Host Responses to Live-Attenuated ASFV (HLJ/18–7GD)
Abstract
:1. Introduction
2. Materials and Methods
2.1. Virus Strains and Cells
2.2. Animal Experiments
2.3. Histopathology and Microscopic Tissue Evaluation
2.4. ASFV Detection
2.5. Measuring Specific Antibody Responses
2.6. Measuring Specific T-Cell Responses
2.7. Detection of NK Cell Cytotoxicity
2.8. Detection of Serum Cytokine by Luminex
2.9. Analysis of Relative Gene Expression by RT-qPCR
3. Results
3.1. Characterization of the In Vivo Pathogenesis of Attenuated HLJ/18-7GD
3.2. Host Antibody Response in Animals Infected with HLJ/18-7GD
3.3. Specific T Cell Response in Pigs Inoculated with HLJ/18-7GD
3.4. Changes in NK Cell Activity in Pigs Inoculated with HLJ/18-7GD
3.5. Evaluation of Cytokine Levels in Serum Samples
3.6. Evaluation of Relative Gene Expression in Tissue Samples
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Acknowledgments
Conflicts of Interest
References
- Linden, A.; Licoppe, A.; Volpe, R.; Paternostre, J.; Lesenfants, C.; Cassart, D.; Garigliany, M.; Tignon, M.; van den Berg, T.; Desmecht, D.; et al. Summer 2018: African swine fever virus hits north-western Europe. Transbound. Emerg. Dis. 2019, 66, 54–55. [Google Scholar] [CrossRef]
- Chapman, D.A.G.; Tcherepanov, V.; Upton, C.; Dixon, L.K. Comparison of the genome sequences of non-pathogenic and pathogenic African swine fever virus isolates. J. Gen. Virol. 2008, 89, 397–408. [Google Scholar] [CrossRef] [PubMed]
- Yáñez, R.J.; Rodríguez, J.M.; Nogal, M.L.; Yuste, L.; Enríquez, C.; Rodriguez, J.F.; Viñuela, E. Analysis of the complete nucleotide sequence of African swine fever virus. Virology 1995, 208, 249–278. [Google Scholar] [CrossRef] [PubMed]
- Blasco, R.; de la Vega, I.; Almazán, F.; Agüero, M.; Viñuela, E. Genetic variation of African swine fever virus: Variable regions near the ends of the viral DNA. Virology 1989, 173, 251–257. [Google Scholar] [CrossRef]
- Burrage, T.G.; Lu, Z.; Neilan, J.G.; Rock, D.L.; Zsak, L. African swine fever virus multigene family 360 genes affect virus replication and generalization of infection in Ornithodoros porcinus ticks. J. Virol. 2004, 78, 2445–2453. [Google Scholar] [CrossRef]
- Zsak, L.; Lu, Z.; Burrage, T.G.; Neilan, J.G.; Kutish, G.F.; Moore, D.M.; Rock, D.L. African swine fever virus multigene family 360 and 530 genes are novel macrophage host range determinants. J. Virol. 2001, 75, 3066–3076. [Google Scholar] [CrossRef]
- Golding, J.P.; Goatley, L.; Goodbourn, S.; Dixon, L.K.; Taylor, G.; Netherton, C.L. Sensitivity of African swine fever virus to type I interferon is linked to genes within multigene families 360 and 505. Virology 2016, 493, 154–161. [Google Scholar] [CrossRef]
- Afonso, C.L.; Piccone, M.E.; Zaffuto, K.M.; Neilan, J.; Kutish, G.F.; Lu, Z.; Balinsky, C.A.; Gibb, T.R.; Bean, T.J.; Zsak, L.; et al. African Swine Fever Virus Multigene Family 360 and 530 Genes Affect Host Interferon Response. J. Virol. 2004, 78, 1858–1864. [Google Scholar] [CrossRef]
- Sánchez-Cordón, P.J.; Jabbar, T.; Berrezaie, M.; Chapman, D.; Reis, A.; Sastre, P.; Rueda, P.; Goatley, L.; Dixon, L.K. Evaluation of protection induced by immunisation of domestic pigs with deletion mutant African swine fever virus BeninΔMGF by different doses and routes. Vaccine 2018, 36, 707–715. [Google Scholar] [CrossRef]
- O’Donnell, V.; Holinka, L.G.; Gladue, D.P.; Sanford, B.; Krug, P.W.; Lu, X.; Arzt, J.; Reese, B.; Carrillo, C.; Risatti, G.R.; et al. African Swine Fever Virus Georgia Isolate Harboring Deletions of MGF360 and MGF505 Genes Is Attenuated in Swine and Confers Protection against Challenge with Virulent Parental Virus. J. Virol. 2015, 89, 6048–6056. [Google Scholar] [CrossRef] [Green Version]
- Sanchez-Cordon, P.J.; Chapman, D.; Jabbar, T.; Reis, A.L.; Goatley, L.; Netherton, C.L.; Taylor, G.; Montoya, M.; Dixon, L. Different routes and doses influence protection in pigs immunised with the naturally attenuated African swine fever virus isolate OURT88/3. Antivir. Res. 2017, 138, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Oura, C.A.L.; Denyer, M.S.; Takamatsu, H.; Parkhouse, R.M.E. In vivo depletion of CD8+ T lymphocytes abrogates protective immunity to African swine fever virus. J. Gen. Virol. 2005, 86, 2445–2450. [Google Scholar] [CrossRef] [PubMed]
- Sánchez-Cordón, P.J.; Jabbar, T.; Chapman, D.; Dixon, L.K.; Montoya, M. Absence of Long-Term Protection in Domestic Pigs Immunized with Attenuated African Swine Fever Virus Isolate OURT88/3 or BeninΔMGF Correlates with Increased Levels of Regulatory T Cells and Interleukin-10. J. Virol. 2020, 94, e00350-20. [Google Scholar] [CrossRef] [PubMed]
- Leitão, A.; Cartaxeiro, C.; Coelho, R.; Cruz, B.; Parkhouse, R.M.E.; Portugal, F.C.; Vigário, J.D.; Martins, C.L.V. The non-haemadsorbing African swine fever virus isolate ASFV/NH/P68 provides a model for defining the protective anti-virus immune response. J. Gen. Virol. 2001, 82, 513–523. [Google Scholar] [CrossRef]
- Alejo, A.; Matamoros, T.; Guerra, M.; Andrés, G. A Proteomic Atlas of the African Swine Fever Virus Particle. J. Virol. 2018, 92, e01293-18. [Google Scholar] [CrossRef] [PubMed]
- Pérez-Núñez, D.; García-Urdiales, E.; Martínez-Bonet, M.; Nogal, M.L.; Barroso, S.; Revilla, Y.; Madrid, R. CD2v Interacts with Adaptor Protein AP-1 during African Swine Fever Infection. PLoS ONE 2015, 10, e0123714. [Google Scholar]
- Borca, M.V.; Carrillo, C.; Zsak, L.; Laegreid, W.W.; Kutish, G.F.; Neilan, J.G.; Burrage, T.G.; Rock, D.L. Deletion of a CD2-like gene, 8-DR, from African swine fever virus affects viral infection in domestic swine. J. Virol. 1998, 72, 2881–2889. [Google Scholar] [CrossRef]
- Monteagudo, P.L.; Lacasta, A.; López, E.; Bosch, L.; Collado, J.; Pina-Pedrero, S.; Correa-Fiz, F.; Accensi, F.; Navas, M.J.; Vidal, E.; et al. BA71ΔCD2: A New Recombinant Live Attenuated African Swine Fever Virus with Cross-Protective Capabilities. J. Virol. 2017, 91, e01058-17. [Google Scholar] [CrossRef]
- Chen, W.; Zhao, D.; He, X.; Liu, R.; Wang, Z.; Zhang, X.; Li, F.; Shan, D.; Chen, H.; Zhang, J.; et al. A seven-gene-deleted African swine fever virus is safe and effective as a live attenuated vaccine in pigs. Sci. China Life Sci. 2020, 63, 623–634. [Google Scholar] [CrossRef]
- Zhao, D.; Liu, R.; Zhang, X.; Li, F.; Wang, J.; Zhang, J.; Liu, X.; Wang, L.; Zhang, J.; Wu, X.; et al. Replication and virulence in pigs of the first African swine fever virus isolated in China. Emerg. Microbes Infect. 2019, 8, 438–447. [Google Scholar] [CrossRef]
- Zhang, Y.; Ke, J.; Zhang, J.; Yang, J.; Yue, H.; Zhou, X.; Qi, Y.; Zhu, R.; Miao, F.; Li, Q.; et al. African Swine Fever Virus Bearing an I226R Gene Deletion Elicits Robust Immunity in Pigs to African Swine Fever. J. Virol. 2021, 95, e0119921. [Google Scholar] [CrossRef] [PubMed]
- MacArthur Clark, J.A.; Sun, D. Guidelines for the ethical review of laboratory animal welfare People’s Republic of China National Standard GB/T 35892–2018 [Issued 6 February 2018 Effective from 1 September 2018]. Anim. Model. Exp. Med. 2020, 3, 103–113. [Google Scholar] [CrossRef] [PubMed]
- Argilaguet, J.M.; Perez-Martin, E.; Nofrarias, M.; Gallardo, C.; Accensi, F.; Lacasta, A.; Mora, M.; Ballester, M.; Galindo-Cardiel, I.; Lopez-Soria, S.; et al. DNA vaccination partially protects against African swine fever virus lethal challenge in the absence of antibodies. PLoS ONE 2012, 7, e40942. [Google Scholar]
- Crisci, E.; Fraile, L.; Moreno, N.; Blanco, E.; Cabezón, R.; Costa, C.; Mussá, T.; Baratelli, M.; Martinez-Orellana, P.; Ganges, L.; et al. Chimeric calicivirus-like particles elicit specific immune responses in pigs. Vaccine 2012, 30, 2427–2439. [Google Scholar] [CrossRef]
- Takamatsu, H.H.; Denyer, M.S.; Lacasta, A.; Stirling, C.M.; Argilaguet, J.M.; Netherton, C.L.; Oura, C.A.; Martins, C.; Rodriguez, F. Cellular immunity in ASFV responses. Virus Res. 2013, 173, 110–121. [Google Scholar] [CrossRef]
- De Boer, C.J. Studies to determine neutralizing antibody in sera from animals recovered from African swine fever and laboratory animals inoculated with African virus with adjuvants. Arch. Gesamte Virusforsch. 1967, 20, 164–179. [Google Scholar] [CrossRef]
- Neilan, J.G.; Zsak, L.; Lu, Z.; Burrage, T.G.; Kutish, G.F.; Rock, D.L. Neutralizing antibodies to African swine fever virus proteins p30, p54, and p72 are not sufficient for antibody-mediated protection. Virology 2004, 319, 337–342. [Google Scholar] [CrossRef]
- Wardley, R.C.; Norley, S.G.; Wilkinson, P.J.; Williams, S. The role of antibody in protection against African swine fever virus. Vet. Immunol. Immunopathol. 1985, 9, 201–212. [Google Scholar] [CrossRef]
- Gómez-Puertas, P.; Rodríguez, F.; Oviedo, J.M.; Brun, A.; Alonso, C.; Escribano, J.M. The African swine fever virus proteins p54 and p30 are involved in two distinct steps of virus attachment and both contribute to the antibody-mediated protective immune response. Virology 1998, 243, 461–471. [Google Scholar] [CrossRef]
- Escribano, J.M.; Galindo, I.; Alonso, C. Antibody-mediated neutralization of African swine fever virus: Myths and facts. Virus Res. 2013, 173, 101–109. [Google Scholar] [CrossRef]
- Onisk, D.V.; Borca, M.V.; Kutish, G.; Kramer, E.; Irusta, P.; Rock, D.L. Passively transferred African swine fever virus antibodies protect swine against lethal infection. Virology 1994, 198, 350–354. [Google Scholar] [CrossRef] [PubMed]
- Gómez-Puertas, P.; Rodríguez, F.; Oviedo, J.M.; Ramiro-Ibáñez, F.; Ruiz-Gonzalvo, F.; Alonso, C.; Escribano, J.M. Neutralizing antibodies to different proteins of African swine fever virus inhibit both virus attachment and internalization. J. Virol. 1996, 70, 5689–5694. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schlafer, D.H.; Mebus, C.A.; McVicar, J.W. African swine fever in neonatal pigs: Passively acquired protection from colostrum or serum of recovered pigs. Am. J. Vet. Res. 1984, 45, 1367–1372. [Google Scholar] [PubMed]
- Schafer, A.; Franzoni, G.; Netherton, C.L.; Hartmann, L.; Blome, S.; Blohm, U. Adaptive Cellular Immunity against African Swine Fever Virus Infections. Pathogens 2022, 11, 274. [Google Scholar] [CrossRef]
- Lacasta, A.; Ballester, M.; Monteagudo, P.L.; Rodriguez, J.M.; Salas, M.L.; Accensi, F.; Pina-Pedrero, S.; Bensaid, A.; Argilaguet, J.; Lopez-Soria, S.; et al. Expression library immunization can confer protection against lethal challenge with African swine fever virus. J. Virol. 2014, 88, 13322–13332. [Google Scholar] [CrossRef]
- Lacasta, A.; Monteagudo, P.L.; Jimenez-Marin, A.; Accensi, F.; Ballester, M.; Argilaguet, J.; Galindo-Cardiel, I.; Segales, J.; Salas, M.L.; Dominguez, J.; et al. Live attenuated African swine fever viruses as ideal tools to dissect the mechanisms involved in viral pathogenesis and immune protection. Vet. Res. 2015, 46, 135. [Google Scholar] [CrossRef]
- Zeromski, J.; Mozer-Lisewska, I.; Kaczmarek, M.; Kowala-Piaskowska, A.; Sikora, J. NK cells prevalence, subsets and function in viral hepatitis C. Arch. Immunol. Ther. Exp. 2011, 59, 449–455. [Google Scholar] [CrossRef]
- Norley, S.G.; Wardley, R.C. Investigation of porcine natural-killer cell activity with reference to African swine-fever virus infection. Immunology 1983, 49, 593–597. [Google Scholar]
- Moore, K.W.; de Waal Malefyt, R.; Coffman, R.L.; O’Garra, A. Interleukin-10 and the interleukin-10 receptor. Annu. Rev. Immunol. 2001, 19, 683–765. [Google Scholar] [CrossRef]
- Zakaryan, H.; Cholakyans, V.; Simonyan, L.; Misakyan, A.; Karalova, E.; Chavushyan, A.; Karalyan, Z. A study of lymphoid organs and serum proinflammatory cytokines in pigs infected with African swine fever virus genotype II. Arch. Virol. 2015, 160, 1407–1414. [Google Scholar] [CrossRef]
- Franzoni, G.; Zinellu, S.; Carta, T.; De Ciucis, C.G.; Fruscione, F.; Anfossi, A.; Ledda, M.; Graham, S.P.; Dei Giudici, S.; Razzuoli, E.; et al. Analyses of the Impact of Immunosuppressive Cytokines on Porcine Macrophage Responses and Susceptibility to Infection to African Swine Fever Viruses. Pathogens 2022, 11, 166. [Google Scholar] [CrossRef] [PubMed]
- Fishbourne, E.; Abrams, C.C.; Takamatsu, H.H.; Dixon, L.K. Modulation of chemokine and chemokine receptor expression following infection of porcine macrophages with African swine fever virus. Vet. Microbiol. 2013, 162, 937–943. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Zhang, J.; Zhang, Y.; Yang, J.; Wang, L.; Qi, Y.; Han, X.; Zhou, X.; Miao, F.; Chen, T.; et al. Cytokine Storm in Domestic Pigs Induced by Infection of Virulent African Swine Fever Virus. Front. Vet. Sci. 2020, 7, 601641. [Google Scholar] [CrossRef]
- Martins, C.L.; Lawman, M.J.; Scholl, T.; Mebus, C.A.; Lunney, J.K. African swine fever virus specific porcine cytotoxic T cell activity. Arch. Virol. 1993, 129, 211–225. [Google Scholar] [CrossRef]
- Gil, S.; Sepúlveda, N.; Albina, E.; Leitão, A.; Martins, C. The low-virulent African swine fever virus (ASFV/NH/P68) induces enhanced expression and production of relevant regulatory cytokines (IFNalpha, TNFalpha and IL12p40) on porcine macrophages in comparison to the highly virulent ASFV/L60. Arch. Virol. 2008, 153, 1845–1854. [Google Scholar] [CrossRef] [PubMed]
- Salguero, F.J.; Ruiz-Villamor, E.; Bautista, M.J.; Sánchez-Cordón, P.J.; Carrasco, L.; Gómez-Villamandos, J.C. Changes in macrophages in spleen and lymph nodes during acute African swine fever: Expression of cytokines. Vet. Immunol. Immunopathol. 2002, 90, 11–22. [Google Scholar] [CrossRef]
Gene Name | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|
β-actin | CAGGTCATCACCATCGGCAACG | GACAGCACCGTGTTGGCGTAGAGGT |
IL-1α | GTGCTCAAAACGAAGACGAACC | CATATTGCCATGCTTTTCCCAGAA |
IL-1β | GGCCGCCAAGATATAACTGA | GGACCTCTGGGTATGGCTTTC |
IL-4 | TTGCTGCCCCAGAGAAC | TGTCAAGTCCGCTCAGG |
IL-6 | TGGCTACTGCCTTCCCTACC | CAGAGATTTTGCCGAGGATG |
IL-10 | CAGATGGGCGACTTGTTG | ACAGGGCAGAAATTGATGAC |
IL-12 | GGAGTATAAGAAGTACAGAGTGG | GATGTCCCTGATGAAGAAGC |
IL-18 | AGGGACATCAAGCCGTGTTT | CGGTCTGAGGTGCATTATCTGA |
IFN-α | TCAGCTGCAATGCCATCTG | AGGGAGAGATTCTCCTCATTTGTG |
IFN-γ | CAAAGCCATCAGTGAACTCATCA | TCTCTGGCCTTGGAACATAGTCT |
TNF-α | TTATTCAGGAGGGCGAGGT | AGCAAAAGGAGGCACAGAGG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Fan, Y.; Chen, W.; Jiang, C.; Zhang, X.; Sun, Y.; Liu, R.; Wang, J.; Yang, D.; Zhao, D.; Bu, Z.; et al. Host Responses to Live-Attenuated ASFV (HLJ/18–7GD). Viruses 2022, 14, 2003. https://doi.org/10.3390/v14092003
Fan Y, Chen W, Jiang C, Zhang X, Sun Y, Liu R, Wang J, Yang D, Zhao D, Bu Z, et al. Host Responses to Live-Attenuated ASFV (HLJ/18–7GD). Viruses. 2022; 14(9):2003. https://doi.org/10.3390/v14092003
Chicago/Turabian StyleFan, Yuqin, Weiye Chen, Chenggang Jiang, Xianfeng Zhang, Ying Sun, Renqiang Liu, Jingfei Wang, Decheng Yang, Dongming Zhao, Zhigao Bu, and et al. 2022. "Host Responses to Live-Attenuated ASFV (HLJ/18–7GD)" Viruses 14, no. 9: 2003. https://doi.org/10.3390/v14092003