In Silico Identification of Cassava Genome-Encoded MicroRNAs with Predicted Potential for Targeting the ICMV-Kerala Begomoviral Pathogen of Cassava
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cassava Biological Data Retrieval
2.2. Potential miRNA Target Prediction in ICMV-Ker Genome
2.3. miRanda
2.4. RNA22
2.5. Tapirhybrid
2.6. psRNATarget
2.7. Mapping of Network-Based miRNA-Target Interactions
2.8. RNAfold
2.9. Free Energy (ΔG) Estimation of Duplex Binding
2.10. Statistical Analysis
3. Results
3.1. Cassava Locus-Derived mes-miRNAs Targeting ICMV-Ker Genome
3.2. Cassava miRNAs Targeting Virion-Sense ORFs
3.3. Cassava miRNAs Targeting Complementary-Sense ORFs
3.4. Cassava miRNAs Targeting Large Intergenic Region
3.5. Identification of Common and Unique Cassava miRNAs
3.6. Predicting Consensual Cassava miRNAs and Silencing ICMV-Ker Genome Sequences
3.7. Association of Cassava miRNAs with Corresponding Gene-Targets
3.8. Prediction of Consensual Secondary Structures
3.9. Evaluation of Free Energy (ΔG) of mRNA-miRNA Interactions
4. Discussion
5. Conclusions and Recommendations
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Malik, A.I.; Kongsil, P.; Nguyễn, V.A.; Ou, W.; Srean, P.; López-Lavalle, L.A.B.; Utsumi, Y.; Lu, C.; Kittipadakul, P.; Nguyễn, H.H. Cassava breeding and agronomy in Asia: 50 years of history and future directions. Breed. Sci. 2020, 70, 145–166. [Google Scholar] [CrossRef] [PubMed]
- De Carvalho, R.; Guerra, M. Cytogenetics of Manihot esculenta Crantz (cassava) and eight related species. Hereditas 2002, 136, 159–168. [Google Scholar] [CrossRef] [PubMed]
- Lyons, J.B.; Bredeson, J.V.; Mansfeld, B.N.; Bauchet, G.J.; Berry, J.; Boyher, A.; Mueller, L.A.; Rokhsar, D.S.; Bart, R.S. Current status and impending progress for cassava structural genomics. Plant Mol. Biol. 2021, 109, 177–191. [Google Scholar] [CrossRef] [PubMed]
- Hu, W.; Ji, C.; Liang, Z.; Ye, J.; Ou, W.; Ding, Z.; Zhou, G.; Tie, W.; Yan, Y.; Yang, J. Resequencing of 388 cassava accessions identifies valuable loci and selection for variation in heterozygosity. Genome Biol. 2021, 22, 316. [Google Scholar] [CrossRef]
- Shirima, R.R.; Wosula, E.N.; Hamza, A.A.; Mohammed, N.A.; Mouigni, H.; Nouhou, S.; Mchinda, N.M.; Ceasar, G.; Amour, M.; Njukwe, E. Epidemiological Analysis of Cassava Mosaic and Brown Streak Diseases, and Bemisia tabaci in the Comoros Islands. Viruses 2022, 14, 2165. [Google Scholar] [CrossRef]
- Chikoti, P.C.; Mulenga, R.M.; Tembo, M.; Sseruwagi, P. Cassava mosaic disease: A review of a threat to cassava production in Zambia. J. Plant Pathol. 2019, 101, 467–477. [Google Scholar] [CrossRef]
- Duraisamy, R.; Natesan, S.; Muthurajan, R.; Gandhi, K.; Lakshmanan, P.; Karuppusamy, N.; Chokkappan, M. Molecular studies on the transmission of Indian cassava mosaic virus (ICMV) and Sri Lankan cassava mosaic virus (SLCMV) in cassava by Bemisia tabaci and cloning of ICMV and SLCMV replicase gene from cassava. Mol. Biotechnol. 2013, 53, 150–158. [Google Scholar] [CrossRef]
- Jacobson, A.L.; Duffy, S.; Sseruwagi, P. Whitefly-transmitted viruses threatening cassava production in Africa. Curr. Opin. Virol. 2018, 33, 167–176. [Google Scholar] [CrossRef]
- Doungous, O.; Masky, B.; Levai, D.L.; Bahoya, J.A.; Minyaka, E.; Mavoungou, J.F.; Mutuku, J.M.; Pita, J.S. Cassava mosaic disease and its whitefly vector in Cameroon: Incidence, severity and whitefly numbers from field surveys. Crop Prot. 2022, 158, 106017. [Google Scholar] [CrossRef]
- Nigam, D. Genomic variation and diversification in begomovirus genome in implication to host and vector adaptation. Plants 2021, 10, 1706. [Google Scholar] [CrossRef]
- de Moya, R.S.; Brown, J.K.; Sweet, A.D.; Walden, K.K.; Paredes-Montero, J.R.; Waterhouse, R.M.; Johnson, K.P. Nuclear orthologs derived from whole genome sequencing indicate cryptic diversity in the Bemisia tabaci (Insecta: Aleyrodidae) complex of whiteflies. Diversity 2019, 11, 151. [Google Scholar] [CrossRef]
- Malik, A.I.; Sophearith, S.; Delaquis, E.; Cuellar, W.J.; Jimenez, J.; Newby, J.C. Susceptibility of Cassava Varieties to Disease Caused by Sri Lankan Cassava Mosaic Virus and Impacts on Yield by Use of Asymptomatic and Virus-Free Planting Material. Agronomy 2022, 12, 1658. [Google Scholar] [CrossRef]
- Sheat, S.; Zhang, X.; Winter, S. High-Throughput Virus Screening in Crosses of South American and African Cassava Germplasm Reveals Broad-Spectrum Resistance against Viruses Causing Cassava Brown Streak Disease and Cassava Mosaic Virus Disease. Agronomy 2022, 12, 1055. [Google Scholar] [CrossRef]
- Houngue, J.A.; Pita, J.S.; Cacaï, G.H.T.; Zandjanakou-Tachin, M.; Abidjo, E.A.; Ahanhanzo, C. Survey of farmers’ knowledge of cassava mosaic disease and their preferences for cassava cultivars in three agro-ecological zones in Benin. J. Ethnobiol. Ethnomedicine 2018, 14, 29. [Google Scholar] [CrossRef]
- Rothenstein, D.; Haible, D.; Dasgupta, I.; Dutt, N.; Patil, B.; Jeske, H. Biodiversity and recombination of cassava-infecting begomoviruses from southern India. Arch. Virol. 2006, 151, 55–69. [Google Scholar] [CrossRef]
- Saunders, K.; Salim, N.; Mali, V.R.; Malathi, V.G.; Briddon, R.; Markham, P.G.; Stanley, J. Characterisation of Sri Lankan cassava mosaic virus and Indian cassava mosaic virus: Evidence for acquisition of a DNA B component by a monopartite begomovirus. Virology 2002, 293, 63–74. [Google Scholar] [CrossRef]
- Patil, B.; Rajasubramaniam, S.; Bagchi, C.; Dasgupta, I. Both Indian cassava mosaic virus and Sri Lankan cassava mosaic virus are found in India and exhibit high variability as assessed by PCR-RFLP. Arch. Virol. 2005, 150, 389–397. [Google Scholar] [CrossRef]
- Fiallo-Olivé, E.; Lett, J.-M.; Martin, D.P.; Roumagnac, P.; Varsani, A.; Zerbini, F.M.; Navas-Castillo, J.; Consortium, I.R. ICTV virus taxonomy profile: Geminiviridae 2021. J. Gen. Virol. 2021, 102, 001696. [Google Scholar] [CrossRef]
- Xavier, C.A.; Godinho, M.T.; Mar, T.B.; Ferro, C.G.; Sande, O.F.; Silva, J.C.; Ramos-Sobrinho, R.; Nascimento, R.N.; Assunção, I.; Lima, G.S. Evolutionary dynamics of bipartite begomoviruses revealed by complete genome analysis. Mol. Ecol. 2021, 30, 3747–3767. [Google Scholar] [CrossRef] [PubMed]
- Reinhart, B.J.; Weinstein, E.G.; Rhoades, M.W.; Bartel, B.; Bartel, D.P. MicroRNAs in plants. Genes Dev. 2002, 16, 1616–1626. [Google Scholar] [CrossRef] [Green Version]
- Liu, W.-W.; Meng, J.; Cui, J.; Luan, Y.-S. Characterization and function of microRNA∗ s in plants. Front. Plant Sci. 2017, 8, 2200. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.J.; Zheng, B.; Yu, Y.; Won, S.Y.; Mo, B.; Chen, X. The role of Mediator in small and long noncoding RNA production in Arabidopsis thaliana. EMBO J. 2011, 30, 814–822. [Google Scholar] [CrossRef] [PubMed]
- Fang, X.; Cui, Y.; Li, Y.; Qi, Y. Transcription and processing of primary microRNAs are coupled by Elongator complex in Arabidopsis. Nat. Plants 2015, 1, 15075. [Google Scholar] [CrossRef] [PubMed]
- Fang, Y.; Spector, D.L. Identification of nuclear dicing bodies containing proteins for microRNA biogenesis in living Arabidopsis plants. Curr. Biol. 2007, 17, 818–823. [Google Scholar] [CrossRef] [PubMed]
- Manavella, P.A.; Koenig, D.; Weigel, D. Plant secondary siRNA production determined by microRNA-duplex structure. Proc. Natl. Acad. Sci. USA 2012, 109, 2461–2466. [Google Scholar] [CrossRef]
- Trobaugh, D.W.; Klimstra, W.B. MicroRNA regulation of RNA virus replication and pathogenesis. Trends Mol. Med. 2017, 23, 80–93. [Google Scholar] [CrossRef]
- Deng, Z.; Ma, L.; Zhang, P.; Zhu, H. Small RNAs Participate in Plant–Virus Interaction and Their Application in Plant Viral Defense. Int. J. Mol. Sci. 2022, 23, 696. [Google Scholar] [CrossRef]
- Mengistu, A.A.; Tenkegna, T.A. The role of miRNA in plant–virus interaction: A review. Mol. Biol. Rep. 2021, 48, 2853–2861. [Google Scholar] [CrossRef]
- Liang, C.; Hao, J.; Li, J.; Baker, B.; Luo, L. Artificial microRNA-mediated resistance to cucumber green mottle mosaic virus in Nicotiana benthamiana. Planta 2019, 250, 1591–1601. [Google Scholar] [CrossRef]
- Miao, S.; Liang, C.; Li, J.; Baker, B.; Luo, L. Polycistronic artificial microRNA-mediated resistance to cucumber green mottle mosaic virus in cucumber. Int. J. Mol. Sci. 2021, 22, 2237. [Google Scholar] [CrossRef]
- Zhou, L.; Yuan, Q.; Ai, X.; Chen, J.; Lu, Y.; Yan, F. Transgenic Rice Plants Expressing Artificial miRNA Targeting the Rice Stripe Virus MP Gene Are Highly Resistant to the Virus. Biology 2022, 11, 332. [Google Scholar] [CrossRef]
- Niu, Q.-W.; Lin, S.-S.; Reyes, J.L.; Chen, K.-C.; Wu, H.-W.; Yeh, S.-D.; Chua, N.-H. Expression of artificial microRNAs in transgenic Arabidopsis thaliana confers virus resistance. Nat. Biotechnol. 2006, 24, 1420–1428. [Google Scholar] [CrossRef]
- Lafforgue, G.; Martínez, F.; Niu, Q.-W.; Chua, N.-H.; Daròs, J.-A.; Elena, S.F. Improving the effectiveness of artificial microRNA (amiR)-mediated resistance against Turnip mosaic virus by combining two amiRs or by targeting highly conserved viral genomic regions. J. Virol. 2013, 87, 8254–8256. [Google Scholar] [CrossRef]
- Simón-Mateo, C.; García, J.A. MicroRNA-guided processing impairs Plum pox virus replication, but the virus readily evolves to escape this silencing mechanism. J. Virol. 2006, 80, 2429–2436. [Google Scholar] [CrossRef]
- Duan, C.-G.; Wang, C.-H.; Fang, R.-X.; Guo, H.-S. Artificial microRNAs highly accessible to targets confer efficient virus resistance in plants. J. Virol. 2008, 82, 11084–11095. [Google Scholar] [CrossRef]
- Jiang, F.; Song, Y.; Han, Q.; Zhu, C.; Wen, F. The choice of target site is crucial in artificial miRNA-mediated virus resistance in transgenic Nicotiana tabacum. Physiol. Mol. Plant Pathol. 2011, 76, 2–8. [Google Scholar] [CrossRef]
- Ali, I.; Amin, I.; Briddon, R.W.; Mansoor, S. Artificial microRNA-mediated resistance against the monopartite begomovirus Cotton leaf curl Burewala virus. Virol. J. 2013, 10, 231. [Google Scholar] [CrossRef]
- Petchthai, U.; Yee, C.S.L.; Wong, S.-M. Resistance to CymMV and ORSV in artificial microRNA transgenic Nicotiana benthamiana plants. Sci. Rep. 2018, 8, 9958. [Google Scholar] [CrossRef]
- Rogans, S.J.; Rey, C. Unveiling the micronome of Cassava (Manihot esculenta Crantz). PLoS ONE 2016, 11, e0147251. [Google Scholar] [CrossRef]
- Chen, X.; Xia, J.; Xia, Z.; Zhang, H.; Zeng, C.; Lu, C.; Zhang, W.; Wang, W. Potential functions of microRNAs in starch metabolism and development revealed by miRNA transcriptome profiling of cassava cultivars and their wild progenitor. BMC Plant Biol. 2015, 15, 33. [Google Scholar] [CrossRef] [Green Version]
- Yawichai, A.; Kalapanulak, S.; Thammarongtham, C.; Saithong, T. Genome-wide identification of putative MicroRNAs in cassava (Manihot esculenta Crantz) and their functional landscape in cellular regulation. BioMed Res. Int. 2019, 2019, 2019846. [Google Scholar] [CrossRef] [PubMed]
- Khatabi, B.; Arikit, S.; Xia, R.; Winter, S.; Oumar, D.; Mongomake, K.; Meyers, B.C.; Fondong, V.N. High-resolution identification and abundance profiling of cassava (Manihot esculenta Crantz) microRNAs. BMC Genom. 2016, 17, 85. [Google Scholar] [CrossRef] [PubMed]
- Kozomara, A.; Birgaoanu, M.; Griffiths-Jones, S. miRBase: From microRNA sequences to function. Nucleic Acids Res. 2019, 47, D155–D162. [Google Scholar] [CrossRef] [PubMed]
- Zeng, C.; Xia, J.; Chen, X.; Zhou, Y.; Peng, M.; Zhang, W. MicroRNA-like RNAs from the same miRNA precursors play a role in cassava chilling responses. Sci. Rep. 2017, 7, 17135. [Google Scholar] [CrossRef]
- Bizabani, C.; Rogans, S.J.; Rey, M.E.C. Differential miRNA profiles in South African cassava mosaic virus-infected cassava landraces reveal clues to susceptibility and tolerance to cassava mosaic disease. Virus Res. 2021, 303, 198400. [Google Scholar] [CrossRef]
- Sayers, E.W.; Bolton, E.E.; Brister, J.R.; Canese, K.; Chan, J.; Comeau, D.C.; Connor, R.; Funk, K.; Kelly, C.; Kim, S.; et al. Database resources of the national center for biotechnology information. Nucleic Acids Res. 2021, 50, D20–D26. [Google Scholar] [CrossRef]
- Enright, A.; John, B.; Gaul, U.; Tuschl, T.; Sander, C.; Marks, D. MicroRNA targets in Drosophila. Genome Biol. 2003, 5, R1. [Google Scholar] [CrossRef]
- John, B.; Enright, A.J.; Aravin, A.; Tuschl, T.; Sander, C.; Marks, D.S. Human microRNA targets. PLoS Biol. 2004, 2, e363. [Google Scholar] [CrossRef]
- Miranda, K.C.; Huynh, T.; Tay, Y.; Ang, Y.-S.; Tam, W.-L.; Thomson, A.M.; Lim, B.; Rigoutsos, I. A pattern-based method for the identification of MicroRNA binding sites and their corresponding heteroduplexes. Cell 2006, 126, 1203–1217. [Google Scholar] [CrossRef]
- Loher, P.; Rigoutsos, I. Interactive exploration of RNA22 microRNA target predictions. Bioinformatics 2012, 28, 3322–3323. [Google Scholar] [CrossRef] [Green Version]
- Bonnet, E.; He, Y.; Billiau, K.; Van de Peer, Y. TAPIR, a web server for the prediction of plant microRNA targets, including target mimics. Bioinformatics 2010, 26, 1566–1568. [Google Scholar] [CrossRef]
- Dai, X.; Zhao, P.X. psRNATarget: A plant small RNA target analysis server. Nucleic Acids Res. 2011, 39, W155–W159. [Google Scholar] [CrossRef]
- Dai, X.; Zhuang, Z.; Zhao, P.X. psRNATarget: A plant small RNA target analysis server (2017 release). Nucleic Acids Res. 2018, 46, W49–W54. [Google Scholar] [CrossRef]
- Krzywinski, M.; Schein, J.; Birol, I.; Connors, J.; Gascoyne, R.; Horsman, D.; Jones, S.J.; Marra, M.A. Circos: An information aesthetic for comparative genomics. Genome Res. 2009, 19, 1639–1645. [Google Scholar] [CrossRef]
- Lorenz, R.; Bernhart, S.H.; Höner zu Siederdissen, C.; Tafer, H.; Flamm, C.; Stadler, P.F.; Hofacker, I.L. ViennaRNA Package 2.0. Algorithms Mol. Biol. 2011, 6, 26. [Google Scholar] [CrossRef]
- Bernhart, S.H.; Tafer, H.; Mückstein, U.; Flamm, C.; Stadler, P.F.; Hofacker, I.L. Partition function and base pairing probabilities of RNA heterodimers. Algorithms Mol. Biol. 2006, 1, 3. [Google Scholar] [CrossRef]
- Gandrud, C. Reproducible Research with R and RStudio; Chapman and Hall/CRC: Boca Raton, FL, USA, 2018. [Google Scholar]
- Götz, M.; Popovski, S.; Kollenberg, M.; Gorovits, R.; Brown, J.K.; Cicero, J.M.; Czosnek, H.; Winter, S.; Ghanim, M. Implication of Bemisia tabaci heat shock protein 70 in begomovirus-whitefly interactions. J. Virol. 2012, 86, 13241–13252. [Google Scholar] [CrossRef]
- Ohnesorge, S.; Bejarano, E. Begomovirus coat protein interacts with a small heat-shock protein of its transmission vector (Bemisia tabaci). Insect Mol. Biol. 2009, 18, 693–703. [Google Scholar] [CrossRef]
- Palanichelvam, K.; Kunik, T.; Citovsky, V.; Gafni, Y. The capsid protein of tomato yellow leaf curl virus binds cooperatively to single-stranded DNA. J. Gen. Virol. 1998, 79, 2829–2833. [Google Scholar] [CrossRef]
- Pan, L.-L.; Chi, Y.; Liu, C.; Fan, Y.-Y.; Liu, S.-S. Mutations in the coat protein of a begomovirus result in altered transmission by different species of whitefly vectors. Virus Evol. 2020, 6, veaa014. [Google Scholar] [CrossRef]
- Hanley-Bowdoin, L.; Bejarano, E.R.; Robertson, D.; Mansoor, S. Geminiviruses: Masters at redirecting and reprogramming plant processes. Nat. Rev. Microbiol. 2013, 11, 777–788. [Google Scholar] [CrossRef] [PubMed]
- Hesketh, E.L.; Saunders, K.; Fisher, C.; Potze, J.; Stanley, J.; Lomonossoff, G.P.; Ranson, N.A. The 3.3 Å structure of a plant geminivirus using cryo-EM. Nat. Commun. 2018, 9, 2369. [Google Scholar] [CrossRef] [PubMed]
- Xu, X.; Zhang, Q.; Hong, J.; Li, Z.; Zhang, X.; Zhou, X. Cryo-EM structure of a begomovirus geminate particle. Int. J. Mol. Sci. 2019, 20, 1738. [Google Scholar] [CrossRef] [PubMed]
- Rojas, M.R.; Macedo, M.A.; Maliano, M.R.; Soto-Aguilar, M.; Souza, J.O.; Briddon, R.W.; Kenyon, L.; Rivera Bustamante, R.F.; Zerbini, F.M.; Adkins, S. World management of geminiviruses. Annu. Rev. Phytopathol. 2018, 56, 637–677. [Google Scholar] [CrossRef] [PubMed]
- Brown, J.K.; Zerbini, F.M.; Navas-Castillo, J.; Moriones, E.; Ramos-Sobrinho, R.; Silva, J.C.; Fiallo-Olivé, E.; Briddon, R.W.; Hernández-Zepeda, C.; Idris, A. Revision of Begomovirus taxonomy based on pairwise sequence comparisons. Arch. Virol. 2015, 160, 1593–1619. [Google Scholar] [CrossRef]
- Ashraf, M.A.; Shahid, A.A.; Rao, A.Q.; Bajwa, K.S.; Husnain, T. Functional characterization of a bidirectional plant promoter from cotton leaf curl Burewala virus using an Agrobacterium-mediated transient assay. Viruses 2014, 6, 223–242. [Google Scholar] [CrossRef]
- Ashraf, M.A.; Shahid, A.A.; Rao, A.Q.; Brown, J.K.; Husnain, T. Development and Evaluation of the Cotton Leaf Curl Kokhran Virus-Burewala Bidirectional Promoter for Enhanced Cry1Ac Endotoxin Expression in Bt Transgenic Cotton. Appl. Sci. 2022, 12, 1275. [Google Scholar] [CrossRef]
- Ashraf, M.A.; Feng, X.; Hu, X.; Ashraf, F.; Shen, L.; Iqbal, M.S.; Zhang, S. In silico identification of sugarcane (Saccharum officinarum L.) genome encoded microRNAs targeting sugarcane bacilliform virus. PLoS ONE 2022, 17, e0261807. [Google Scholar] [CrossRef]
- Ashraf, M.A.; Ashraf, F.; Feng, X.; Hu, X.; Shen, L.; Khan, J.; Zhang, S. Potential targets for evaluation of sugarcane yellow leaf virus resistance in sugarcane cultivars: In silico sugarcane miRNA and target network prediction. Biotechnol. Biotechnol. Equip. 2021, 35, 1980–1991. [Google Scholar] [CrossRef]
- Ashraf, F.; Ashraf, M.A.; Hu, X.; Zhang, S. A novel computational approach to the silencing of Sugarcane Bacilliform Guadeloupe A Virus determines potential host-derived MicroRNAs in sugarcane (Saccharum officinarum L.). PeerJ 2020, 8, e8359. [Google Scholar] [CrossRef] [Green Version]
- Gaafar, Y.Z.A.; Ziebell, H. Novel targets for engineering Physostegia chlorotic mottle and tomato brown rugose fruit virus-resistant tomatoes: In silico prediction of tomato microRNA targets. PeerJ 2020, 8, e10096. [Google Scholar] [CrossRef]
- Shahid, M.N.; Rashid, S.; Iqbal, M.S.; Jamal, A.; Khalid, S. In silico prediction of potential mirnas to target zymv in cucumis melo. Pak. J. Bot. 2022, 54, 1319–1325. [Google Scholar]
- Jabbar, B.; Iqbal, M.S.; Batcho, A.A.; Nasir, I.A.; Rashid, B.; Husnain, T.; Henry, R.J. Target prediction of candidate miRNAs from Oryza sativa for silencing the RYMV genome. Comput. Biol. Chem. 2019, 83, 107127. [Google Scholar] [CrossRef]
- Akhter, Y.; Khan, J.A. Genome wide identification of cotton (Gossypium hirsutum)-encoded microRNA targets against Cotton leaf curl Burewala virus. Gene 2018, 638, 60–65. [Google Scholar]
- Iqbal, M.S.; Jabbar, B.; Sharif, M.N.; Ali, Q.; Husnain, T.; Nasir, I.A. In silico MCMV silencing concludes potential host-derived miRNAs in maize. Front. Plant Sci. 2017, 8, 372. [Google Scholar] [CrossRef]
- Ashraf, M.A.; Tariq, H.K.; Hu, X.-W.; Khan, J.; Zou, Z. Computational Biology and Machine Learning Approaches Identify Rubber Tree (Hevea brasiliensis Muell. Arg.) Genome Encoded MicroRNAs Targeting Rubber Tree Virus 1. Appl. Sci. 2022, 12, 2908. [Google Scholar] [CrossRef]
- Zhang, D.; Zhang, N.; Shen, W.; Li, J.-F. Engineered artificial microRNA precursors facilitate cloning and gene silencing in arabidopsis and rice. Int. J. Mol. Sci. 2019, 20, 5620. [Google Scholar] [CrossRef]
- Yasir, M.; Motawaa, M.; Wang, Q.; Zhang, X.; Khalid, A.; Cai, X.; Li, F. Simple Webserver-Facilitated Method to Design and Synthesize Artificial miRNA Gene and Its Application in Engineering Viral Resistance. Plants 2022, 11, 2125. [Google Scholar] [CrossRef]
- Yang, X.; Zhang, L.; Yang, Y.; Schmid, M.; Wang, Y. miRNA mediated regulation and interaction between plants and pathogens. Int. J. Mol. Sci. 2021, 22, 2913. [Google Scholar] [CrossRef]
- Thody, J.; Moulton, V.; Mohorianu, I. PAREameters: A tool for computational inference of plant miRNA–mRNA targeting rules using small RNA and degradome sequencing data. Nucleic Acids Res. 2020, 48, 2258–2270. [Google Scholar] [CrossRef]
- Riffo-Campos, Á.L.; Riquelme, I.; Brebi-Mieville, P. Tools for sequence-based miRNA target prediction: What to choose? Int. J. Mol. Sci. 2016, 17, 1987. [Google Scholar] [CrossRef] [PubMed]
- Peterson, S.M.; Thompson, J.A.; Ufkin, M.L.; Sathyanarayana, P.; Liaw, L.; Congdon, C.B. Common features of microRNA target prediction tools. Front. Genet. 2014, 5, 23. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Doench, J.G.; Sharp, P.A. Specificity of microRNA target selection in translational repression. Genes Dev. 2004, 18, 504–511. [Google Scholar] [CrossRef] [PubMed]
- Ruhel, R.; Chakraborty, S. Multifunctional roles of geminivirus encoded replication initiator protein. VirusDisease 2019, 30, 66–73. [Google Scholar] [CrossRef]
- Patanun, O.; Lertpanyasampatha, M.; Sojikul, P.; Viboonjun, U.; Narangajavana, J. Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.). Mol. Biotechnol. 2013, 53, 257–269. [Google Scholar] [CrossRef]
- Li, S.; Yu, X.; Lei, N.; Cheng, Z.; Zhao, P.; He, Y.; Wang, W.; Peng, M. Genome-wide identification and functional prediction of cold and/or drought-responsive lncRNAs in cassava. Sci. Rep. 2017, 7, 45981. [Google Scholar] [CrossRef]
- Din, M.; Barozai, M.Y.K.; Baloch, I.A. Identification and functional analysis of new conserved microRNAs and their targets in potato (Solanum tuberosum L.). Turk. J. Bot. 2014, 38, 1199–1213. [Google Scholar] [CrossRef]
- Quillet, A.; Anouar, Y.; Lecroq, T.; Dubessy, C. Prediction methods for microRNA targets in bilaterian animals: Toward a better understanding by biologists. Comput. Struct. Biotechnol. J. 2021, 19, 5811–5825. [Google Scholar] [CrossRef]
- Oliveira, A.C.; Bovolenta, L.A.; Nachtigall, P.G.; Herkenhoff, M.E.; Lemke, N.; Pinhal, D. Combining results from distinct microRNA target prediction tools enhances the performance of analyses. Front. Genet. 2017, 8, 59. [Google Scholar] [CrossRef]
- Min, H.; Yoon, S. Got target?: Computational methods for microRNA target prediction and their extension. Exp. Mol. Med. 2010, 42, 233–244. [Google Scholar] [CrossRef]
- Witkos, T.M.; Koscianska, E.; Krzyzosiak, W.J. Practical aspects of microRNA target prediction. Curr. Mol. Med. 2011, 11, 93–109. [Google Scholar] [CrossRef]
- Zhao, T.; Wang, W.; Bai, X.; Qi, Y. Gene silencing by artificial microRNAs in Chlamydomonas. Plant J. 2009, 58, 157–164. [Google Scholar] [CrossRef]
- Schwab, R.; Ossowski, S.; Warthmann, N.; Weigel, D. Directed gene silencing with artificial microRNAs. Plant Micrornas Methods Protoc. 2010, 592, 71–88. [Google Scholar]
- Hirsch, A.J. The use of RNAi-based screens to identify host proteins involved in viral replication. Future Microbiol. 2010, 5, 303–311. [Google Scholar] [CrossRef]
- Kampmann, M.; Horlbeck, M.A.; Chen, Y.; Tsai, J.C.; Bassik, M.C.; Gilbert, L.A.; Villalta, J.E.; Kwon, S.C.; Chang, H.; Kim, V.N. Next-generation libraries for robust RNA interference-based genome-wide screens. Proc. Natl. Acad. Sci. 2015, 112, E3384–E3391. [Google Scholar] [CrossRef]
- Martin, S.; Chiramel, A.I.; Schmidt, M.L.; Chen, Y.-C.; Whitt, N.; Watt, A.; Dunham, E.C.; Shifflett, K.; Traeger, S.; Leske, A. A genome-wide siRNA screen identifies a druggable host pathway essential for the Ebola virus life cycle. Genome Med. 2018, 10, 58. [Google Scholar] [CrossRef]
- R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2022; Available online: https://www.r-project.org/ (accessed on 30 May 2022).
Tools | Algorithms | Organism | Features | Availability |
---|---|---|---|---|
miRanda | Local alignment | Human, rat, fly, worms | Seed pairing, multiple sites and conservation | Web server and source code |
RNA22 | FASTA | Human, mouse, fly and worms | Pattern recognition and folding energy | Only web server |
Tapirhybrid | FASTA | Plants | Seed pairing | Web server and source code |
psRNATarget | Smith-Waterman | Plants | Multiple sites, translation inhibition | Only web server |
RNAhybrid | Intermolecular hybridization | Any | Seed pairing and free energy | Web server |
Targetfinder | FASTA | Plants | Seed pairing | Only source code |
Target-align | Smith-Waterman | Plant | Target sites | Web server and source code |
TargetScan | Custom made | Mammals, flies, worms, fish | Seed pairing, free energy and conservation | Only Web server |
PicTar | FASTA | Vertebrates, flies, worms | Seed pairing, free energy and conservation | Only Web server |
ICMV-Ker Gene | miRanda | RNA22 | Tapirhybrid | psRNATarget |
---|---|---|---|---|
AV1 | mes-miR2950 | mes-miR535(a, b, c, d) | mes-miR160e, mes-miR395e, mes-miR482e, mes-miR535c and mes-miR2950 | mes-miR160 (e, f), mes-miR171 (g, h, i, j and k), mes-miR394 (a, b, c), mes-miR397, mes-miR408, mes-miR2111 (a, b) and mes-miR2950 |
AV2 | mes-miR394 (a, b, c) | |||
AC1 | mes-miR159 (c, d), mes-miR399e, mes-miR477 (a, b, c, d, e, f, g, h, I and k) and mes-miR1446 (a, b) | mes-miR159 (a, b, c, d), mes-miR319 (a, b, e, f, g, and h), mes-miR395 (a, b, c, d and e), mes-miR1446a and mes-miR2118 | mes-miR172 (e, f), mes-miR399e, mes-miR477 (f, g, h), mes-miR482d, mes-miR530 (a, b), and mes-miR1446a | mes-miR159 (a, b), mes-miR395 (a, b, c, d, e), mes-miR397, mes-miR399b, mes-miR530a, mes-miR827, mes-miR1446a and mes-miR2275 |
AC3 | mes-miR390b, | - | mes-miR403 (a, b) | mes-miR403 (a, b) |
AC4 | mes-miR159 (c, d) | mes-miR159 (a, b, c, d) and mes-miR319 (a, b, e, f, g and h) | mes-miR530 (a, b) | mes-miR159 (a, b), mes-miR397 and mes-miR530a |
LIR | mes-miR393 (a, b, c, d) | mes-miR399h | mes-miR395e | - |
Cassava miRNA | Position miRanda | Position RNA22 | Position TAPIR | Position psRNATarget | MFE * miRanda | MFE ** RNA22 | MFE Ratio Tapirhybrid | Expectation psRNATarget |
---|---|---|---|---|---|---|---|---|
mes-miR159c | 2263 | 2261 | −20.75 | −19.3 | ||||
mes-miR159d | 2263 | 2261 | −20.75 | −19.3 | ||||
mes-miR160e | 574 | 574 | 0.62 | 6.5 | ||||
mes-miR395a | 1789 | 1789 | −15.80 | 6.0 | ||||
mes-miR395b | 1789 | 1789 | −15.80 | 6.0 | ||||
mes-miR395c | 1789 | 1789 | −15.80 | 6.0 | ||||
mes-miR395d | 1789 | 1789 | −15.80 | 6.0 | ||||
mes-miR399e | 2561 | 2561 | −22.90 | 0.56 | ||||
mes-miR403a | 1446 | 1446 | 0.60 | 6.5 | ||||
mes-miR403b | 1446 | 1446 | 0.60 | 6.5 | ||||
mes-miR477f | 1592 | 1592 | −23.95 | 0.54 | ||||
mes-miR477g | 1592 | 1592 | −23.95 | 0.54 | ||||
mes-miR530a | 2425 | 2425 | 0.56 | 6.5 | ||||
mes-miR1446a | 2053 | 2051 | 2053 | 2053 | −23.11 | −20.30 | 0.63 | 6.0 |
mes-miR2950 | 639 | 639 | 639 | −20.15 | 0.5 | 6.5 |
miRNA ID | Accession ID | Mature Sequence (5′–3′) | Target Genes ORF(s) | Target Binding Locus Position |
---|---|---|---|---|
mes-miR159c | MIMAT0029177 | AUUGGAGUGAAGGGAGCUCUG | AC1/AC4 | 2261–2281 |
mes-miR159d | MIMAT0029191 | UGGAGAAGCAGGGCACAUGCU | AC1/AC4 | 2261–2281 |
mes-miR160e | MIMAT0029183 | UGCCUGGCUCCCUGAAUGCCAUC | AV1 | 574–596 |
mes-miR395a | MIMAT0029268 | CUGAAGUGUUUGGGGGAACUC | AC1 | 1789–1809 |
mes-miR395b | MIMAT0029269 | CUGAAGUGUUUGGGGGAACUC | AC1 | 1789–1809 |
mes-miR395c | MIMAT0029270 | CUGAAGUGUUUGGGGGAACUC | AC1 | 1789–1809 |
mes-miR395d | MIMAT0029271 | CUGAAGUGUUUGGGGGAACUC | AC1 | 1789–1809 |
mes-miR399e | MIMAT0029283 | UGCCAAAGGAGAUUUGCUCGG | AC1 | 2581–2581 |
mes-miR403a | MIMAT0029286 | UUAGAUUCACGCACAAACUCG | AC3 | 1446–1466 |
mes-miR403b | MIMAT0029287 | UUAGAUUCACGCACAAACUCG | AC3 | 1446–1466 |
mes-miR477f | MIMAT0029295 | AUCUCCCUCAAAGGCUUCCA | AC1 | 1592–1611 |
mes-miR477g | MIMAT0029296 | AUCUCCCUCAAAGGCUUCCA | AC1 | 1592–1611 |
mes-miR530a | MIMAT0029298 | UGCAUUUGCACCUGCACCUU | AC1/AC4 | 2425–2444 |
mes-miR1446a | MIMAT0029309 | UUCUGAACUCUCUCCCUCAU | AC1 | 2053–2072 |
mes-miR2950 | MIMAT0029305 | UUCCAUCUCUUGCACACUGGA | AV1 | 639–659 |
Cassava miRNA | miRNA-Target Pair | Locus Position | MFE (Kcal/mol) | Score | Complementarity (%) | Mode of Inhibition |
---|---|---|---|---|---|---|
mes-miR1446a | Query: 3′ uaCUCCCUCUCUCAAGUCUu 5′ |:|||| ||:|||| || Ref:5′ gaGGGGGAAAGGGTTCTGA 3′ | 2053–2072 | −23.11 | 142 | 88.24 | Cleavage |
mes-miR2950 | Query: 3’ aggucACACGUUCUCUACCUu 5′ || |||||| ||||| Ref: 5′ catccTGGGCAAGATATGGAt 3′ | 639–659 | −20.15 | 140 | 86.67 | Cleavage |
miRNA ID | Length miRNA | Length Precursor | MFE */Kcal/mol | AMFE ** | MFEI *** | (G+C)% |
---|---|---|---|---|---|---|
mes-MIR1446a | 20 nt | 131 nt | −52.90 | −40.38 | −1.01 | 39.69 |
mes-MIR2950 | 21 nt | 104 nt | −55.30 | −53.17 | −1.20 | 44.23 |
miRNA ID | Accession ID | miRNA-Target Sequence (5′–3′) | ΔG Duplex (Kcal/mol) | ΔG Binding (Kcal/mol) | |
---|---|---|---|---|---|
mes-miR1446a | MIMAT0029309 | 5′ UUCUGAACUCUCUCCCUCAU 3′ 5′ GAGGGGGAAAGGGTTCTGAT 3′ | −22.80 | −21.89 | |
mes-miR2950 | MIMAT0029305 | 5′ UUCCAUCUCUUGCACACUGGA 3′ 5′ CATCCTGGGCAAGATATGGAT 3′ | −17.90 | −14.82 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ashraf, M.A.; Ali, B.; Brown, J.K.; Shahid, I.; Yu, N. In Silico Identification of Cassava Genome-Encoded MicroRNAs with Predicted Potential for Targeting the ICMV-Kerala Begomoviral Pathogen of Cassava. Viruses 2023, 15, 486. https://doi.org/10.3390/v15020486
Ashraf MA, Ali B, Brown JK, Shahid I, Yu N. In Silico Identification of Cassava Genome-Encoded MicroRNAs with Predicted Potential for Targeting the ICMV-Kerala Begomoviral Pathogen of Cassava. Viruses. 2023; 15(2):486. https://doi.org/10.3390/v15020486
Chicago/Turabian StyleAshraf, Muhammad Aleem, Babar Ali, Judith K. Brown, Imran Shahid, and Naitong Yu. 2023. "In Silico Identification of Cassava Genome-Encoded MicroRNAs with Predicted Potential for Targeting the ICMV-Kerala Begomoviral Pathogen of Cassava" Viruses 15, no. 2: 486. https://doi.org/10.3390/v15020486