Enhancing the Immunogenicity of RBD Protein Variants through Amino Acid E484 Mutation in SARS-CoV-2
Abstract
:1. Introduction
2. Materials and Methods
2.1. Bacterial Strains, Construction, and Growth Conditions
2.2. Protein Expression and Purification
2.3. SDS-PAGE and Immunoblotting
2.4. Mouse Immunization
2.5. Enzyme-Linked Immunosorbent Assay (ELISA)
2.6. Statistical Analysis
3. Results
3.1. The Nine RBD Protein Mutants Were Obtained by Prokaryotic Expression and Affinity Chromatography
3.2. The RBD Protein Mutants Possessed Antigenicity In Vitro
3.3. The Mutants E484K, E484Q, K417T-E484K-N501Y, and K417N-E484K-N501Y Displayed Excellent Immunogenicity in Mice
3.4. The Site E484 Has a Significant Impact on the Function of the RBD Protein
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Wu, J.T.; Leung, K.; Leung, G.M. Nowcasting and forecasting the potential domestic and international spread of the 2019-nCoV outbreak originating in Wuhan, China: A modelling study. Lancet 2020, 395, 689–697. [Google Scholar] [CrossRef]
- Sanche, S.; Lin, Y.T.; Xu, C.; Romero-Severson, E.; Hengartner, N.; Ke, R. High Contagiousness and Rapid Spread of Severe Acute Respiratory Syndrome Coronavirus 2. Emerg. Infect. Dis. 2020, 26, 1470–1477. [Google Scholar] [CrossRef] [PubMed]
- Harrison, A.G.; Lin, T.; Wang, P. Mechanisms of SARS-CoV-2 Transmission and Pathogenesis. Trends Immunol. 2020, 41, 1100–1115. [Google Scholar] [CrossRef] [PubMed]
- Hu, B.; Guo, H.; Zhou, P.; Shi, Z. Characteristics of SARS-CoV-2 and COVID-19. Nat. Rev. Microbiol. 2021, 19, 141–154. [Google Scholar] [CrossRef]
- Dai, L.; Gao, G.F. Viral targets for vaccines against COVID-19. Nat. Rev. Immunol. 2021, 21, 73–82. [Google Scholar] [CrossRef]
- Keech, C.; Albert, G.; Cho, I.; Robertson, A.; Reed, P.; Neal, S.; Plested, J.S.; Zhu, M.; Cloney-Clark, S.; Zhou, H.; et al. Phase 1–2 Trial of a SARS-CoV-2 Recombinant Spike Protein Nanoparticle Vaccine. N. Engl. J. Med. 2020, 383, 2320–2332. [Google Scholar] [CrossRef]
- Liu, X.; Drelich, A.; Li, W.; Chen, C.; Sun, Z.; Shi, M.; Adams, C.; Mellors, J.W.; Tseng, C.; Dimitrov, D.S. Enhanced elicitation of potent neutralizing antibodies by the SARS-CoV-2 spike receptor binding domain Fc fusion protein in mice. Vaccine 2020, 38, 7205–7212. [Google Scholar] [CrossRef]
- Lan, J.; Ge, J.; Yu, J.; Shan, S.; Zhou, H.; Fan, S.; Zhang, Q.; Shi, X.; Wang, Q.; Zhang, L.; et al. Structure of the SARS-CoV-2 spike receptor-binding domain bound to the ACE2 receptor. Nature 2020, 581, 215–220. [Google Scholar] [CrossRef]
- Xu, C.; Wang, Y.; Liu, C.; Zhang, C.; Han, W.; Hong, X.; Wang, Y.; Hong, Q.; Wang, S.; Zhao, Q.; et al. Conformational dynamics of SARS-CoV-2 trimeric spike glycoprotein in complex with receptor ACE2 revealed by cryo-EM. Sci. Adv. 2021, 7, eabe5575. [Google Scholar] [CrossRef]
- Yang, S.; Li, Y.; Dai, L.; Wang, J.; He, P.; Li, C.; Fang, X.; Wang, C.; Zhao, X.; Huang, E.; et al. Safety and immunogenicity of a recombinant tandem-repeat dimeric RBD-based protein subunit vaccine (ZF2001) against COVID-19 in adults: Two randomised, double-blind, placebo-controlled, phase 1 and 2 trials. Lancet Infect. Dis. 2021, 21, 1107–1119. [Google Scholar] [CrossRef]
- Gao, F.; An, C.; Bian, L.; Wang, Y.; Zhang, J.; Cui, B.; He, Q.; Yuan, Y.; Song, L.; Yang, J.; et al. Establishment of the first Chinese national standard for protein subunit SARS-CoV-2 vaccine. Vaccine 2022, 40, 2233–2239. [Google Scholar] [CrossRef]
- Lu, R.; Zhao, X.; Li, J.; Niu, P.; Yang, B.; Wu, H.; Wang, W.; Song, H.; Huang, B.; Zhu, N.; et al. Genomic characterisation and epidemiology of 2019 novel coronavirus: Implications for virus origins and receptor binding. Lancet 2020, 395, 565–574. [Google Scholar] [CrossRef]
- Weissman, D.; Alameh, M.; de Silva, T.; Collini, P.; Hornsby, H.; Brown, R.; LaBranche, C.C.; Edwards, R.J.; Sutherland, L.; Santra, S.; et al. D614G Spike Mutation Increases SARS CoV-2 Susceptibility to Neutralization. Cell Host Microbe 2021, 29, 23–31. [Google Scholar] [CrossRef]
- David, D. What scientists know about new, fast-spreading coronavirus variants. Nature 2021, 594, 19–20. [Google Scholar]
- Kannan, S.R.; Spratt, A.N.; Sharma, K.; Chand, H.S.; Byrareddy, S.N.; Singh, K. Omicron SARS-CoV-2 variant: Unique features and their impact on pre-existing antibodies. J. Autoimmun. 2022, 126, 102779. [Google Scholar] [CrossRef]
- Laffeber, C.; de Koning, K.; Kanaar, R.; Lebbink, J.H.G. Experimental Evidence for Enhanced Receptor Binding by Rapidly Spreading SARS-CoV-2 Variants. J. Mol. Biol. 2021, 433, 167058. [Google Scholar] [CrossRef]
- Kumar, V.; Singh, J.; Hasnain, S.E.; Sundar, D. Possible Link between Higher Transmissibility of Alpha, Kappa and Delta Variants of SARS-CoV-2 and Increased Structural Stability of Its Spike Protein and hACE2 Affinity. Int. J. Mol. Sci. 2021, 22, 9131. [Google Scholar] [CrossRef]
- Escalera, A.; Gonzalez-Reiche, A.S.; Aslam, S.; Mena, I.; Laporte, M.; Pearl, R.L.; Fossati, A.; Rathnasinghe, R.; Alshammary, H.; van de Guchte, A.; et al. Mutations in SARS-CoV-2 variants of concern link to increased spike cleavage and virus transmission. Cell Host Microbe 2022, 30, 373–387. [Google Scholar] [CrossRef]
- Biswas, S.; Dey, S.; Chatterjee, S.; Nandy, A. Combatting future variants of SARS-CoV-2 using an in-silico peptide vaccine approach by targeting the spike protein. Med. Hypotheses 2022, 161, 110810. [Google Scholar] [CrossRef]
- Chen, L.; Lu, L.; Choi, C.Y.; Cai, J.; Tsoi, H.; Chu, A.W.; Ip, J.D.; Chan, W.; Zhang, R.R.; Zhang, X.; et al. Impact of Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) Variant-Associated Receptor Binding Domain (RBD) Mutations on the Susceptibility to Serum Antibodies Elicited by Coronavirus Disease 2019 (COVID-19) Infection or Vaccination. Clin. Infect. Dis. 2022, 74, 1623–1630. [Google Scholar] [CrossRef]
- Li, C.; Wen, A.; Shen, B.; Lu, J.; Huang, Y.; Chang, Y. FastCloning: A highly simplified, purification-free, sequence- and ligation-independent PCR cloning method. BMC Biotechnol. 2011, 11, 92. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Han, P.; Li, L.; Liu, S.; Wang, Q.; Zhang, D.; Xu, Z.; Han, P.; Li, X.; Peng, Q.; Su, C.; et al. Receptor binding and complex structures of human ACE2 to spike RBD from omicron and delta SARS-CoV-2. Cell 2022, 185, 630–640. [Google Scholar] [CrossRef]
- Zhang, Y.; Wei, M.; Wu, Y.; Wang, J.; Hong, Y.; Huang, Y.; Yuan, L.; Ma, J.; Wang, K.; Wang, S.; et al. Cross-species tropism and antigenic landscapes of circulating SARS-CoV-2 variants. Cell Rep. 2022, 38, 110558. [Google Scholar] [CrossRef]
- Pérez-Then, E.; Lucas, C.; Monteiro, V.S.; Miric, M.; Brache, V.; Cochon, L.; Vogels, C.B.F.; Malik, A.A.; De la Cruz, E.; Jorge, A.; et al. Neutralizing antibodies against the SARS-CoV-2 Delta and Omicron variants following heterologous CoronaVac plus BNT162b2 booster vaccination. Nat. Med. 2022, 28, 481–485. [Google Scholar] [CrossRef]
- Guo, H.; Gao, Y.; Li, T.; Li, T.; Lu, Y.; Zheng, L.; Liu, Y.; Yang, T.; Luo, F.; Song, S.; et al. Structures of Omicron Spike complexes and implications for neutralizing antibody development. Cell Rep. 2022, 39, 110770. [Google Scholar] [CrossRef]
- Moreira, R.A.; Chwastyk, M.; Baker, J.L.; Guzman, H.V.; Poma, A.B. Quantitative determination of mechanical stability in the novel coronavirus spike protein. Nanoscale 2020, 12, 16409–16413. [Google Scholar] [CrossRef]
- Ren, W.; Sun, H.; Gao, G.F.; Chen, J.; Sun, S.; Zhao, R.; Gao, G.; Hu, Y.; Zhao, G.; Chen, Y.; et al. Recombinant SARS-CoV-2 spike S1-Fc fusion protein induced high levels of neutralizing responses in nonhuman primates. Vaccine 2020, 38, 5653–5658. [Google Scholar] [CrossRef]
- Su, Q.; Zou, Y.; Yi, Y.; Shen, L.; Ye, X.; Zhang, Y.; Wang, H.; Ke, H.; Song, J.; Hu, K.; et al. Recombinant SARS-CoV-2 RBD with a built in T helper epitope induces strong neutralization antibody response. Vaccine 2021, 39, 1241–1247. [Google Scholar] [CrossRef]
- Liu, H.; Wei, P.; Zhang, Q.; Chen, Z.; Aviszus, K.; Downing, W.; Peterson, S.; Reynoso, L.; Downey, G.P.; Frankel, S.K.; et al. 501Y.V2 and 501Y.V3 variants of SARS-CoV-2 lose binding to bamlanivimabin vitro. mAbs 2021, 13, 1919285. [Google Scholar] [CrossRef]
- Koehler, M.; Ray, A.; Moreira, R.A.; Juniku, B.; Poma, A.B.; Alsteens, D. Molecular insights into receptor binding energetics and neutralization of SARS-CoV-2 variants. Nat. Commun. 2021, 12, 6977. [Google Scholar] [CrossRef]
- Liu, H.; Zhang, Q.; Wei, P.; Chen, Z.; Aviszus, K.; Yang, J.; Downing, W.; Jiang, C.; Liang, B.; Reynoso, L.; et al. The basis of a more contagious 501Y.V1 variant of SARS-CoV-2. Cell Res. 2021, 31, 720–722. [Google Scholar] [CrossRef] [PubMed]
- Islam, M.R.; Rahman, M.S.; Amin, M.A.; Alam, A.; Siddique, M.A.; Sultana, M.; Hossain, M.A. Evidence of combined effect of amino acid substitutions within G-H and B-C loops of VP1 conferring serological heterogeneity in foot-and-mouth disease virus serotype A. Transbound. Emerg. Dis. 2021, 68, 375–384. [Google Scholar] [CrossRef]
- Wang, M.; Zhang, L.; Li, Q.; Wang, B.; Liang, Z.; Sun, Y.; Nie, J.; Wu, J.; Su, X.; Qu, X.; et al. Reduced sensitivity of the SARS-CoV-2 Lambda variant to monoclonal antibodies and neutralizing antibodies induced by infection and vaccination. Emerg. Microbes Infect. 2022, 11, 18–29. [Google Scholar] [CrossRef] [PubMed]
Primers Name | Sequence (5′-3′) |
---|---|
RBD-F | TCGCATCACCATCACCATCACAATATTACAAACTTGTGCCCTTTTG |
RBD-R | GAGTCCAAGCTCAGCTAATTTTACTCAAGTGTCTGTGGATCACGG |
K417T-F | CAAACTGGAACCATTGCTGATTATAATTATAAATTACC |
K417T-R | CAGCAATGGTTCCAGTTTGCCCTGGAGCGATTTGTC |
K417N-F | CAAACTGGAAACATTGCTGATTATAATTATAAATTACC |
K417N-R | CAGCAATGTTTCCAGTTTGCCCTGGAGCGATTTGTC |
L452R-F | ATAATTACCGCTATAGATTGTTTAGGAAGTCTAATC |
L452R-R | CAATCTATAGCGGTAATTATAATTACCACCAACCTTAG |
E484K-F | AATGGTGTTAAGGGTTTTAATTGTTACTTTCCTTTAC |
E484K-R | TTAAAACCCTTAACACCATTACAAGGTGTGCTACCG |
E484Q-F | AATGGTGTTCAGGGTTTTAATTGTTACTTTCCTTTAC |
E484Q-R | TTAAAACCCTGAACACCATTACAAGGTGTGCTACCG |
N501Y-F | CCAACCCACTTACGGTGTTGGTTACCAACCATACAGAG |
N501Y-R | CAACACCGTAAGTGGGTTGGAAACCATATGATTGT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, Z.; Wan, X.; Li, X.; Cai, S.; Wan, C. Enhancing the Immunogenicity of RBD Protein Variants through Amino Acid E484 Mutation in SARS-CoV-2. Viruses 2022, 14, 2020. https://doi.org/10.3390/v14092020
Zhang Z, Wan X, Li X, Cai S, Wan C. Enhancing the Immunogenicity of RBD Protein Variants through Amino Acid E484 Mutation in SARS-CoV-2. Viruses. 2022; 14(9):2020. https://doi.org/10.3390/v14092020
Chicago/Turabian StyleZhang, Zhikai, Xuan Wan, Xinyue Li, Shaoxi Cai, and Chengsong Wan. 2022. "Enhancing the Immunogenicity of RBD Protein Variants through Amino Acid E484 Mutation in SARS-CoV-2" Viruses 14, no. 9: 2020. https://doi.org/10.3390/v14092020