of 50/100,000 cases per year [58,59,60]. Studies have reported that 40% to 70% of patients maintained neuropsychological and functional impairments for years after an acute neurological episode [61,62,63,64]. In 50% of cases, the causative agent may not be identified [65,66]. In Brazil, some studies have found neurological disorders to be related to arboviral infections [5,67,68,69]; however, most of these studies do not describe a systematic surveillance system for detecting arboviruses and largely consist of case reports [70,71,72,73,74]. Encephalitis is the most common form of neuroinvasive disease [75], followed by polyradiculopathies [76]. The patients with arboviral infections detected in the present study most frequently exhibited symptoms of encephalitis and meningitis (each at a rate of 33.33%); these infections were also associated with two cases of brain bleeding (22.22%) and one case of demyelinating polyneuropathy (11.11%).
Often, suspected cases of viral meningoencephalitis are reported without diagnosis of its causative agent. The severity of such cases varies depending on the accuracy of the diagnosis, the etiological agent involved, and the age and immunological status of the patient [77]. The viruses most commonly associated with meningoencephalitis are herpes simplex, enteroviruses, and the varicella zoster virus, but there are also reports of arboviruses being associated with meningoencephalitis [16,77,78], as in the present study. In these cases, the most commonly reported clinical manifestations were meningitis and encephalitis, presentations that reinforce the relationship these conditions exhibit with DENV and ZIKV.
Between 2015 and 2019, the city of São José do Rio Preto reported 44,898 dengue cases [79] and 2169 Zika cases [80]. Although the Zika cases were of a lesser magnitude, the surveillance of arbovirus-related neurological findings detected Zika at a rate three times higher than that of dengue. This observation was noteworthy in itself because it suggested central nervous system involvement in ZIKV infection. The neurotropism and neurovirulence of ZIKV has been extensively documented since its 2015 re-emergence, mainly through cases of congenital Zika syndrome (CZS) [26,81]. These cases exemplify the serious impact of ZIKV infection on human fetal brain development. Furthermore, studies show that infection in children and adults is also linked to structural and functional neural abnormalities [82], such as the ability to infect and replicate in endothelial cells of the blood–brain barrier [83,84]. However, reports of cerebrovascular manifestations associated with Zika are rare and have been confined to case reports [33,70] and in the current study, in which we have diagnosed two cases.
It is challenging to determine clinical associations between arbovirus and neurological events and to establish etiological diagnoses. Herein, we identified a case (ID 248) in which the patient presented classic symptoms of acute ZIKV infection with a brain bleed, which corroborates other recent observations [70]. In contrast, we observed another case (ID 177) in which the patient exhibited no symptoms of arboviral infection, but the molecular RT-qPCR used in our study detected acute ZIKV infection with an ischemic vascular incident and in the absence of coagulation disorders. These cases demonstrate the complexity of establishing clinical correlations with arboviral infections and show that the etiological diagnosis can be even more difficult when the patient may not present symptoms of arboviral infection.
In addition to acute neurological involvement, post-infectious autoimmune disorders are also caused by arboviruses and are characterized by bilateral flaccid limb weakness attributable to peripheral nerve damage, which can lead to syndromes such as GBS and transverse myelitis [85,86]. Similarly, our study found a case (ID 257) of demyelinating polyneuropathy in which the patient was hospitalized due to ataxia and decreased lower limb strength. In this case, the electroneuromyography revealed an acute demyelinating pattern, and the CSF tested positive for ZIKV when RT-qPCR was used.
Three cases of ZIKV-positive patients were also HIV positive with AIDS syndrome, and one of these patients had leukopenia (2580 leukocytes/mm3). There are few reports in the literature on the relationship between ZIKV and HIV. A previous clinical case study described an autochthonous case of ZIKV infection in an HIV-infected patient in Brazil, in which the patient presented with mild symptoms [87]. However, there is also a case of ZIKV infection from the same region in which a ZIKV infection acquired during the first trimester in an HIV-infected pregnant woman led to multiple fetal malformations and fetal death [88]. Our study reflects the need for a greater understanding of this infection in different population groups and suggests that further studies should be performed in order to expand knowledge on arboviral infections in different populations.
Although the viruses cause a similarly broad range of CNS manifestations, our study shows that the use of laboratory tests may help health professionals to diagnose neuroinvasive diseases related to arboviruses such as DENV and ZIKV. Furthermore, the ILHV case found during our analyses showed that populations may be at risk for other underreported neuroinvasive arboviruses that may be circulating [9], since epidemiological surveillance does not typically cover all of the arboviruses considered herein (ROCV, SLEV, WNV, MAYV, ILHV, BSQV, IGUV and MADV) as potential causes of neurological manifestations.
This study exemplifies the usefulness of associating clinical and laboratory data to determine cases of arboviral infection associated with neuropathy. To achieve an accurate diagnosis, it is important to consider geography (the SJdRP region is hyperendemic for dengue [42,89] and multiple arboviruses cocirculate [40,89]), clinical data typical of arbovirus infection, and also laboratory data, such as CSF, cell and protein assessments, and information provided by molecular and serological assays.
The current study was carried out in a retrospective cross-sectional manner based on samples obtained from an institutional biobank. Our ability to detect arboviral genetic signatures in the CSF samples of patients with neurological manifestations suggests a strong correlation with arboviral infection albeit at low incidence rate. Prospective surveillance studies that include collection of serum and CSF samples in patients with neurologic manifestation will be critical, providing insights into the incidence and prevalence arbovirus infections contribute to neurological outcomes. Finally, we would like to reiterate to health care professionals the importance of establishing an accurate etiological diagnosis based on comprehensive laboratory analysis. Even if there is not yet a specific treatment for neuroinvasive disease caused by arboviruses, the true impact of these viruses on the population can become clearer with the acquisition of additional data, which in turn can guide future research. One reason for the absence of specific treatments may be the lack of understanding of the full spectrum of arboviral clinical presentations and specifically neurological presentations.

5. Conclusions

In conclusion, our study offers insights regarding the frequency of neurological manifestations following arbovirus infections. We have demonstrated a pathway based of commonly available laboratory tests to provide an accurate diagnosis and correlate neurological manifestations to arbovirus infections. Our retrospective study illustrates the importance of epidemiological surveillance of neuroinvasive arboviruses in accurately determining the true incidence and prevalence in hyperendemic regions, in order to guide public health officials and policy makers for improvements in public health planning and medical case management.

Author Contributions

Conceptualization: B.H.G.A.M., C.F.E., N.V. and M.L.N.; data curation: B.H.G.A.M., C.F.E., M.T.A., B.F.d.S., P.H.C.G., R.S.R., E.L., V.M.S.B. and M.L.N.; formal analysis: B.H.G.A.M., C.F.E., L.C.d.R., A.C.B.T., N.Z., L.S., G.C.D.d.S. and M.L.N.; funding acquisition: M.L.N. and N.V.; investigation: B.H.G.A.M., C.F.E., A.L. and N.Z.; methodology: B.H.G.A.M., C.F.E., L.C.d.R. and M.L.N.; project administration: C.F.E. and M.L.N.; resources: C.F.E. and M.L.N.; supervision: C.F.E. and M.L.N.; writing—original draft: B.H.G.A.M., C.F.E., N.V. and M.L.N.; writing—review and editing: B.H.G.A.M., C.F.E., N.V., C.C.P.M. and M.L.N. The material described above is original work contributed equally by all authors, who have read and agreed to the published version of the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by the São Paulo Research Foundation [FAPESP] via grant numbers 2013/21719-3 and 2016/15021-1 for MLN, 2015/12295-0 for ACBT, 2019/065722 for BHGAM, and 2017/216881 for MTA. The study is partly funded by the Centers for Research in Emerging Infectious Diseases [CREID], “The Coordinating Research on Emerging Arboviral Threats Encompassing the Neotropics [CREATE-NEO]” grant U01 AI151807 by the National Institutes of Health [NIH]. The funders had no role in the design of the study, collection, analyses, or interpretation of data, writing of the manuscript, or in the decision to publish the results.

Institutional Review Board Statement

The study was conducted according to the guidelines of the Declaration of Helsinki and approved by the Institutional Review Board of the São José do Rio Preto School of Medicine [FAMERP], protocol number 81649317.5.0000.5415, approved on 24 May 2019.

Informed Consent Statement

This study was performed in retrospective samples collected for routine health care purposes and the waiver of consent term was approved by FAMERP IRB (protocol number 81649317.5.0000.5415, on 24 May 2019).

Data Availability Statement

De-identified data are available from the authors upon request.

Acknowledgments

We would like to thank the health care professionals of Hospital de Base de São José do Rio Preto for providing the CSF for this study, and the entire LPV group for helping with laboratory procedures and data collection.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses or interpretation of data; in the writing of the manuscript or in the decision to publish the results.

References

  1. Weaver, S.C.; Reisen, W.K. Present and future arboviral threats. Antivir. Res. 2010, 85, 328–345. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Weaver, S.C.; Charlier, C.; Vasilakis, N.; Lecuit, M. Zika, Chikungunya, and Other Emerging Vector-Borne Viral Diseases. Annu. Rev. Med. 2018, 69, 395–408. [Google Scholar] [CrossRef] [PubMed]
  3. Gubler, D.; Vasilakis, N. (Eds.) The Arboviruses: Quo Vadis? In Arboviruses—Molecular Biology, Evolution and Control; Caister Academic Press: Norwich, UK, 2016; pp. 1–6. [Google Scholar]
  4. Solomon, T. Flavivirus Encephalitis. N. Engl. J. Med. 2004, 351, 370–378. [Google Scholar] [CrossRef] [PubMed]
  5. De Azevedo, M.B.; Coutinho, M.S.C.; Da Silva, M.A.; Arduini, D.B.; Lima, J.D.V.; Monteiro, R.; Mendes, B.N.B.; Lemos, M.C.F.; Noronha, C.P.; Saraceni, V. Neurologic manifestations in emerging arboviral diseases in Rio de Janeiro City, Brazil, 2015–2016. Rev. Soc. Bras. Med. Trop. 2018, 51, 347–351. [Google Scholar] [CrossRef] [PubMed]
  6. Solomon, T.; Dung, N.M.; Vaughn, D.W.; Kneen, R.; Thao, L.T.T.; Raengsakulrach, B.; Loan, H.T.; Day, N.P.; Farrar, J.; Myint, K.S.; et al. Neurological manifestations of dengue infection. Lancet 2000, 355, 1053–1059. [Google Scholar] [CrossRef]
  7. Acevedo, N.; Waggoner, J.; Rodriguez, M.; Rivera, L.; Landivar, J.; Pinsky, B.; Zambrano, H. Zika Virus, Chikungunya Virus, and Dengue Virus in Cerebrospinal Fluid from Adults with Neurological Manifestations, Guayaquil, Ecuador. Front. Microbiol. 2017, 8, 42. [Google Scholar] [CrossRef] [Green Version]
  8. Saivish, M.V.; Gomes da Costa, V.; de Lima Menezes, G.; Alves da Silva, R.; Dutra da Silva, G.C.; Moreli, M.L.; Sacchetto, L.; Pacca-Mazaro, C.C.; Vasilakis, N.; Nogueira, M.L. Rocio Virus: An Updated View on an Elusive Flavivirus. Viruses 2021, 13, 2293. [Google Scholar] [CrossRef]
  9. Milhim, B.H.G.A.; Estofolete, C.F.; Da Rocha, L.C.; Liso, E.; Brienze, V.M.S.; Vasilakis, N.; Terzian, A.C.B.; Nogueira, M.L. Fatal Outcome of Ilheus Virus in the Cerebrospinal Fluid of a Patient Diagnosed with Encephalitis. Viruses 2020, 12, 957. [Google Scholar] [CrossRef]
  10. Estofolete, C.F.; de Oliveira Mota, M.T.; Bernardes Terzian, A.C.; de Aguiar Milhim, B.H.G.; Ribeiro, M.R.; Nunes, D.V.; Mourão, M.P.; Rossi, S.L.; Nogueira, M.L.; Vasilakis, N. Unusual clinical manifestations of dengue disease—Real or imagined? Acta Trop. 2019, 199, 105134. [Google Scholar] [CrossRef]
  11. Weaver, S.C.; Ferro, C.; Barrera, R.; Boshell, J.; Navarro, J.C. Venezuelan Equine Encephalitis. Annu. Rev. Entomol. 2004, 49, 141–174. [Google Scholar] [CrossRef]
  12. Carod-Artal, F.J.; Wichmann, O.; Farrar, J.; Gascón, J. Neurological complications of dengue virus infection. Lancet Neurol. 2013, 12, 906–919. [Google Scholar] [CrossRef]
  13. Sulekha, C.; Kumar, S.; Philip, J. Guillain-Barre syndrome following dengue fever. Indian Pediatr. 2004, 41, 948–950. [Google Scholar] [PubMed]
  14. Mathew, S.; Pandian, J.D. Stroke in Patients with Dengue. J. Stroke Cerebrovasc. Dis. 2010, 19, 253–256. [Google Scholar] [CrossRef] [PubMed]
  15. Sharma, C.M.; Kumawat, B.L.; Ralot, T.; Tripathi, G.; Dixit, S. Guillain-Barre syndrome occurring during dengue fever. J. Indian Med. Assoc. 2011, 109, 675–682. [Google Scholar] [PubMed]
  16. Marinho, P.E.S.; De Oliveira, D.B.; Candiani, T.M.S.; Crispim, A.P.C.; Alvarenga, P.P.M.; Castro, F.C.D.S.; Abrahão, J.S.; Rios, M.; Coimbra, R.S.; Kroon, E.G. Meningitis Associated with Simultaneous Infection by Multiple Dengue Virus Serotypes in Children, Brazil. Emerg. Infect. Dis. 2017, 23, 115–118. [Google Scholar] [CrossRef] [Green Version]
  17. Kyaw, A.K.; Tun, M.M.N.; Nabeshima, T.; Buerano, C.C.; Ando, T.; Inoue, S.; Hayasaka, D.; Lim, C.-K.; Saijo, M.; Thu, H.M.; et al. Japanese Encephalitis- and Dengue-Associated Acute Encephalitis Syndrome Cases in Myanmar. Am. J. Trop. Med. Hyg. 2019, 100, 643–646. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  18. Christo, P.P. Encephalitis by dengue virus and other arboviruses. Arq. Neuro-Psiquiatr. 2015, 73, 641–643. [Google Scholar] [CrossRef] [Green Version]
  19. Chen, T.-C.; Perng, D.-S.; Tsai, J.-J.; Lu, P.-L.; Chen, T.-P. Dengue hemorrhagic fever complicated with acute pancreatitis and seizure. J. Formos. Med. Assoc. 2004, 103, 865–868. [Google Scholar]
  20. Garg, R.K.; Malhotra, H.S.; Jain, A.; Malhotra, K.P. Dengue-associated neuromuscular complications. Neurol. India 2015, 63, 497–516. [Google Scholar] [CrossRef]
  21. Martínez-Catalán, N.; Valencia, M.; Del Palacio, M.; Fernández-Jara, J.; Calvo, E. Isolated spinal accessory nerve mononeuropathy causing winging scapula: An unusual peripheral nervous system manifestation of dengue fever. JSES Int. 2020, 4, 491–494. [Google Scholar] [CrossRef]
  22. Soares, C.N.; Cabral-Castro, M.J.; Peralta, J.M.; de Freitas, M.R.; Zalis, M.; Puccioni-Sohler, M. Review of the etiologies of viral meningitis and encephalitis in a dengue endemic region. J. Neurol. Sci. 2011, 303, 75–79. [Google Scholar] [CrossRef] [PubMed]
  23. Mamdouh, K.H.; Mroog, K.M.; Hani, N.H.; Nabil, E.M. Atypical Dengue Meningitis in Makkah, Saudi Arabia with Slow Resolving, Prominent Migraine like Headache, Phobia, and Arrhythmia. J. Glob. Infect. Dis. 2013, 5, 183–186. [Google Scholar] [CrossRef] [PubMed]
  24. Gonçalves, E. Acute inflammatory demyelinating polyradiculoneuropathy (Guillain-Barré syndrome) following dengue fever. Rev. Inst. Med. Trop. S. Paulo 2011, 53, 223–225. [Google Scholar] [CrossRef] [Green Version]
  25. Cao-Lormeau, V.-M.; Blake, A.; Mons, S.; Lastère, S.; Roche, C.; Vanhomwegen, J.; Dub, T.; Baudouin, L.; Teissier, A.; Larre, P.; et al. Guillain-Barré Syndrome outbreak associated with Zika virus infection in French Polynesia: A case-control study. Lancet 2016, 387, 1531–1539. [Google Scholar] [CrossRef] [Green Version]
  26. de Araújo, T.V.B.; Rodrigues, L.C.; de Alencar Ximenes, R.A.; de Barros Miranda-Filho, D.; Montarroyos, U.R.; de Melo, A.P.L.; Valongueiro, S.; Braga, C.; Vazquez, E.; Dhalia, R.; et al. Association between Zika virus infection and microcephaly in Brazil, January to May, 2016: Preliminary report of a case-control study. Lancet Infect. Dis. 2016, 16, 1356–1363. [Google Scholar] [CrossRef] [Green Version]
  27. Brasil, P.; Pereira, J.P.; Moreira, M.E.; Ribeiro Nogueira, R.M.; Damasceno, L.; Wakimoto, M.; Rabello, R.S.; Valderramos, S.G.; Halai, U.-A.; Salles, T.S.; et al. Zika Virus Infection in Pregnant Women in Rio de Janeiro. N. Engl. J. Med. 2016, 375, 2321–2334. [Google Scholar] [CrossRef]
  28. Johansson, M.A.; Mier-Y-Teran-Romero, L.; Reefhuis, J.; Gilboa, S.M.; Hills, S.L. Zika and the Risk of Microcephaly. N. Engl. J. Med. 2016, 375, 1–4. [Google Scholar] [CrossRef]
  29. Broutet, N.; Krauer, F.; Riesen, M.; Khalakdina, A.; Almiron, M.; Aldighieri, S.; Espinal, M.; Low, N.; Dye, C. Zika Virus as a Cause of Neurologic Disorders. N. Engl. J. Med. 2016, 374, 1506–1509. [Google Scholar] [CrossRef] [Green Version]
  30. Zhou, K.; Wang, L.; Yu, D.; Huang, H.; Ji, H.; Mo, X. Molecular and cellular insights into Zika virus-related neuropathies. J. NeuroVirology 2017, 23, 341–346. [Google Scholar] [CrossRef] [Green Version]
  31. Oehler, E.; Watrin, L.; Larre, P.; Leparc-Goffart, I.; Lastere, S.; Valour, F.; Baudouin, L.; Mallet, H.P.; Musso, D.; Ghawche, F. Zika virus infection complicated by Guillain-Barre syndrome—Case Report, French Polynesia, December 2013. Eurosurveillance 2014, 19, 20720. [Google Scholar] [CrossRef] [Green Version]
  32. do Rosário, M.S.; de Jesus, P.A.; Vasilakis, N.; Farias, D.S.; Novaes, M.A.; Rodrigues, S.G.; Martins, L.C.; da Costa Vasconcelos, P.F.; Ko, I.A.; de Siqueira, I.C.; et al. Guillain-Barré Syndrome After Zika Virus Infection in Brazil. Am. J. Trop. Med. Hyg. 2016, 95, 1157–1160. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Landais, A.; Césaire, A.; Fernandez, M.; Breurec, S.; Herrmann, C.; Delion, F.; Desprez, P. ZIKA Vasculitis: A new cause of stroke in children? J. Neurol. Sci. 2017, 383, 211–213. [Google Scholar] [CrossRef] [PubMed]
  34. de Paula Freitas, B.; de Oliveira Dias, J.R.; Prazeres, J.; Sacramento, G.A.; Ko, A.I.; Maia, M.; Belfort, R., Jr. Ocular Findings in Infants with Microcephaly Associated with Presumed Zika Virus Congenital Infection in Salvador, Brazil. JAMA Ophthalmol. 2016, 134, 529–535. [Google Scholar] [CrossRef] [Green Version]
  35. Ventura, C.V.; Maia, M.; Bravo-Filho, V.; Góis, A.L.; Belfort, R., Jr. Zika virus in Brazil and macular atrophy in a child with microcephaly. Lancet 2016, 387, 228. [Google Scholar] [CrossRef] [Green Version]
  36. Causey, O.R.; Causey, C.E.; Maroja, O.M.; Macedo, D.G. The Isolation of Arthropod-Borne Viruses, including Members of Two Hitherto Undescribed Serological Groups, in the Amazon Region of Brazil. Am. J. Trop. Med. Hyg. 1961, 10, 227–249. [Google Scholar] [CrossRef] [PubMed]
  37. CDC. Arboviral Diseases, Neuroinvasive and Non-Neuroinvasive 2015 Case Definition. 2015. Available online: https://ndc.services.cdc.gov/case-definitions/arboviral-diseases-neuroinvasive-and-non-neuroinvasive-2015/ (accessed on 5 February 2022).
  38. Fernanda Estofolete, C.; Terzian, A.C.; Parreira, R.; Esteves, A.; Hardman, L.; Greque, G.V.; Rahal, P.; Nogueira, M.L. Clinical and laboratory profile of Zika virus infection in dengue suspected patients: A Case Series. J. Clin. Virol. 2016, 81, 25–30. [Google Scholar] [CrossRef] [Green Version]
  39. Clé, M.; Eldin, P.; Briant, L.; Lannuzel, A.; Simonin, Y.; Van De Perre, P.; Cabié, A.; Salinas, S. Neurocognitive impacts of arbovirus infections. J. Neuroinflamm. 2020, 17, 233. [Google Scholar] [CrossRef]
  40. Terzian, A.C.B.; Mondini, A.; Bronzoni, R.V.; Drumond, B.P.; Ferro, B.P.; Cabrera, E.M.; Figueiredo, L.T.M.; Chiaravalloti-Neto, F.; Nogueira, M.L. Detection of Saint Louis Encephalitis Virus in Dengue-Suspected Cases During a Dengue 3 Outbreak. Vector Borne Zoonotic Dis. 2011, 11, 291–300. [Google Scholar] [CrossRef]
  41. Mondini, A.; Chiaravalloti Neto, F.; Gallo Y Sanches, M.; Lopes, J.C. Spatial analysis of dengue transmission in a medium-sized city in Brazil. Rev. Saude Publica 2005, 39, 444–451. [Google Scholar] [CrossRef] [Green Version]
  42. Colombo, T.E.; Vedovello, D.; Pacca-Mazaro, C.C.; Mondini, A.; Araújo, J.P.; Cabrera, E.; Lopes, J.C.; Penha dos Santos, I.N.; Reis, A.F.N.; Costa, F.R.; et al. Dengue virus surveillance: Detection of DENV-4 in the city of São José do Rio Preto, SP, Brazil. Acta Trop. 2016, 164, 84–89. [Google Scholar] [CrossRef] [Green Version]
  43. Mondini, A.; Bronzoni, R.V.D.M.; Nunes, S.H.P.; Chiaravalloti-Neto, F.; Massad, E.; Alonso, W.; Lázzaro, E.S.M.; Ferraz, A.A.; Zanotto, P.M.D.A.; Nogueira, M.L. Spatio-Temporal Tracking and Phylodynamics of an Urban Dengue 3 Outbreak in São Paulo, Brazil. PLoS Negl. Trop. Dis. 2009, 3, e448. [Google Scholar] [CrossRef] [PubMed]
  44. Drumond, B.P.; Mondini, A.; Schmidt, D.J.; Bosch, I.; Nogueira, M. Population dynamics of DENV-1 genotype V in Brazil is characterized by co-circulation and strain/lineage replacement. Arch. Virol. 2012, 157, 2061–2073. [Google Scholar] [CrossRef] [Green Version]
  45. Drumond, B.P.; Mondini, A.; Schmidt, D.J.; Bronzoni, R.V.D.M.; Bosch, I.; Nogueira, M.L. Circulation of Different Lineages of Dengue Virus 2, Genotype American/Asian in Brazil: Dynamics and Molecular and Phylogenetic Characterization. PLoS ONE 2013, 8, e59422. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  46. Mota, M.T.D.O.; Estofolete, C.F.; Zini, N.; Terzian, A.C.B.; Gongora, D.V.N.; Maia, I.L.; Nogueira, M.L. Transverse Myelitis as an Unusual Complication of Dengue Fever. Am. J. Trop. Med. Hyg. 2016, 96, 380–381. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  47. Chiaravalloti-Neto, F.; Pereira, M.; Fávaro, E.A.; Dibo, M.R.; Mondini, A.; Rodrigues-Junior, A.L.; Chierotti, A.P.; Nogueira, M.L. Assessment of the relationship between entomologic indicators of Aedes aegypti and the epidemic occurrence of dengue virus 3 in a susceptible population, São José do Rio Preto, São Paulo, Brazil. Acta Trop. 2015, 142, 167–177. [Google Scholar] [CrossRef]
  48. Villabona-Arenas, C.J.; Mondini, A.; Bosch, I.; Schimdt, D.J.; Schimitt, D.; Calzavara-Silva, C.E.; de A Zanotto, P.M.; Nogueira, M.L. Dengue virus type 3 adaptive changes during epidemics in São Jose de Rio Preto, Brazil, 2006–2007. PLoS ONE 2013, 8, e63496. [Google Scholar]
  49. Mondini, A.; Bronzoni, R.V.; Cardeal, I.L.; dos Santos, T.M.; Lázaro, E.; Nunes, S.H.; Silva, G.C.D.; Nogueira, M.L.; Chiaravalloti, F.N.; Rahal, P.; et al. Simultaneous infection by DENV-3 and SLEV in Brazil. J. Clin. Virol. 2007, 40, 84–86. [Google Scholar] [CrossRef]
  50. Mondini, A.; Cardeal, I.L.S.; Lázaro, E.; Nunes, S.H.; Moreira, C.C.; Rahal, P.; Maia, I.L.; Franco, C.; Góngora, D.V.N.; Góngora-Rubio, F.; et al. Saint Louis Encephalitis Virus, Brazil. Emerg. Infect. Dis. 2007, 13, 176–178. [Google Scholar] [CrossRef]
  51. Colombo, T.E.; Estofolete, C.F.; Reis, A.F.N.; da Silva, N.S.; Aguiar, M.L.; Cabrera, E.M.S.; dos Santos, I.N.P.; Costa, F.R.; Cruz, L.E.A.A.; Rombola, P.L.; et al. Clinical, laboratory and virological data from suspected ZIKV patients in an endemic arbovirus area. J. Clin. Virol. 2017, 96, 20–25. [Google Scholar] [CrossRef]
  52. CDC. Trioplex Real-Time RT-PCR Assay. Instruction for Use. 2017. Available online: https://www.cdc.gov/zika/pdfs/trioplex-real-time-rt-pcr-assay-instructions-for-use.pdf (accessed on 7 February 2018).
  53. Johnson, B.W.; Russell, B.J.; Lanciotti, R.S. Serotype-Specific Detection of Dengue Viruses in a Fourplex Real-Time Reverse Transcriptase PCR Assay. J. Clin. Microbiol. 2005, 43, 4977–4983. [Google Scholar] [CrossRef] [Green Version]
  54. de Morais Bronzoni, R.V.; Baleotti, F.G.; Ribeiro Nogueira, R.M.; Nunes, M.; Moraes Figueiredo, L.T. Duplex reverse transcription-PCR followed by nested PCR assays for detection and identification of Brazilian alphaviruses and flaviviruses. J. Clin. Microbiol. 2005, 43, 696–702. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  55. Ausubel, F.M.; Brent, R.; Kingston, R.E.; Moore, D.D.; Seidman, J.; Smith, J.A.; Struhl, K. Current Protocols in Molecular Biology; John Wiley & Sons: Hoboken, NJ, USA, 2003. [Google Scholar]
  56. Nogueira, M.L.; Nery Júnior, N.R.R.; Estofolete, C.F.; Bernardes Terzian, A.C.; Guimarães, G.F.; Zini, N.; da Silva, R.A.; Silva, G.C.D.; Franco, L.C.J.; Rahal, P.; et al. Adverse birth outcomes associated with Zika virus exposure during pregnancy in São José do Rio Preto, Brazil. Clin. Microbiol. Infect. 2018, 24, 646–652. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  57. Saad, L.D.; Barata, R.B. Yellow fever outbreaks in São Paulo State, Brazil, 2000–2010. Epidemiol. Serv. Saude 2016, 25, 531–540. [Google Scholar] [CrossRef] [PubMed]
  58. Monnet, F.P. Behavioural disturbances following Japanese B encephalitis. Eur. Psychiatry 2003, 18, 269–273. [Google Scholar] [CrossRef]
  59. LaBeaud, A.D.; Bashir, F.; King, C.H. Measuring the burden of arboviral diseases: The spectrum of morbidity and mortality from four prevalent infections. Popul. Health Metr. 2011, 9, 1. [Google Scholar] [CrossRef] [Green Version]
  60. Joshi, R.; Mishra, P.K.; Joshi, D.; Santhosh, S.; Parida, M.; Desikan, P.; Gangane, N.; Kalantri, S.; Reingold, A.; Colford, J.M. Clinical presentation, etiology, and survival in adult acute encephalitis syndrome in rural Central India. Clin. Neurol. Neurosurg. 2013, 115, 1753–1761. [Google Scholar] [CrossRef] [Green Version]
  61. Klee, A.L.; Maldin, B.; Edwin, B.; Poshni, I.; Mostashari, F.; Fine, A.; Layton, M.; Nash, D. Long-Term Prognosis for Clinical West Nile Virus Infection. Emerg. Infect. Dis. 2004, 10, 1405–1411. [Google Scholar] [CrossRef]
  62. Berg, P.J.; Smallfield, S.; Svien, L. An investigation of depression and fatigue post West Nile virus infection. S. Dak. Med. 2010, 63, 127. [Google Scholar]
  63. Sadek, J.R.; Pergam, S.A.; Harrington, J.A.; Echevarria, L.A.; Davis, L.E.; Goade, D.; Nofchissey, R.A.; Sewell, C.M.; Ettestad, P.; Haaland, K.Y. Persistent neuropsychological impairment associated with West Nile virus infection. J. Clin. Exp. Neuropsychol. 2010, 32, 81–87. [Google Scholar] [CrossRef]
  64. Hoffman, J.E.; Paschal, K.A. Functional Outcomes of Adult Patients with West Nile Virus Admitted to a Rehabilitation Hospital. J. Geriatr. Phys. Ther. 2013, 36, 55–62. [Google Scholar] [CrossRef]
  65. George, B.P.; Schneider, E.B.; Venkatesan, A. Encephalitis Hospitalization Rates and Inpatient Mortality in the United States, 2000–2010. PLoS ONE 2014, 9, e104169. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  66. Vora, N.M.; Holman, R.C.; Mehal, J.M.; Steiner, C.A.; Blanton, J.; Sejvar, J. Burden of encephalitis-associated hospitalizations in the United States, 1998–2010. Neurology 2014, 82, 443–451. [Google Scholar] [CrossRef]
  67. De Lima, E.C.B.; Montarroyos, U.R.; De Magalhães, J.J.F.; Dimech, G.S.; Lacerda, H.R. Survival analysis in non-congenital neurological disorders related to dengue, chikungunya and Zika virus infections in Northeast Brazil. Rev. Inst. Med. Trop. S. Paulo 2020, 62, e69. [Google Scholar] [CrossRef] [PubMed]
  68. Mello, C.D.S.; Cabral-Castro, M.J.; de Faria, L.C.S.; Peralta, J.M.; Puccioni-Sohler, M. Dengue and chikungunya infection in neurologic disorders from endemic areas in Brazil. Neurol. Clin. Pract. 2019, 10, 497–502. [Google Scholar] [CrossRef]
  69. Angelo, J.R.; Fuller, T.L.; Leandro, B.B.S.; Praça, H.L.F.; Marques, R.D.; Ferreira, J.M.C.; Pupe, C.C.B.; Perez, O.C.; Nielsen-Saines, K.; Nascimento, O.J.M.; et al. Neurological complications associated with emerging viruses in Brazil. Int. J. Gynaecol. Obstet. 2020, 148 (Suppl. 2), 70–75. [Google Scholar] [CrossRef] [PubMed]
  70. Estofolete, C.F.; Milhim, B.H.G.A.; Zini, N.; Scamardi, S.N.; Selvante, J.D.; Vasilakis, N.; Nogueira, M.L. Flavivirus Infection Associated with Cerebrovascular Events. Viruses 2020, 12, 671. [Google Scholar] [CrossRef]
  71. Mehta, R.; Soares, C.N.; Medialdea-Carrera, R.; Ellul, M.; Da Silva, M.T.T.; Rosala-Hallas, A.; Jardim, M.R.; Burnside, G.; Pamplona, L.; Bhojak, M.; et al. The spectrum of neurological disease associated with Zika and chikungunya viruses in adults in Rio de Janeiro, Brazil: A case series. PLoS Negl. Trop. Dis. 2018, 12, e0006212. [Google Scholar] [CrossRef] [Green Version]
  72. Chiang, J.O.; Azevedo, R.S.; Justino, M.C.A.; Matos, H.J.; Cabeça, H.L.S.; Silva, S.P.; Henriques, D.F.; Silva, E.V.P.; Andrade, G.S.S.; Vasconcelos, P.F.C.; et al. Neurological disease caused by Oropouche virus in northern Brazil: Should it be included in the scope of clinical neurological diseases? J. NeuroVirology 2021, 27, 626–630. [Google Scholar] [CrossRef]
  73. Paixão, E.S.; Teixeira, M.G.; Costa, M.D.C.N.; Barreto, M.L.; Rodrigues, L.C. Symptomatic Dengue during Pregnancy and Congenital Neurologic Malformations. Emerg. Infect. Dis. 2018, 24, 1748–1750. [Google Scholar] [CrossRef]
  74. Akrami, K.M.; De Nogueira, B.M.F.; Rosário, M.S.D.; de Moraes, L.; Cordeiro, M.T.; Haddad, R.; Gomes, L.N.; Carvalho, I.D.P.; Pimentel, E.D.R.; Silva, J.D.J.; et al. The re-emergence of Zika in Brazil in 2020: A case of Guillain Barré Syndrome during the low season for arboviral infections. J. Travel Med. 2020, 27, taaa165. [Google Scholar] [CrossRef]
  75. Salimi, H.; Cain, M.D.; Klein, R.S. Encephalitic Arboviruses: Emergence, Clinical Presentation, and Neuropathogenesis. Neurotherapeutics 2016, 13, 514–534. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  76. Chanthamat, N.; Sathirapanya, P. Acute Transverse Myelitis Associated with Dengue Viral Infection. J. Spinal Cord Med. 2010, 33, 425–427. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  77. Kennedy, P.G. Viral encephalitis: Causes, differential diagnosis, and management. J. Neurol. Neurosurg. Psychiatry 2004, 75 (Suppl. 1), i10–i15. [Google Scholar] [CrossRef] [Green Version]
  78. Wright, J.K.; Castellani, L.; Lecce, C.; Khatib, A.; Bonta, M.; Boggild, A.K. Zika Virus-Associated Aseptic Meningitis and Guillain–Barre Syndrome in a Traveler Returning from Latin America: A Case Report and Mini-Review. Curr. Infect. Dis. Rep. 2019, 21, 3. [Google Scholar] [CrossRef] [PubMed]
  79. São José do Rio Preto. Secretaria Municipal de Saúde. Situação epidemiológica da Dengue e Chikungunya no município de São José do Rio Preto em 2019. São José do Rio Preto. 2019. Available online: https://saude.riopreto.sp.gov.br/transparencia/arqu/boleepid/2019/boletins_epidemiologico_dengue_2019.pdf (accessed on 26 August 2021).
  80. São José do Rio Preto. Secretaria Municipal de Saúde. Situação epidemiológica da Zika no município de São José do Rio Preto em 2019. São José do Rio Preto. 2019. Available online: https://saude.riopreto.sp.gov.br/transparencia/arqu/boleepid/2019/boletins_epidemiologico_zika_2019.pdf (accessed on 26 August 2021).
  81. Rocha, S.G.M.O.; Correia, L.L.; Da Cunha, A.J.L.A.; Rocha, H.A.L.; Leite, Á.; Campos, J.S.; Bandeira, T.d.J.P.G.; do Nascimento, L.S.; e Silva, A.C. Zika Virus Infection and Microcephaly: A Case-Control Study in Brazil. Ann. Glob. Health 2019, 85, 116. [Google Scholar] [CrossRef]
  82. Li, Y.; Muffat, J.; Javed, A.O.; Keys, H.R.; Lungjangwa, T.; Bosch, I.; Khan, M.; Virgilio, M.C.; Gehrke, L.; Sabatini, D.M.; et al. Genome-wide CRISPR screen for Zika virus resistance in human neural cells. Proc. Natl. Acad. Sci. USA 2019, 116, 9527–9532. [Google Scholar] [CrossRef] [Green Version]
  83. Shao, Q.; Herrlinger, S.; Yang, S.-L.; Lai, F.; Moore, J.M.; Brindley, M.A.; Chen, J.-F. Zika virus infection disrupts neurovascular development and results in postnatal microcephaly with brain damage. Development 2016, 143, 4127–4136. [Google Scholar] [CrossRef] [Green Version]
  84. Mladinich, M.C.; Schwedes, J.; Mackow, E.R. Zika Virus Persistently Infects and Is Basolaterally Released from Primary Human Brain Microvascular Endothelial Cells. mBio 2017, 8, e00952-17. [Google Scholar] [CrossRef] [Green Version]
  85. Dirlikov, E.; Major, C.G.; Mayshack, M.; Medina, N.; Matos, D.; Ryff, K.R.; Torres-Aponte, J.; Alkis, R.; Munoz-Jordan, J.; Colon-Sanchez, C.; et al. Guillain-Barré Syndrome During Ongoing Zika Virus Transmission—Puerto Rico, January 1–July 31, 2016. MMWR Morb. Mortal. Wkly. Rep. 2016, 65, 910–914. [Google Scholar] [CrossRef] [Green Version]
  86. Mancera-Páez, O.; Román, G.C.; Pardo-Turriago, R.; Rodríguez, Y.; Anaya, J.-M. Concurrent Guillain-Barré syndrome, transverse myelitis and encephalitis post-Zika: A case report and review of the pathogenic role of multiple arboviral immunity. J. Neurol. Sci. 2018, 395, 47–53. [Google Scholar] [CrossRef] [Green Version]
  87. Calvet, G.A.; Filippis, A.M.B.; Mendonça, M.C.L.; Sequeira, P.C.; Siqueira, A.M.; Veloso, V.G.; Nogueira, R.M.; Brasil, P. First detection of autochthonous Zika virus transmission in a HIV-infected patient in Rio de Janeiro, Brazil. J. Clin. Virol. 2015, 74, 1–3. [Google Scholar] [CrossRef] [PubMed]
  88. João, E.; Gouvea, M.I.F.D.S.; Teixeira, M.D.L.B.; da Silva, W.M.; Esteves, J.S.; Santos, E.M.; Ledesma, L.A.; Gomes, A.P.; Cruz, M.L. Zika Virus Infection Associated with Congenital Birth Defects in a HIV-infected Pregnant Woman. Pediatr. Infect. Dis. J. 2017, 36, 500–501. [Google Scholar] [CrossRef] [PubMed]
  89. Estofolete, C.F.; Terzian, A.C.B.; Colombo, T.E.; de Freitas Guimaraães, G.D.F.; Ferraz, H.C.J.; da Silva, R.A.; Greque, G.V.; Nogueira, M.L. Co-infection between Zika and different Dengue serotypes during DENV outbreak in Brazil. J. Infect. Public Health 2019, 12, 178–181. [Google Scholar] [CrossRef] [PubMed]
Table
Table 1. Clinical data from the positive patients in CSF samples.
Table 1. Clinical data from the positive patients in CSF samples.
IDGender,
Age		Clinical SyndromeSigns and SymptomsCSF CharacteristicsOther ObservationsDiagnostic Test
144Male, 61MeningitisFever, myalgia, lethargyLeukocytes 4 cells/mm3, lymphocytes 88%, neutrophils 2%, protein 44 mg/dL, glucose 90 mg/dL, culture negativeLeukopenia (2580 leukocytes/mm3); comorbidity: HIV infection ZIKVElisa IgM positive
177Female, 71Brain bleedingHeadacheLeukocytes 11 cells/mm3, lymphocytes 67%, neutrophils 10%, protein 90 mg/dL, glucose 64 mg/dL, culture negativeNo coagulation disorders detectedZIKVPCR positive
194Male, 74EncephalitisLethargy, mental confusion and decreased consciousness awarenessLeukocytes 17 cells/mm3, lymphocytes 67%, neutrophils 23%, protein 161 mg/dL, glucose 21 mg/dL, culture negative ZIKVPCR positive
248Female, 59Brain bleedingFever, náusea, irritability, respiratory distressLeukocytes 89 cells/mm3, lymphocytes 74%, neutrophils 6%, protein 71 mg/dL, glucose 82 mg/dL, culture negative ZIKVPCR positive
253Male, 56MeningitisFever, lethargy, dyspnea, mental confusionLeukocytes 39 cells/mm3, lymphocytes 50%, neutrophils 38%, protein 98 mg/dL, glucose 41 mg/dL, culture negativeComorbidity: HIV infectionZIKVPCR positive
257Female, 51Demyelinating polyneurophaty Myalgia, peripheral facial palsy, ataxy, decreased lower limbs strengthLeukocytes 11 cells/mm3, lymphocytes 95%, neutrophils 5%, protein 187 mg/dL, glucose 47 mg/dL, culture negativeComorbidity: HIV infectionZIKVPCR positive
272Male, 18MeningitisFever, headache Leukocytes 29 cells/mm3, lymphocytes 76%, neutrophils 6%, protein 81 mg/dL, glucose 79 mg/dL, culture negativeComorbidity: Hyper IgD syndromeZIKVPCR positive
04Female, 50EncephalitisAphasia, mental confusion, convulsive crisis and decreased consciousness awarenessLeukocytes 2 cells/mm3, lymphocytes 80%, neutrophils 8%, protein 91 mg/dL, glucose 69 mg/dL, culture negative DENVPCR positive
06Female, 65EncephalitisSpeech difficulty, drowsiness, decreased lower limbs strengthLeukocytes 1 cells/mm3, lymphocytes 85%, neutrophils 5%, protein 44 mg/dL, glucose 251 mg/dL, culture negative DENVPCR positive
CSF: cerebrospinal fluid; reference values: Leukocytes ≤ 3 cells/mm3, lymphocytes ≥ 90%, neutrophils ≤ 10%, protein ≤ 40 mg/dL, glucose ≥ 2/3 serum level, culture negative.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Milhim, B.H.G.A.; da Rocha, L.C.; Terzian, A.C.B.; Mazaro, C.C.P.; Augusto, M.T.; Luchs, A.; Zini, N.; Sacchetto, L.; dos Santos, B.F.; Garcia, P.H.C.; et al. Arboviral Infections in Neurological Disorders in Hospitalized Patients in São José do Rio Preto, São Paulo, Brazil. Viruses 2022, 14, 1488. https://doi.org/10.3390/v14071488

AMA Style

Milhim BHGA, da Rocha LC, Terzian ACB, Mazaro CCP, Augusto MT, Luchs A, Zini N, Sacchetto L, dos Santos BF, Garcia PHC, et al. Arboviral Infections in Neurological Disorders in Hospitalized Patients in São José do Rio Preto, São Paulo, Brazil. Viruses. 2022; 14(7):1488. https://doi.org/10.3390/v14071488

Chicago/Turabian Style

Milhim, Bruno H. G. A., Leonardo C. da Rocha, Ana C. B. Terzian, Carolina C. P. Mazaro, Marcos T. Augusto, Adriana Luchs, Nathalia Zini, Livia Sacchetto, Barbara F. dos Santos, Pedro H. C. Garcia, and et al. 2022. "Arboviral Infections in Neurological Disorders in Hospitalized Patients in São José do Rio Preto, São Paulo, Brazil" Viruses 14, no. 7: 1488. https://doi.org/10.3390/v14071488

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop