High-Resolution Genomic Profiling of a Genotype 3b Hepatitis C Virus from a Flare of an Occult Hepatitis Patient with Acute-on-Chronic Liver Failure
Abstract
:1. Introduction
2. Materials and Methods
2.1. Ethics
2.2. RNA Extraction and Reverse Transcription
2.3. Quantification of HCV RNA by Real-Time PCR (R-PCR)
2.4. HCV Genotyping
2.5. Cloning and Sequencing the Whole HCV Genome
2.6. Bioinformatics
3. Results
3.1. Clinical Features of the Patient
3.2. Diagnosis of Hepatitis C Infection
3.3. Cloning the Genome of HCV and Phylogenetic Analysis of the HCV
3.4. Sequence Profile of HCV Genome
3.5. Resistance-Associated Substitutions (RASs) in the Viral Genome
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Manns, M.P.; Buti, M.; Gane, E.; Pawlotsky, J.M.; Razavi, H.; Terrault, N.; Younossi, Z. Hepatitis C virus infection. Nat. Rev. Dis. Prim. 2017, 3, 17006. [Google Scholar] [CrossRef] [PubMed]
- Kuo, G.; Choo, Q.L.; Alter, H.J.; Gitnick, G.L.; Redeker, A.G.; Purcell, R.H.; Miyamura, T.; Dienstag, J.L.; Alter, M.J.; Stevens, C.E.; et al. An assay for circulating antibodies to a major etiologic virus of human non-A, non-B hepatitis. Science 1989, 244, 362–364. [Google Scholar] [CrossRef] [PubMed]
- Forner, A.; Llovet, J.M.; Bruix, J. Hepatocellular carcinoma. Lancet 2012, 379, 1245–1255. [Google Scholar] [CrossRef] [PubMed]
- Moradpour, D.; Penin, F.; Rice, C.M. Replication of hepatitis C virus. Nat. Rev. Microbiol. 2007, 5, 453–463. [Google Scholar] [CrossRef] [PubMed]
- Gu, M.; Rice, C.M. Structures of hepatitis C virus nonstructural proteins required for replicase assembly and function. Curr. Opin. Virol. 2013, 3, 129–136. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kohli, A.; Shaffer, A.; Sherman, A.; Kottilil, S. Treatment of hepatitis C: A systematic review. JAMA 2014, 312, 631–640. [Google Scholar] [CrossRef] [PubMed]
- Castillo, I.; Pardo, M.; Bartolome, J.; Ortiz-Movilla, N.; Rodriguez-Inigo, E.; de Lucas, S.; Salas, C.; Jimenez-Heffernan, J.A.; Perez-Mota, A.; Graus, J.; et al. Occult hepatitis C virus infection in patients in whom the etiology of persistently abnormal results of liver-function tests is unknown. J. Infect. Dis. 2004, 189, 7–14. [Google Scholar] [CrossRef] [Green Version]
- Austria, A.; Wu, G.Y. Occult Hepatitis C Virus Infection: A Review. J. Clin. Transl. Hepatol. 2018, 6, 155–160. [Google Scholar] [CrossRef] [Green Version]
- Castillo, I.; Bartolome, J.; Quiroga, J.A.; Barril, G.; Carreno, V. Diagnosis of Occult Hepatitis C Without the Need for a Liver Biopsy. J. Med. Virol. 2010, 82, 1554–1559. [Google Scholar] [CrossRef] [Green Version]
- Jalan, R.; Williams, R. Acute-on-chronic liver failure: Pathophysiological basis of therapeutic options. Blood Purif. 2002, 20, 252–261. [Google Scholar] [CrossRef]
- Arroyo, V.; Moreau, R.; Jalan, R. Acute-on-Chronic Liver Failure. N. Engl. J. Med. 2020, 382, 2137–2145. [Google Scholar] [CrossRef] [PubMed]
- Agrawal, S.; Rana, B.S.; Mitra, S.; Duseja, A.; Das, A.; Dhiman, R.K.; Chawla, Y. A Case of Acute-on-Chronic Liver Failure (ACLF) Due to An Uncommon Acute And Chronic Event. J. Clin. Exp. Hepatol. 2018, 8, 95–97. [Google Scholar] [CrossRef] [PubMed]
- Laskus, T.; Wilkinson, J.; Gallegos-Orozco, J.F.; Radkowski, M.; Adair, D.M.; Nowicki, M.; Operskalski, E.; Buskell, Z.; Seeff, L.B.; Vargas, H.; et al. Analysis of hepatitis C virus quasispecies transmission and evolution in patients infected through blood transfusion. Gastroenterology 2004, 127, 764–776. [Google Scholar] [CrossRef]
- Engle, R.E.; Russell, R.S.; Purcell, R.H.; Bukh, J. Development of a TaqMan assay for the six major genotypes of hepatitis C virus: Comparison with commercial assays. J. Med. Virol. 2008, 80, 72–79. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lole, K.S.; Jha, J.A.; Shrotri, S.P.; Tandon, B.N.; Prasad, V.G.M.; Arankalle, V.A. Comparison of hepatitis C virus genotyping by 5’ noncoding region- and core-based reverse transcriptase PCR assay with sequencing and use of the assay for determining subtype distribution in India. J. Clin. Microbiol. 2003, 41, 5240–5244. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tamura, K.; Nei, M. Estimation of the Number of Nucleotide Substitutions in the Control Region of Mitochondrial-DNA in Humans and Chimpanzees. Mol. Biol. Evol. 1993, 10, 512–526. [Google Scholar] [CrossRef] [Green Version]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [Green Version]
- Moreau, R.; Jalan, R.; Gines, P.; Pavesi, M.; Angeli, P.; Cordoba, J.; Durand, F.; Gustot, T.; Saliba, F.; Domenicali, M.; et al. Acute-on-Chronic Liver Failure Is a Distinct Syndrome That Develops in Patients With Acute Decompensation of Cirrhosis. Gastroenterology 2013, 144, 1426–1437.e9. [Google Scholar] [CrossRef]
- Wiesner, R.; Edwards, E.; Freeman, R.; Harper, A.; Kim, R.; Kamath, P.; Kremers, W.; Lake, J.; Howard, T.; Merion, R.M.; et al. Model for End-Stage Liver Disease (MELD) and allocation of donor livers. Gastroenterology 2003, 124, 91–96. [Google Scholar] [CrossRef] [Green Version]
- Singal, A.K.; Kamath, P.S. Model for End-stage Liver Disease. J. Clin. Exp. Hepatol. 2013, 3, 50–60. [Google Scholar] [CrossRef] [Green Version]
- Forns, X.; Purcell, R.H.; Bukh, J. Quasispecies in viral persistence and pathogenesis of hepatitis C virus. Trends Microbiol. 1999, 7, 402–410. [Google Scholar] [CrossRef] [PubMed]
- Ross-Thriepland, D.; Harris, M. Hepatitis C virus NS5A: Enigmatic but still promiscuous 10 years on! J. Gen. Virol. 2015, 96, 727–738. [Google Scholar] [CrossRef] [PubMed]
- Hezode, C.; Fourati, S.; Chevaliez, S.; Scoazec, G.; Soulier, A.; Varaut, A.; Francois, M.; Ruiz, I.; Roudot-Thoraval, F.; Mallat, A.; et al. Sofosbuvir-Daclatasvir-Simeprevir Plus Ribavirin in Direct-Acting Antiviral-Experienced Patients With Hepatitis C. Clin. Infect. Dis. 2017, 64, 1615–1618. [Google Scholar] [CrossRef] [PubMed]
- Nelson, D.R.; Cooper, J.N.; Lalezari, J.P.; Lawitz, E.; Pockros, P.J.; Gitlin, N.; Freilich, B.F.; Younes, Z.H.; Harlan, W.; Ghalib, R.; et al. All-Oral 12-Week Treatment With Daclatasvir Plus Sofosbuvir in Patients With Hepatitis C Virus Genotype 3 Infection: ALLY-3 Phase III Study. Hepatology 2015, 61, 1127–1135. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Smith, D.; Magri, A.; Bonsall, D.; Ip, C.L.C.; Trebes, A.; Brown, A.; Piazza, P.; Bowden, R.; Nguyen, D.; Ansari, M.A.; et al. Resistance analysis of genotype 3 hepatitis C virus indicates subtypes inherently resistant to nonstructural protein 5A inhibitors. Hepatology 2019, 69, 1861–1872. [Google Scholar] [CrossRef] [Green Version]
- Lontok, E.; Harrington, P.; Howe, A.; Kieffer, T.; Lennerstrand, J.; Lenz, O.; McPhee, F.; Mo, H.M.; Parkin, N.; Pilot-Matias, T.; et al. Hepatitis C virus drug resistance-associated substitutions: State of the art summary. Hepatology 2015, 62, 1623–1632. [Google Scholar] [CrossRef] [Green Version]
- Ballester, M.P.; Sittner, R.; Jalan, R. Alcohol and Acute-on-Chronic Liver Failure. J. Clin. Exp. Hepatol. 2022, 12, 1360–1370. [Google Scholar] [CrossRef]
- Qu, L.X.; Shi, Y.; Chen, K.Y.; Wang, W.; Ren, H. Analysis of integrated HCV surveillance in Shanghai, 2014–2019. Zhonghua Liu Xing Bing Xue Za Zhi 2021, 42, 626–631. [Google Scholar] [CrossRef]
Fragment | Primer | Sequence (5′–3′) | Product |
---|---|---|---|
F1 | Sense | ACCTGCCTCTTTCGAGGCGACACTCCACC | 1.4 kb |
Antisense | GCCATYACGCCCCAGTGGGC | ||
F2 | Sense | GCCCACTGGGGCGTRATGGC | 1.3 kb |
Antisense | AGCTTCCCCCGRATGTGCCA | ||
F3 | Sense | TGGCACATYCGGGGGAAGCT | 2.5 kb |
Antisense | GCGTATGAGACATTTCCACATCTCATCCC | ||
F4 | Sense | GGGATGAGATGTGGAAATGTCTCATACGC | 1.8 kb |
Antisense | GGAGCYGAGAGCTGGCTGGCA | ||
F5 | Sense | TGCCAGCCAGCTCTCRGCTCC | 1.1 kb |
Antisense | AGGGCGCGTTTCTCACAGAC | ||
F6 | Sense | GTCTGTGAGAAACGCGCCCT | 900 bp |
Antisense | GCGAGAACGCGCTCAAACCATGGA |
Date | CD3 Cell (690–2540 cells/μL) | CD8 Cell (190–1140 cells/μL) | CD4 Cell (410–1590 cells/μL) | CD45 Cell (900–3500 cells/μL) | HDL (1.04–1.55 mmol/L) | LDL (2.59–4.11 mmol/L) |
---|---|---|---|---|---|---|
4 June 2018 | 315 | 118 | 169 | 551 | 0.32 | 3.04 |
15 August 2018 | 327 | 144 | 127 | 349 | 0.22 | 1.31 |
12 November 2018 | NA | NA | NA | NA | 0.35 | 1.02 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mei, X.; Zou, J.; Shi, B.; Qian, Z.; Yi, Z. High-Resolution Genomic Profiling of a Genotype 3b Hepatitis C Virus from a Flare of an Occult Hepatitis Patient with Acute-on-Chronic Liver Failure. Viruses 2023, 15, 634. https://doi.org/10.3390/v15030634
Mei X, Zou J, Shi B, Qian Z, Yi Z. High-Resolution Genomic Profiling of a Genotype 3b Hepatitis C Virus from a Flare of an Occult Hepatitis Patient with Acute-on-Chronic Liver Failure. Viruses. 2023; 15(3):634. https://doi.org/10.3390/v15030634
Chicago/Turabian StyleMei, Xue, Jingyi Zou, Bisheng Shi, Zhiping Qian, and Zhigang Yi. 2023. "High-Resolution Genomic Profiling of a Genotype 3b Hepatitis C Virus from a Flare of an Occult Hepatitis Patient with Acute-on-Chronic Liver Failure" Viruses 15, no. 3: 634. https://doi.org/10.3390/v15030634